ID: 1112569549

View in Genome Browser
Species Human (GRCh38)
Location 13:100581286-100581308
Sequence GCTGAACCTAAGACTGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 195}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112569543_1112569549 11 Left 1112569543 13:100581252-100581274 CCAACAGAGGGGACCAGGGTTCC 0: 1
1: 0
2: 2
3: 17
4: 183
Right 1112569549 13:100581286-100581308 GCTGAACCTAAGACTGAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 195
1112569545_1112569549 -2 Left 1112569545 13:100581265-100581287 CCAGGGTTCCCCAGAGAAACGGC 0: 1
1: 0
2: 6
3: 67
4: 306
Right 1112569549 13:100581286-100581308 GCTGAACCTAAGACTGAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 195
1112569540_1112569549 17 Left 1112569540 13:100581246-100581268 CCATCTCCAACAGAGGGGACCAG 0: 1
1: 0
2: 3
3: 46
4: 416
Right 1112569549 13:100581286-100581308 GCTGAACCTAAGACTGAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 195
1112569546_1112569549 -10 Left 1112569546 13:100581273-100581295 CCCCAGAGAAACGGCTGAACCTA 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1112569549 13:100581286-100581308 GCTGAACCTAAGACTGAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112569549 Original CRISPR GCTGAACCTAAGACTGAAGC AGG Intronic
903079901 1:20801612-20801634 GCTGATTCTAGGACTGAGGCAGG + Intergenic
904406526 1:30293820-30293842 GCTGATTCTAGGACTGAGGCAGG + Intergenic
906030706 1:42717942-42717964 GGTGACCCTCAGACTGCAGCAGG + Intergenic
914762538 1:150610748-150610770 GCTGTACCAGAGGCTGAAGCAGG - Intronic
918623038 1:186626714-186626736 GCTGAACCACAGAGTCAAGCTGG - Intergenic
919364191 1:196636242-196636264 GCTGATTCTAGGACTGAGGCAGG + Intergenic
919555298 1:199045827-199045849 GCTGAAGCTGAGACTGAACAGGG + Intergenic
1063026514 10:2184120-2184142 GCTGACCCTAGGACTGGGGCAGG + Intergenic
1066100839 10:32117114-32117136 ACTGAACCTATGACTGTGGCTGG - Intergenic
1070837115 10:79455746-79455768 GCTGACTCTAAGACTAGAGCAGG + Intergenic
1074596623 10:114873864-114873886 GCTGATCCTAGGACTGGGGCAGG - Intronic
1074702319 10:116103316-116103338 GCTGAACATTAGAATGAACCAGG - Intronic
1076345430 10:129775800-129775822 TCTGAACCAAAGCCTGAAGTGGG + Intergenic
1076611332 10:131727647-131727669 GCTGGACCTGAGAATGAAGCCGG - Intergenic
1076619108 10:131775691-131775713 GCTGAACCTGTGTCTGCAGCTGG + Intergenic
1076637758 10:131893421-131893443 GCTGAATCTCTGACTGCAGCTGG + Intergenic
1077333329 11:1992928-1992950 GCTGAACCTCAGGGTGAGGCGGG - Intergenic
1079092807 11:17492919-17492941 GCTGAACATAGGGCTGAACCTGG + Intergenic
1079150096 11:17890776-17890798 GCTGATTCTAGGACTGAGGCAGG + Intronic
1082275637 11:50218306-50218328 GCTGATTCTAGGACTGCAGCAGG - Intergenic
1085148732 11:74229914-74229936 TTTGAACCTAAGATTGAAACTGG - Intronic
1086756554 11:90571128-90571150 CCTGAACCTAATACAAAAGCTGG - Intergenic
1087008646 11:93493255-93493277 AGTGGACCTAAGACTGGAGCTGG - Intronic
1087462698 11:98464888-98464910 GCTGATTCTAAGACTGGGGCAGG - Intergenic
1090112635 11:123931054-123931076 GCTGATTCTAAAACTGAGGCAGG - Intergenic
1091306959 11:134542454-134542476 GCTGAACCTAAGCATGAAAATGG - Intergenic
1202816309 11_KI270721v1_random:48109-48131 GCTGAACCTCAGGGTGAGGCGGG - Intergenic
1092253303 12:6913380-6913402 GCTGGACCTAGGAGAGAAGCAGG + Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1094724194 12:33095757-33095779 TCTGAATATAAGACAGAAGCAGG + Intergenic
1097102917 12:56601944-56601966 GCTGAGCCTCAGGCTGAAGCTGG + Exonic
1099122751 12:78712150-78712172 GCTGAAACCAAGAATGAAACAGG + Intergenic
1102083341 12:110115994-110116016 GCTGCCCCTAAGCCTGAAGCAGG - Intergenic
1102708856 12:114907649-114907671 GAAGAAACTAAGACTTAAGCAGG - Intergenic
1105776538 13:23667298-23667320 GCTGAATATATCACTGAAGCTGG - Intronic
1107526558 13:41238192-41238214 GCTGACTCTAAGTCTGAGGCAGG + Intronic
1108180964 13:47839375-47839397 GCTCACCCTAGGTCTGAAGCTGG - Intergenic
1109604688 13:64677425-64677447 CCTGAACCTAAGATAAAAGCTGG + Intergenic
1110124723 13:71928463-71928485 GGTGAACCTGAGCTTGAAGCTGG + Intergenic
1111856736 13:93647471-93647493 GAGGAACATAAGACTGAACCGGG + Intronic
1112569549 13:100581286-100581308 GCTGAACCTAAGACTGAAGCAGG + Intronic
1114639236 14:24207876-24207898 GTTGGACCTAAGAAAGAAGCAGG - Intronic
1115899626 14:38130019-38130041 CCTGAATGTAAGACTGAAACAGG - Intergenic
1118231846 14:63959049-63959071 ACTGATCCTAAGACTGGGGCAGG - Intronic
1119297242 14:73542945-73542967 GTTGAACCTGAGTCTGAATCTGG - Intronic
1120833361 14:89017683-89017705 CCTGAACCAAATACCGAAGCAGG + Intergenic
1122185929 14:99996020-99996042 ACTGAATCTAAGACAGAAGTGGG - Intronic
1124429705 15:29595972-29595994 GCTGAACCTAGGACTCAGGTTGG - Intergenic
1125110127 15:36022866-36022888 ACTGCACCTGAGACTGAAGGAGG + Intergenic
1125373331 15:39001289-39001311 ACTGAACCTAAGACTGACAGAGG + Intergenic
1125818629 15:42608407-42608429 GCTGAACCCAACAATGAAACCGG + Intronic
1127302647 15:57671649-57671671 GATGGACTTAAGACTGAAGATGG - Intronic
1128809733 15:70562096-70562118 CCTGCACCTGAGCCTGAAGCTGG + Intergenic
1128821026 15:70653722-70653744 ACTGAACCTGAGACTGTTGCTGG - Intergenic
1128824689 15:70702595-70702617 GATGATCCTAAGACTGAAACTGG - Intronic
1130139929 15:81216432-81216454 GCTGAAGCTGAGGCTGAAGAGGG - Intronic
1131155190 15:90070705-90070727 GCTACACATGAGACTGAAGCAGG + Intronic
1131893444 15:96999847-96999869 GCTGAAGCAAACACTGAAGAAGG - Intergenic
1132435835 15:101801719-101801741 GTTGAATCTAAGACAAAAGCAGG + Intergenic
1132939602 16:2500264-2500286 GCTGCACCTCAGGCTGCAGCTGG - Exonic
1134616857 16:15658183-15658205 GCTGGAGGTAAGCCTGAAGCCGG - Intronic
1135140136 16:19914130-19914152 GCTGCTCAGAAGACTGAAGCTGG - Intergenic
1135622137 16:23965008-23965030 CCTGAACCTGAAACTGAAGCTGG - Intronic
1140182554 16:72735190-72735212 ACTGAACCTATGACTGATTCAGG - Intergenic
1143582091 17:7833594-7833616 GTTGCACCTAGGACTGAGGCCGG + Exonic
1143680937 17:8475633-8475655 ATTGTACCTAAGTCTGAAGCAGG + Exonic
1143737010 17:8918262-8918284 GCTGATCCTAGGATTGAAACAGG + Intronic
1144814969 17:18027618-18027640 GCTGGACCTAAGAGTGTAGCTGG + Intronic
1147184223 17:38705112-38705134 CCTGAACCTAAGACTTTACCCGG + Intergenic
1149194340 17:54102109-54102131 ACTGAACCTGAGGCTGAAGAGGG + Intergenic
1149421146 17:56511547-56511569 GTGGCACCTATGACTGAAGCTGG + Intronic
1150662338 17:67094032-67094054 ACTGAACCTAAGATAAAAGCTGG + Intronic
1151166892 17:72211561-72211583 TGTGAACCCAAGAATGAAGCTGG - Intergenic
1151776917 17:76210914-76210936 GCTGCTCCAGAGACTGAAGCAGG - Intronic
1153118752 18:1693958-1693980 GCTGAATGTAGGACTGGAGCTGG - Intergenic
1157149452 18:45201635-45201657 GCTGATTCTAAGGCTGAAACAGG - Intergenic
1159378666 18:67628452-67628474 GCTGCTCCTGAGGCTGAAGCAGG - Intergenic
1161655015 19:5508882-5508904 GCTGAAACTCAGATTGAACCCGG - Intergenic
1165993422 19:39828452-39828474 GCTGAACCTGACCCGGAAGCTGG - Exonic
926413066 2:12625098-12625120 GCTGAACCAAAGACCTAGGCGGG - Intergenic
926479688 2:13377155-13377177 GCCGAAGCCAAGACTGAAGAGGG + Intergenic
926629371 2:15122882-15122904 GCTGAAGCTGAGGCTGAAGGAGG + Intergenic
927071951 2:19540023-19540045 TCTGAACCTAAGGCGGATGCTGG + Intergenic
928051465 2:28000959-28000981 GCTGATACTAAGACTGGAGCAGG - Intronic
928395342 2:30939438-30939460 TCTGGACCTAAGGCTGAGGCAGG + Intronic
930091740 2:47535738-47535760 TCTGAACCTAAGGCTGAGTCAGG - Intronic
935168071 2:100587057-100587079 GCTGATTCTAAAACTGAAGCAGG + Intergenic
936648737 2:114402212-114402234 GCAGAAGCTAAGACTGACCCAGG - Intergenic
938367665 2:130747622-130747644 GCAGAACCTAAGTGTGAAACAGG + Intergenic
939560326 2:143723945-143723967 GTGGAACCTCATACTGAAGCTGG - Intronic
939618477 2:144388661-144388683 GGTGAGCTTAACACTGAAGCTGG + Exonic
940851351 2:158690650-158690672 GCTGAACCTGAGGTTGAAGTTGG + Intergenic
941543943 2:166821777-166821799 GCTGATTCTAAGATTGGAGCAGG + Intergenic
941968203 2:171321510-171321532 GATGAACCAATGACTAAAGCTGG + Exonic
942098560 2:172556215-172556237 GCTGAAGCTGCGGCTGAAGCCGG - Exonic
943841638 2:192590831-192590853 GCTGATTCTAAGACTGGGGCAGG + Intergenic
944114662 2:196173233-196173255 GCTGGAGCTAAGGCAGAAGCAGG - Intronic
944662088 2:201929620-201929642 GCTGAAGCTAGGACTCAGGCTGG - Intergenic
945513173 2:210727861-210727883 GCTGATTCTAGGACTGGAGCAGG - Intergenic
946057530 2:216915058-216915080 GCTGAACCTCAGACAGAATAAGG - Intergenic
947361826 2:229353162-229353184 GCTGATTCTAAGTCTGAAGCAGG + Intergenic
948088671 2:235272241-235272263 GCTGATTCTAGGACTGGAGCAGG + Intergenic
948334585 2:237197504-237197526 GCTGAACCACAGCGTGAAGCAGG + Intergenic
948923653 2:241080510-241080532 GGTGATTCCAAGACTGAAGCAGG + Intronic
1169128281 20:3146979-3147001 GCAGACCCCAAGAATGAAGCTGG - Exonic
1171009120 20:21498357-21498379 GCTGAAACAATGACCGAAGCTGG - Intergenic
1172761742 20:37328133-37328155 GCTGAAGCTTAGAGTGATGCGGG - Intergenic
1173314623 20:41932103-41932125 GGTGAACTTAAGACTGATGATGG + Intergenic
1173495312 20:43514131-43514153 GCTGGACCTGAGACGGAAGTGGG + Intronic
1173576353 20:44115192-44115214 GCGGCAACAAAGACTGAAGCTGG - Intronic
1174397342 20:50255566-50255588 GCTGATTCTAAGACTGCAGCAGG - Intergenic
1176446948 21:6829672-6829694 GCTGAACCTACAGCAGAAGCAGG + Intergenic
1176667120 21:9697967-9697989 GCTGAACCCCAGGCAGAAGCCGG - Intergenic
1176825119 21:13694698-13694720 GCTGAACCTACAGCAGAAGCAGG + Intergenic
1179224319 21:39440229-39440251 GATGATCCTAAGCCTGAGGCAGG + Intronic
1181895802 22:26106369-26106391 TCTGATCCTCAGACTGAATCCGG + Intergenic
1182568980 22:31221898-31221920 GCTGAAAGAATGACTGAAGCGGG + Intronic
1182977518 22:34637310-34637332 ACTGAACTAAAGACTCAAGCAGG + Intergenic
949198434 3:1341772-1341794 GTTGAACCAAAGACTTAAGATGG + Intronic
950237758 3:11338566-11338588 GCTGCTCCGAAGGCTGAAGCTGG + Intronic
950738929 3:15034193-15034215 GCTGGATCCGAGACTGAAGCAGG - Intronic
952280800 3:31921367-31921389 GCTGATTCTAAGACTGGGGCAGG + Intronic
954529107 3:51303053-51303075 ACTGAACCTACGACTGATGGGGG - Intronic
955581026 3:60422601-60422623 GCAGTAACTAAGATTGAAGCTGG + Intronic
957627099 3:82667386-82667408 GCTGATTCTAAGACTTATGCAGG - Intergenic
957828442 3:85482531-85482553 GCTGAACTTATGACTGAATAAGG + Intronic
958988351 3:100810411-100810433 GATGAGCCTCAGACTGAACCTGG - Intronic
962637141 3:137342826-137342848 GCTGATCCTCAGATGGAAGCAGG + Intergenic
963042439 3:141079606-141079628 GCTGACCCTTAGCCGGAAGCTGG + Intronic
964113873 3:153115027-153115049 GAAGAACATAAGACAGAAGCAGG + Intergenic
967456717 3:189695424-189695446 GCTGCTTCTATGACTGAAGCAGG - Intronic
968358869 3:198132552-198132574 ACTGAACCTAAGACTGATAAGGG - Intergenic
968746235 4:2362031-2362053 GCTGAACCCAGGACATAAGCTGG + Intronic
970469238 4:16359914-16359936 GGTGAGCTTAACACTGAAGCTGG + Intergenic
971863681 4:32141463-32141485 GCTGAAAAAAAGACTGAAGATGG - Intergenic
975803215 4:78084698-78084720 GCTGAACCTAGGACTAGAGCAGG - Intronic
977511073 4:97963541-97963563 GCTACACAGAAGACTGAAGCAGG + Intronic
978461135 4:108953572-108953594 GCTGAATAGAAGAGTGAAGCTGG + Intronic
981825565 4:148936839-148936861 GCTGATTCTAAGGCTGGAGCTGG - Intergenic
983649002 4:170020234-170020256 GCTGTACCTGAGACAGAATCTGG + Intronic
984628428 4:182035016-182035038 ACTGAACCTAAGACTGATTGGGG - Intergenic
986850403 5:11805445-11805467 GCTGATCCTAAGACTGGATCAGG + Intronic
987349616 5:17010225-17010247 GCTGACCCTAACACTGGTGCAGG - Intergenic
987394558 5:17410041-17410063 GCTAGCTCTAAGACTGAAGCAGG - Intergenic
987756450 5:22102837-22102859 GCTGAACAGAAGGCTGAAGAGGG - Intronic
988321097 5:29697804-29697826 GCTGATTCTAGGACTGAGGCCGG - Intergenic
990214783 5:53518355-53518377 AATGAACCTCAGACTTAAGCAGG + Intergenic
990341303 5:54825869-54825891 GATGAACCCAAGGATGAAGCAGG + Intergenic
990662949 5:58038868-58038890 GCTAATTCTAGGACTGAAGCAGG + Intergenic
990897831 5:60717796-60717818 CCTGAAACTAAAACTGAAACTGG - Intergenic
991111755 5:62908122-62908144 GCTGATTCTAAGACTGAGGCAGG - Intergenic
992616474 5:78550515-78550537 GCTGAACACAAGACTGAAAAAGG + Intronic
993462279 5:88198291-88198313 GGTGAATCAAAAACTGAAGCTGG + Intronic
993868868 5:93226201-93226223 ACTGAACTTAAAACTGTAGCTGG - Intergenic
994990584 5:106991498-106991520 GCTGTACCTACAACTGAAGAAGG + Intergenic
995739479 5:115340015-115340037 GCTGAACATAATACTGAAGCAGG + Intergenic
997310310 5:132874164-132874186 CATGAACCTAAGAATAAAGCTGG + Intronic
997531158 5:134581976-134581998 GCTGTCCCTGAGACTGAGGCAGG + Exonic
997846296 5:137289032-137289054 GTTGAAGCCAAGACTCAAGCTGG - Intronic
998546483 5:143032268-143032290 GCTGAACCTGAGGCTGAGGGAGG + Intronic
998979495 5:147686008-147686030 GCTGAAGCTAGGAGTGAGGCTGG + Intronic
1003605035 6:7551963-7551985 GCCACACCTAAGACTGAAGTTGG + Intronic
1003790197 6:9537828-9537850 GCTGCACATGAGGCTGAAGCAGG - Intergenic
1004785022 6:18958526-18958548 GATGATCTTAAGACTGAAGGTGG + Intergenic
1006668179 6:35712802-35712824 GCTGACCCTAGAACTGAAGCTGG + Intronic
1010227114 6:73500994-73501016 AGTGAACCTAAAACTGAACCTGG + Exonic
1010237631 6:73588591-73588613 GCTGAACCTAAGGGTGAGGAGGG + Intergenic
1010669181 6:78666289-78666311 GCTGATTCTAGGACTGTAGCAGG + Intergenic
1011053898 6:83185139-83185161 GGTGAACATGAGACAGAAGCAGG + Intronic
1012096312 6:94967104-94967126 GCTGAAATAAAGACTGAAACAGG + Intergenic
1013381239 6:109573441-109573463 CCTGAAACTGAGCCTGAAGCAGG - Exonic
1013932119 6:115546484-115546506 GCTGAACTTAAGACTGATTGGGG + Intergenic
1014677879 6:124390214-124390236 TTTCCACCTAAGACTGAAGCAGG + Intronic
1015141443 6:129938350-129938372 GCTGATTCTAAGACTGGGGCAGG - Intergenic
1016004825 6:139078818-139078840 GCTGAACCTAGGACAAAATCTGG - Intergenic
1017246092 6:152226817-152226839 GCTGAACCTCAGACTGTGGAGGG + Intronic
1017548177 6:155473953-155473975 GCTGAGTCTAAGATTGCAGCAGG + Intergenic
1018748999 6:166785617-166785639 GTTGAACCTAAGACTGAACAAGG + Intronic
1021087948 7:16445861-16445883 CCTGAACCTAATACTGAAGGGGG - Intergenic
1021593211 7:22287414-22287436 GATGAACCTAAGAGGGAACCAGG + Intronic
1022699120 7:32740760-32740782 ACTGAACATAAGAGAGAAGCAGG - Intergenic
1023746283 7:43325767-43325789 GCCGAGCCTAAGACTGACCCGGG - Intronic
1025972853 7:66344316-66344338 GCTGAACCTAACACTAAAATTGG + Intronic
1026376609 7:69757731-69757753 GTTGAAACTCATACTGAAGCAGG - Intronic
1034318836 7:150160705-150160727 GCAGGAGCTTAGACTGAAGCTGG + Intergenic
1034773921 7:153806500-153806522 GCAGGAGCTTAGACTGAAGCTGG - Intergenic
1035293925 7:157857218-157857240 GCTGTGCCCAACACTGAAGCTGG + Intronic
1035529218 8:337842-337864 GGGGACCCTGAGACTGAAGCAGG + Intergenic
1037401185 8:18496805-18496827 GCTGAAAATAAGAATGAAGTGGG + Intergenic
1038076603 8:24082540-24082562 GTTGAATCTAGGACTGAGGCAGG - Intergenic
1038444725 8:27595378-27595400 GCTGAAGCTAAGAATGAACACGG - Intergenic
1041384032 8:57279896-57279918 GCTGAACCCAAGGCGGAGGCTGG - Intergenic
1042086868 8:65119098-65119120 GCTGAAGGTAAGAATGAAGGAGG + Intergenic
1043495938 8:80800177-80800199 ACTGAACCTATGACTGATTCAGG + Intronic
1043573116 8:81627621-81627643 GCTGAGTCAAAGACTGAAGACGG + Intergenic
1044491742 8:92827379-92827401 GCTATACCTAAGACTAAAGTAGG + Intergenic
1044898376 8:96917521-96917543 GCTGATTCTAGGACTGGAGCAGG - Intronic
1049162445 8:141106015-141106037 GTTGAACCTAAGGCTGCAGGAGG + Intergenic
1050019442 9:1268285-1268307 ACAGAACCTAACACTGAAGATGG - Intergenic
1050225565 9:3451010-3451032 GCTGATTCTAGGAGTGAAGCAGG + Intronic
1050441083 9:5664745-5664767 ACTGAACCTAAGACTGACTGGGG - Intronic
1050514161 9:6425405-6425427 GTTGATTCTAGGACTGAAGCAGG - Intronic
1052341924 9:27372123-27372145 GCTGATTCTAGGACTGAGGCAGG + Intronic
1054855441 9:69894271-69894293 GCAGATCCTAAGGTTGAAGCTGG - Intronic
1059489866 9:114658104-114658126 GATGAACTTAAGACTGTAGCTGG + Intergenic
1062742998 9:138191658-138191680 ACTGAACCTAAGACTGATAAGGG - Intergenic
1062743247 9:138193658-138193680 ACTGAACCTAAGACTGATAAGGG - Intergenic
1062743496 9:138195659-138195681 ACTGAACCTAAGACTGATAAGGG - Intergenic
1203522242 Un_GL000213v1:54859-54881 GCTGAACCTACAGCAGAAGCAGG - Intergenic
1203658976 Un_KI270753v1:23795-23817 GCTGAACCCCAGGCAGAAGCCGG + Intergenic
1192358275 X:70423283-70423305 GCTGAACCGAGGACTGAAAAAGG + Exonic
1197054734 X:122103566-122103588 GCTAAACTTAAGACTGTTGCTGG + Intergenic
1199772901 X:150985118-150985140 GCTGAACACAAGACCAAAGCAGG - Intronic
1199779277 X:151043693-151043715 GGTGAACACATGACTGAAGCTGG - Intergenic