ID: 1112571887

View in Genome Browser
Species Human (GRCh38)
Location 13:100600886-100600908
Sequence AGTCATGGGCAGGAGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 726
Summary {0: 1, 1: 0, 2: 3, 3: 72, 4: 650}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112571887 Original CRISPR AGTCATGGGCAGGAGGTGGG TGG (reversed) Intergenic
900032243 1:380423-380445 GGGGCTGGGCAGGAGGTGGGTGG + Intergenic
900095227 1:937491-937513 AGTGATTGCCAGGAGGTGAGAGG + Intronic
900221226 1:1510280-1510302 AGCCATGGGGTGGGGGTGGGGGG + Intergenic
900665695 1:3814177-3814199 AGCCCTGGGCACCAGGTGGGAGG + Exonic
901190736 1:7408406-7408428 AGGCATGGGGAGGAGGGGAGGGG - Intronic
901727518 1:11253633-11253655 AGTGATGGGGAGGGGGTGAGTGG - Intronic
902091081 1:13903747-13903769 AGTGATGGGCAGGAGGAAGACGG + Intergenic
902141848 1:14363380-14363402 AGTCACGGCCAGAGGGTGGGTGG - Intergenic
902287496 1:15416130-15416152 AGTCCTGGGCCGGGGGTGTGGGG - Intronic
902712396 1:18249365-18249387 GATCATGGGCAATAGGTGGGTGG + Intronic
902837438 1:19056067-19056089 CGTCATGGGCTGGGGGTGGAGGG + Intergenic
903027230 1:20438125-20438147 CTTGGTGGGCAGGAGGTGGGAGG - Intergenic
903650202 1:24917340-24917362 TCTCATGGGCAGCAGCTGGGTGG - Intronic
903656275 1:24950541-24950563 ATTCAAGCACAGGAGGTGGGGGG + Intronic
904365956 1:30010934-30010956 AGACATGGGGAGGAGGCGGACGG - Intergenic
904402064 1:30263502-30263524 AGTCAGGGGCAGGATGAAGGGGG - Intergenic
904577451 1:31514202-31514224 AGTCCTGGGCAGAAGGGGGCAGG - Intergenic
904694653 1:32322221-32322243 AGTCAGAGGCAGGAGGTGTGGGG - Intronic
905370495 1:37480213-37480235 AGGCCTGAGCAGGAGGAGGGAGG - Intronic
906204230 1:43978820-43978842 AGGCGTGGGCTGGAGGTGGCTGG - Intergenic
906240870 1:44241488-44241510 AGTAATGGGCTGGGGGTGGGTGG - Intronic
906323522 1:44830726-44830748 AATAATGGCCAGGAAGTGGGGGG + Intronic
906426067 1:45713671-45713693 ACTCAGGGGGATGAGGTGGGAGG - Intronic
907911791 1:58833708-58833730 AGTCAGGAGCTGGGGGTGGGGGG - Intergenic
907912560 1:58839857-58839879 AGGCAAAGGCAGGAGGAGGGAGG - Intergenic
907977726 1:59448370-59448392 TGTCTTGGGCAGTAGGTGGTGGG + Intronic
908168712 1:61483958-61483980 AGCCCTGGGCAGGAGGAGGGAGG + Intergenic
908199600 1:61780601-61780623 AGGCAGAGGCAGGAGGAGGGAGG - Intronic
908464330 1:64376703-64376725 AGTGAGGGGCTGGCGGTGGGGGG - Intergenic
909274047 1:73662193-73662215 AGTCATTGCCAGGTGTTGGGAGG - Intergenic
910082844 1:83362101-83362123 TGTGCTGGGCAGAAGGTGGGGGG + Intergenic
910412972 1:86965622-86965644 GGTCTTGGGGTGGAGGTGGGAGG + Intronic
910738241 1:90486191-90486213 AAAGATGGGCAGGGGGTGGGGGG + Intergenic
911876725 1:103174724-103174746 AATGATGGGGAGGAGGGGGGAGG + Intergenic
912319067 1:108693100-108693122 AGGGGTGGGCAGGAGGTTGGGGG - Intronic
912411164 1:109481582-109481604 AGTTGCGGGCAGGGGGTGGGGGG + Exonic
912466956 1:109880992-109881014 AGTCAGGGGCAACAGGTGGAGGG + Intergenic
912587260 1:110778365-110778387 AGAGGTAGGCAGGAGGTGGGGGG + Intergenic
912853451 1:113146869-113146891 AGCCATGGGCAGAGGGAGGGAGG - Intergenic
913162859 1:116161066-116161088 ACTCAGGGGCCTGAGGTGGGAGG + Intergenic
913320980 1:117588235-117588257 AGTGTTGAGCAGGAGGTGGATGG - Intergenic
914196458 1:145450503-145450525 GGCCACGGGGAGGAGGTGGGAGG - Intergenic
914255251 1:145957441-145957463 AGTAAAGGGGAGGAGGTAGGAGG + Intronic
914619897 1:149395536-149395558 AGTGAGAGGCAGGGGGTGGGTGG - Intergenic
915066323 1:153227954-153227976 AGACAGGGACAGGAGGTGTGTGG + Intergenic
915163048 1:153933106-153933128 GGAGATGGGGAGGAGGTGGGAGG - Intronic
915238467 1:154502481-154502503 AGCTCTGGGCAGGAGGTGGCGGG - Intronic
915364356 1:155306015-155306037 AGGGATTAGCAGGAGGTGGGGGG + Intergenic
915473623 1:156139773-156139795 AGAGATGGGAATGAGGTGGGAGG + Exonic
916619903 1:166485994-166486016 AGTTAGGGGCAAGAAGTGGGAGG - Intergenic
916694640 1:167222031-167222053 GGTCAGGCGCAGGGGGTGGGGGG - Intronic
917206012 1:172571963-172571985 CGTAATGGGAGGGAGGTGGGGGG + Intronic
917757612 1:178118270-178118292 ACGGATGGGGAGGAGGTGGGTGG + Intronic
917821515 1:178768659-178768681 AGTCCTGGGGAGGTGCTGGGAGG + Intronic
919414474 1:197290499-197290521 GGTCATGGAAAGGAGCTGGGGGG - Intronic
919756587 1:201069823-201069845 AGGAAGGGGCAGGTGGTGGGAGG - Intronic
919801583 1:201357705-201357727 AGTCAAGGGGAAGAGGTTGGGGG - Intergenic
919949986 1:202354267-202354289 TGTCATGGGCTGAGGGTGGGAGG - Intronic
920310253 1:205044252-205044274 CATAATGGGCTGGAGGTGGGGGG + Intronic
920422921 1:205847852-205847874 AATCAGGGGCAAGGGGTGGGTGG - Intronic
920423534 1:205853885-205853907 AATCAGGGGCAAGGGGTGGGTGG + Intergenic
921123066 1:212153406-212153428 AATGAGGGGCAGGAGGTGGAGGG - Intergenic
921314378 1:213876432-213876454 AGACTCGGGCAGGGGGTGGGTGG + Intergenic
922156091 1:223040645-223040667 AGTCATGGGCAAGGGGCAGGGGG + Intergenic
922183749 1:223256494-223256516 AGTCATCTGCAGGAGGAGAGCGG - Intronic
922738425 1:228002297-228002319 AGCCATAGACAGGAGGTGGGAGG + Intergenic
922900292 1:229131279-229131301 AGAGATGGGGAGGAGGTGGGGGG - Intergenic
923141035 1:231162019-231162041 AGTAATGGGGAGGAGGGGGGAGG - Intergenic
923311175 1:232737046-232737068 AGGCACTGGCAGGAGCTGGGAGG + Intergenic
923359685 1:233198720-233198742 AGGCCAGGCCAGGAGGTGGGGGG + Intronic
923533104 1:234827315-234827337 AGACTTGAGCAGAAGGTGGGCGG - Intergenic
924129820 1:240895433-240895455 TGTCATGGGGTGGAGGAGGGGGG - Intronic
924140836 1:241021644-241021666 GGTCAAGGGGAGGAGGTGGAAGG + Intronic
1063050217 10:2439077-2439099 AGTCATGGAAAGGAGTTGGGGGG + Intergenic
1063466128 10:6246053-6246075 GGCCATGGGGAGGAAGTGGGAGG - Intergenic
1064954816 10:20896027-20896049 AGTCCTGGGCAGGAGGGTAGTGG - Intronic
1065184785 10:23161144-23161166 AGTGATTGTCAGGAGCTGGGGGG + Intergenic
1065971572 10:30810050-30810072 AGTGGTGGGCAGGGGGTTGGTGG + Intergenic
1066340454 10:34527479-34527501 AGACATGGGCTGGAGTGGGGAGG + Intronic
1066372505 10:34829374-34829396 AGTGATGGGTAGATGGTGGGTGG + Intergenic
1066641267 10:37556606-37556628 ACTCATGGGGCTGAGGTGGGAGG - Intergenic
1067217638 10:44316353-44316375 AGTGATGGGGAGGAAGTGGATGG - Intergenic
1069049544 10:63778199-63778221 TGTCGTGGGGTGGAGGTGGGGGG - Intergenic
1069586506 10:69607604-69607626 AGCTATAGGCAGGTGGTGGGGGG - Intergenic
1070002712 10:72392816-72392838 AGTCCGGGTCAGGAGGAGGGAGG + Intronic
1070628502 10:78067921-78067943 AATCATTGGAAGGGGGTGGGTGG + Intergenic
1070697171 10:78572011-78572033 ACTCCTGGGCAGGGAGTGGGTGG + Intergenic
1070812537 10:79305616-79305638 AGCGAGGGGCAGGGGGTGGGAGG + Intronic
1071105733 10:82092465-82092487 AATCTTGGGTAGGGGGTGGGTGG - Intronic
1071831502 10:89376817-89376839 GGTCATGGGCATGGGATGGGAGG - Intronic
1072806939 10:98429746-98429768 AGTCAGGGGCAGGAGGGGATCGG - Intronic
1072900475 10:99402547-99402569 ACGCATGGGCTGGAGGTGGTGGG + Intronic
1073189689 10:101642579-101642601 AGTCCTGAGCAGGAGGATGGAGG - Intronic
1073205521 10:101767381-101767403 CGTCATGGGGAGGAGGCAGGAGG + Intergenic
1073214317 10:101828255-101828277 AGTCCTGGGAAGGAGGCAGGAGG + Exonic
1073332431 10:102679135-102679157 AGAACTGGGCTGGAGGTGGGAGG + Intronic
1073495745 10:103889479-103889501 AGTCATGGGGTGGAGATTGGAGG - Intronic
1074421062 10:113309305-113309327 AGGCATTGGCAGGAGGCTGGAGG - Intergenic
1074477539 10:113786195-113786217 AGAAATGGGATGGAGGTGGGGGG - Intergenic
1074779598 10:116791751-116791773 TGGCAGGGGCTGGAGGTGGGAGG - Intergenic
1074938962 10:118216204-118216226 AGTCAGGGGGAGGAGGGGGCAGG - Intergenic
1075101559 10:119509933-119509955 AGTGATGGGCAGGGGGAGAGGGG + Intronic
1075743810 10:124712614-124712636 AGTCACGGGAGAGAGGTGGGAGG - Intronic
1076005693 10:126946994-126947016 AGTCATGGGCCAGGGATGGGGGG - Intronic
1076146042 10:128123083-128123105 ATCCATGAGCAGGAGGTGAGTGG - Exonic
1076162665 10:128257215-128257237 TGTGATGGGCTGGAGGTAGGAGG + Intergenic
1076920952 10:133454422-133454444 GGTCCTGGGAAGGAGGTGGGAGG + Intergenic
1077032426 11:474508-474530 CTTCAAGGGCAGGGGGTGGGCGG - Intronic
1077356526 11:2121414-2121436 GGGCATTGGCAGGACGTGGGTGG - Intergenic
1077466458 11:2735928-2735950 AGTCAGAGGCAGGAGGAGGTGGG + Intronic
1077546858 11:3175672-3175694 AATCCAGGGCAGGAGGTAGGAGG + Intergenic
1077584913 11:3443864-3443886 TGTGATGGACAGGAGGTAGGCGG + Intergenic
1077994156 11:7438819-7438841 AGTCAGGGGCGGGATGTAGGAGG - Intronic
1078153463 11:8778418-8778440 TGTCAGGGGCAGGGGGAGGGTGG - Intronic
1078241810 11:9536811-9536833 ATTCAGGGGCAGGAGGAGAGAGG - Intergenic
1078415459 11:11161026-11161048 AGTCTTTGGCAGGGGGTAGGGGG + Intergenic
1079124354 11:17708253-17708275 AGCCATGGGCAAGCAGTGGGTGG - Intergenic
1079400701 11:20104240-20104262 TCTCATGGCCAGGATGTGGGAGG + Intronic
1080562492 11:33476701-33476723 AATGATGAGCAGGAGCTGGGAGG - Intergenic
1080824191 11:35834098-35834120 AGTCCGTGGCAGGAGGTGAGTGG + Intergenic
1081400063 11:42632997-42633019 AGTGCTTGGCAGTAGGTGGGTGG + Intergenic
1081455879 11:43222221-43222243 AGTGGGGGGCATGAGGTGGGTGG - Intergenic
1081911151 11:46700713-46700735 GGGCATGTGCAGGAAGTGGGCGG - Intergenic
1082805417 11:57446304-57446326 AGTCATTGGCTTCAGGTGGGTGG + Intergenic
1083265068 11:61542805-61542827 AGCCAGGGCCAGAAGGTGGGTGG - Intronic
1083547337 11:63558680-63558702 AGTCCTGGGCAGGGCCTGGGGGG + Intronic
1083831573 11:65236874-65236896 AGCCATGGAGAGGAGGTGAGGGG + Intergenic
1083858765 11:65407929-65407951 AGCCATGCGCATGAGGAGGGCGG + Intronic
1083864454 11:65446026-65446048 AGGCCTGGGCTGGAGATGGGTGG + Intergenic
1084180349 11:67442909-67442931 TGTCGGGGGCAGGAGGTGGGAGG + Intronic
1084194463 11:67516560-67516582 AGGCCTGGGGAGGTGGTGGGAGG + Intergenic
1084381818 11:68817650-68817672 GGTCAAGGGCAGGAGGCTGGGGG + Intronic
1084951910 11:72671146-72671168 AGTGCTGTGTAGGAGGTGGGGGG - Intronic
1085279616 11:75321283-75321305 AGTCCTGAGGAAGAGGTGGGGGG - Intronic
1087159606 11:94935908-94935930 AGTCATTGGCATGGGGAGGGAGG - Intergenic
1088480044 11:110287754-110287776 TGTCTTGGGCAGGAAGGGGGAGG - Intronic
1088883065 11:113986777-113986799 AGACACATGCAGGAGGTGGGAGG - Exonic
1089141079 11:116284803-116284825 AGTCAGGGGATGGAGGTGGAGGG + Intergenic
1089177190 11:116557465-116557487 AGGCATAGGCAGGAGGTTGCTGG - Intergenic
1089411537 11:118247121-118247143 AGGCATTGGCAGGAGATTGGAGG - Intronic
1089443965 11:118536981-118537003 AGTCATGAGGCTGAGGTGGGAGG - Intronic
1089738419 11:120565010-120565032 AGGCCGGGACAGGAGGTGGGCGG - Intronic
1089839262 11:121400161-121400183 AGGCAGGGGCAAGAGGTGGGAGG + Intergenic
1091368270 11:135039439-135039461 AGACCTGGGCAGTAGGAGGGAGG + Intergenic
1091664788 12:2411377-2411399 AGTGAGGGGCTGGAGGTGGGGGG + Intronic
1091704916 12:2687213-2687235 GGGCAGGGGCAGGAGGTGGAAGG + Intronic
1092204701 12:6607622-6607644 TGGGATGGCCAGGAGGTGGGCGG - Intergenic
1092218402 12:6697716-6697738 AGCCCTGAGCAGGCGGTGGGAGG + Exonic
1092943666 12:13433650-13433672 AGTAGTGGGCTGGAGGTGGATGG + Intergenic
1095682960 12:45000066-45000088 AGTCATGTGTAGGTGGTGGTGGG - Intergenic
1095849846 12:46790407-46790429 AGTGGTGGGCAGTGGGTGGGGGG - Intronic
1095879442 12:47117343-47117365 TGTCATGGGGTGGAGGTAGGGGG - Intronic
1096554534 12:52395279-52395301 GGTGAGTGGCAGGAGGTGGGAGG - Intronic
1096648105 12:53049073-53049095 AGTCAAGGGAGGGAGGTGGATGG - Exonic
1096801957 12:54116366-54116388 AGCCCTTGGCAGGAGATGGGAGG + Intergenic
1097286699 12:57883035-57883057 GGTGGGGGGCAGGAGGTGGGAGG + Intergenic
1099284829 12:80704687-80704709 AGTTGAGGGCAGGAGGTGGGAGG - Intergenic
1100710531 12:97251422-97251444 AATCAAGGGTAGGGGGTGGGGGG + Intergenic
1101118430 12:101554355-101554377 GGTGATGGGCACGAGTTGGGTGG - Intergenic
1101441444 12:104707000-104707022 TGGCCTTGGCAGGAGGTGGGAGG - Intronic
1101495698 12:105252138-105252160 AGTCATTGCCAGGAGCTGGAGGG + Intronic
1101496150 12:105256201-105256223 AATCCTGAGCAGGAGGTGGAAGG - Intronic
1102492598 12:113298005-113298027 AGTCAAGGCCCCGAGGTGGGGGG + Exonic
1102496470 12:113322839-113322861 ACTCAGGAGGAGGAGGTGGGAGG + Intronic
1102979869 12:117232974-117232996 ACTCAGGAGCATGAGGTGGGAGG - Intronic
1102998141 12:117365157-117365179 AGCCCTGGGCAGGAGGAGGAAGG + Intronic
1103596931 12:122029818-122029840 GGTCAAGGACAGGAGGTGGCTGG + Intronic
1104057789 12:125243927-125243949 AGTGGTGGGCAGGGGCTGGGGGG - Intronic
1104178008 12:126351500-126351522 AGTCCTGGGGAGCAGGTGTGAGG - Intergenic
1105541855 13:21322774-21322796 GGGCATGGGCAGCAGATGGGAGG - Intergenic
1105844084 13:24279860-24279882 AGTCCTGGCCAGGAGATGGGGGG - Intronic
1105988531 13:25593675-25593697 AGGAATGGGTAGGAGGAGGGAGG + Intronic
1106229929 13:27813953-27813975 TGTCAGGGGCAGGAGGGTGGCGG - Intergenic
1107133234 13:36919204-36919226 GGTCAAGGGCAGGAGGAGGAAGG + Intronic
1107283147 13:38758922-38758944 ACTCAGGGGCCTGAGGTGGGAGG + Intronic
1107837368 13:44422808-44422830 AGCAATGGGTAGGAGGTGAGGGG - Intergenic
1109354687 13:61222186-61222208 GATCATGGGCAGGGGGCGGGGGG - Intergenic
1110231284 13:73170185-73170207 CTTCATGGCTAGGAGGTGGGAGG - Intergenic
1111675823 13:91387352-91387374 AGTCAGGAGGATGAGGTGGGAGG - Intergenic
1111800497 13:92974834-92974856 ATTCATGGGCAGAAGGGGGTGGG - Intergenic
1112343457 13:98571371-98571393 AGTTATGGGCAGGTGGCGGCTGG - Intronic
1112399985 13:99068048-99068070 ATGCTGGGGCAGGAGGTGGGGGG - Intronic
1112571887 13:100600886-100600908 AGTCATGGGCAGGAGGTGGGTGG - Intergenic
1112673994 13:101676921-101676943 AGTCGAGGCCAGGAGTTGGGTGG + Intronic
1113901879 13:113802220-113802242 TGGCCTGGGCAGGAGGAGGGAGG + Intronic
1113937147 13:114000460-114000482 AGCGAGGGGCAGGAGGTGGTGGG + Intronic
1115013232 14:28576739-28576761 ACTCAGGAGCCGGAGGTGGGAGG - Intergenic
1115072617 14:29343170-29343192 ACTCAGGAGTAGGAGGTGGGAGG - Intergenic
1116169403 14:41380714-41380736 AGGCATGGGGGGGAGTTGGGTGG - Intergenic
1116842578 14:49834582-49834604 AGGCTGAGGCAGGAGGTGGGAGG - Intronic
1116943706 14:50816159-50816181 ACTAATTGGCAGGAGGTAGGGGG + Intronic
1118124725 14:62889058-62889080 ATTCATGGGCTGGAAGTGGCTGG + Intronic
1118151975 14:63199516-63199538 AGCCATGGACAGAAGGTGGATGG - Intergenic
1119029640 14:71181756-71181778 AGCCAAGGGCAGGCGGTGGAGGG - Intergenic
1120816352 14:88863068-88863090 AATGATGGGGAGGGGGTGGGTGG + Intronic
1120856025 14:89213145-89213167 AGAGATGGGCAGCAGGTGTGTGG - Intronic
1121007910 14:90502027-90502049 AGTGATGGGCAGGAAGAGGGCGG - Intergenic
1121326407 14:93022438-93022460 ACTCATGGGGCTGAGGTGGGAGG + Intronic
1121405853 14:93719049-93719071 GGTCTTGGGCTTGAGGTGGGGGG + Exonic
1121437044 14:93927091-93927113 GGTCAAGGGGAGGAGGGGGGTGG + Intronic
1121633459 14:95438184-95438206 ACTCAGGGGCCTGAGGTGGGAGG - Intronic
1122296334 14:100708437-100708459 GGGCATAGACAGGAGGTGGGAGG + Intergenic
1122628759 14:103097889-103097911 TGTCATCAGCGGGAGGTGGGGGG + Intergenic
1122634548 14:103123860-103123882 AGTCCTGGGCAGGATGTGGAAGG - Exonic
1122645917 14:103193870-103193892 GGTCTTGGGCAGGAGGAAGGAGG + Intergenic
1122732961 14:103815257-103815279 AGTCGTTGGTAGGAGCTGGGAGG + Intronic
1122855867 14:104559848-104559870 AGTCTTGGGGAAGAGGAGGGAGG - Intronic
1123018577 14:105387034-105387056 AGGCAGGGGCAGGAGGTGCAGGG - Intronic
1123116889 14:105898945-105898967 AGTTGTGGGCAGGAGGAGGTAGG + Intergenic
1123121169 14:105917810-105917832 AGTTGTGGGCAGGAGGAGGCAGG + Intergenic
1124112694 15:26806824-26806846 AGCATGGGGCAGGAGGTGGGGGG + Intronic
1124554140 15:30709633-30709655 AGACATGGGTTGGGGGTGGGTGG - Intronic
1124603265 15:31151842-31151864 AGCCAAGGCCAGGAGGTGGGAGG - Intronic
1124646506 15:31440958-31440980 AGTCTTTGGCTGGGGGTGGGAGG + Intergenic
1124932004 15:34129545-34129567 AGTCCTGGCCAGTAGGTGTGAGG - Intergenic
1125749861 15:42020864-42020886 AGGCATGGCCAGGAAGTGAGGGG - Intronic
1126411110 15:48374101-48374123 AGAAATGGGGAGGAGGAGGGAGG - Intergenic
1126739436 15:51762703-51762725 AGGCATGGGAGAGAGGTGGGAGG - Intronic
1127308218 15:57728655-57728677 AATCAGAGTCAGGAGGTGGGCGG - Intronic
1128182988 15:65621304-65621326 AGTCATGGGCTGGAGGCGCGGGG + Intronic
1128300230 15:66562045-66562067 AGGTTTGGGCAGGAGGTGGGAGG - Intronic
1129236411 15:74226202-74226224 AGTGGTGGGCATGAGCTGGGTGG + Intergenic
1129702565 15:77776134-77776156 AGGCAGGGGGAGGAGCTGGGAGG - Intronic
1130104201 15:80917281-80917303 AGCTATGGGCAGGAGGCAGGAGG + Intronic
1130828797 15:87578519-87578541 AGGGATGGGGTGGAGGTGGGAGG - Intergenic
1130841111 15:87702035-87702057 AGTCATTGGCTGGAGCTGAGTGG - Intergenic
1130953030 15:88606835-88606857 AGCCATGGGGTGGAGGGGGGAGG - Intergenic
1131223541 15:90605382-90605404 AGTCACGGGACTGAGGTGGGAGG - Intronic
1131735330 15:95325900-95325922 AGACAGGGGCAGGAGGTTGGAGG + Intergenic
1131900050 15:97077918-97077940 TTTCCTGGGCAGAAGGTGGGTGG - Intergenic
1132015840 15:98315865-98315887 ACTCAAGGGGATGAGGTGGGAGG - Intergenic
1132322092 15:100933006-100933028 AGTCCTGGGTGGGAGGCGGGAGG - Intronic
1132982473 16:2745556-2745578 AGGCAGGGGCAGGAAGTAGGGGG - Intergenic
1134036325 16:11033915-11033937 AGTCCTGGGCCAGAGGTGGAGGG + Intronic
1134100454 16:11448156-11448178 GGTGATGGGCAGGTTGTGGGGGG - Intronic
1135604100 16:23808218-23808240 ACTCATGGGGCTGAGGTGGGAGG + Intergenic
1135609817 16:23856630-23856652 ACTCATGAGAATGAGGTGGGAGG - Intronic
1135862308 16:26067744-26067766 TGTCATGGGGAGGAGCTGGTGGG + Intronic
1136011038 16:27363531-27363553 TGTCATGGCCAGGAGGATGGTGG + Exonic
1136059455 16:27716279-27716301 AGTCATTGCCAGGGGCTGGGAGG + Intronic
1136532219 16:30877187-30877209 GGTCATGGGGCGGAGGTTGGTGG - Intronic
1138028650 16:53541913-53541935 AGGCAAGGTCAGGAGGTGAGTGG - Intergenic
1138077720 16:54058726-54058748 GTTCATGCACAGGAGGTGGGGGG - Intronic
1138354521 16:56366816-56366838 GGGCACGGGCAGGGGGTGGGGGG + Intronic
1138435249 16:56995228-56995250 ATTCCTGGGGAGGAGGTGGGTGG - Intronic
1138552500 16:57755222-57755244 ACTCACGGGCAGGAAGTCGGAGG - Exonic
1139346175 16:66305273-66305295 AGTCAAGGGCATGTGTTGGGAGG + Intergenic
1139596643 16:67962050-67962072 AGCCATAGCCAGGAGGTGGCTGG - Intronic
1140301664 16:73763909-73763931 AACCAGGGGCAGGGGGTGGGAGG + Intergenic
1140364881 16:74373664-74373686 GGTGATGAGCAGGAGGTGGAGGG - Intergenic
1140454908 16:75099385-75099407 TGTGATGGGCTGGGGGTGGGAGG - Intronic
1140661449 16:77193912-77193934 TGTCAGTGGCGGGAGGTGGGGGG + Intronic
1141076495 16:81010493-81010515 AGGCATGGGCAGGAGAAGTGAGG + Intronic
1141478926 16:84293407-84293429 TGTGCTGGCCAGGAGGTGGGGGG + Intergenic
1141841350 16:86576272-86576294 GGTAATGGGCGGGACGTGGGCGG - Intergenic
1141930844 16:87201767-87201789 AGGCAGGGGCAGGAGCTTGGAGG - Intronic
1142131938 16:88435120-88435142 AGCCCTGGGCAGGCGGTGGCTGG - Exonic
1142340687 16:89520318-89520340 CTTCATGGGAAGGAGATGGGGGG + Intronic
1142650196 17:1344716-1344738 AGTGAGGGGAAGGAGGTAGGGGG + Exonic
1143018655 17:3904935-3904957 AGTGAGGGGCAGGGGGAGGGTGG + Intronic
1143456451 17:7070954-7070976 AGCCATGGGCAGAGGTTGGGGGG + Intergenic
1143812596 17:9484471-9484493 AGTAATTGGCAGGAGGGGGAAGG + Intronic
1144346519 17:14354589-14354611 AGTCATGGGCAGGCGTGGGGAGG - Intergenic
1144556351 17:16286104-16286126 AGAGATGGGCCAGAGGTGGGTGG + Intronic
1144754385 17:17670383-17670405 AGGTATGGGGAGGAGGTGGGAGG + Intergenic
1144958448 17:19031496-19031518 ATTCATGGGCCGGGGGTGGGGGG + Intronic
1144976710 17:19143028-19143050 ATTCATGGGCAGGGGGTGGGGGG - Intronic
1145278720 17:21453383-21453405 AGAAACGGGCAGGAGGTGGCCGG - Intergenic
1145890013 17:28407654-28407676 ATTCAGGGGCTGGAGGTAGGGGG + Intergenic
1146474255 17:33150292-33150314 TGTACTGGGCAGGTGGTGGGAGG - Intronic
1146519698 17:33516794-33516816 AGGCATGGGAGGGAGGAGGGTGG - Intronic
1146655712 17:34633603-34633625 AGCTAAGAGCAGGAGGTGGGCGG + Intronic
1147013422 17:37470768-37470790 AGTCATGGGTAGAAGGCTGGGGG - Intronic
1147368391 17:39974519-39974541 TGACGGGGGCAGGAGGTGGGTGG + Intronic
1147371090 17:39993548-39993570 AGTGATGGGAAGGAGGATGGGGG - Intronic
1147575185 17:41594866-41594888 AGGGATGAACAGGAGGTGGGTGG + Intergenic
1147655788 17:42090168-42090190 AGCCATGAGAAGGAGGAGGGAGG - Intergenic
1147904338 17:43813151-43813173 AGCCAAGGGCACGAAGTGGGAGG + Intronic
1147960695 17:44165911-44165933 ACTCATGGGCAAGAGGAGGCAGG + Intergenic
1147969626 17:44212488-44212510 AGCCAGGGGCAGGGGGAGGGGGG + Intronic
1148748497 17:49931456-49931478 AGTCCTGGGCAGGAGGAGTGGGG - Intergenic
1149451065 17:56750418-56750440 AGGCATTGGCAGGAGGTTGGGGG - Intergenic
1149990856 17:61382879-61382901 AGTCCTGGGCAGGAGGCCGAGGG + Intronic
1150287208 17:63961145-63961167 ATTCATGGGCAGGATGGGAGGGG - Intronic
1150526554 17:65929353-65929375 AGGCCTGGGCAGCAGGTAGGTGG - Intronic
1151189559 17:72388312-72388334 AGTGTTGGGGAGAAGGTGGGGGG + Intergenic
1151309082 17:73282503-73282525 ATTCAAGGGAAGGAGGTGGTAGG + Intergenic
1151748406 17:76023697-76023719 AGTGATGGGCAGCAGGGGTGTGG - Intronic
1151874082 17:76856673-76856695 TGGCATGGGCTGGAGGTGTGGGG + Intergenic
1152190709 17:78885691-78885713 TGTGAGGGGCAGGAGGTGGAGGG + Intronic
1152374934 17:79914160-79914182 AGGCATTGGCAGGGGGTGGCAGG - Intergenic
1152539672 17:80968642-80968664 GGTCTTGGGCAGGAGGTGGGTGG + Intergenic
1152846665 17:82604403-82604425 AGTCATGGCCAGAAGGGGGGTGG + Exonic
1152930671 17:83107977-83107999 GGGCAAGTGCAGGAGGTGGGGGG + Intergenic
1152930693 17:83108048-83108070 GGGCAAGCGCAGGAGGTGGGGGG + Intergenic
1153646539 18:7200935-7200957 ACTCAAGGGCCTGAGGTGGGAGG + Intergenic
1154106029 18:11523814-11523836 AGCCATGGGGAGCAGCTGGGGGG - Intergenic
1154241584 18:12658024-12658046 AGGCGTGGGCAAGAGGAGGGCGG + Exonic
1155023836 18:21922687-21922709 AGTCATGGGCAACTGGTGTGTGG + Intergenic
1155309613 18:24510697-24510719 AGAGATGGGCGGGGGGTGGGGGG + Intergenic
1155526800 18:26724310-26724332 GGTCATGGGTAAGAGGTAGGAGG - Intergenic
1156435204 18:37119578-37119600 ATTCATGGGGAGGTGGTGGCAGG - Intronic
1156476028 18:37405854-37405876 AGGCATGGGGTGGTGGTGGGGGG + Intronic
1156526639 18:37774252-37774274 AGCCAGGGGCAGGGAGTGGGGGG + Intergenic
1158550967 18:58435949-58435971 AGTGGTGGGGAGGGGGTGGGAGG + Intergenic
1158569897 18:58589321-58589343 AGTTTTGGGCAGGAGGAGGCCGG + Intronic
1158870603 18:61683873-61683895 GGTCATGGGCAGGGGTTGGAGGG + Intergenic
1159549034 18:69875889-69875911 AGTGGTTGCCAGGAGGTGGGAGG + Intronic
1160028873 18:75241463-75241485 AGTCACGGGCCGGGGGTTGGCGG + Intronic
1160056153 18:75482789-75482811 TCACATGGCCAGGAGGTGGGGGG + Intergenic
1160280936 18:77489999-77490021 ATTCATGGGAAGGAGGTAAGGGG - Intergenic
1160588045 18:79923354-79923376 ATGCATGGGCAGGTGGTGGATGG + Intronic
1160803161 19:979801-979823 GGGCCTGGGGAGGAGGTGGGGGG - Intergenic
1160803185 19:979854-979876 GGGCCTGGGGAGGAGGTGGGGGG - Intergenic
1160803210 19:979909-979931 GGGCCTGGGGAGGAGGTGGGGGG - Intergenic
1160803235 19:979964-979986 GGGCCTGGGGAGGAGGTGGGGGG - Intergenic
1160803260 19:980019-980041 GGGCCTGGGGAGGAGGTGGGGGG - Intergenic
1160919881 19:1514345-1514367 AGTCCAGGTCAGAAGGTGGGGGG - Intergenic
1161029049 19:2049588-2049610 AGGCCTTGGCAGGAGGTGGCTGG + Intronic
1161101017 19:2422008-2422030 AGACATGGGAAGGGGCTGGGAGG - Exonic
1161414463 19:4137845-4137867 ACTCAGGGGCTTGAGGTGGGAGG - Intergenic
1161907960 19:7171466-7171488 ACTCATAGGCAGGAGGTCTGTGG - Intronic
1161910965 19:7193530-7193552 AATTAGGGGCAGGAGGGGGGAGG + Intronic
1162138213 19:8569323-8569345 AGTCAGGGGCTTGAGGTGGGTGG + Intronic
1162153966 19:8664361-8664383 GCTGATGGGCAGGAAGTGGGGGG - Intergenic
1162464482 19:10831749-10831771 AGGCATGGGCGGGAGCTGAGAGG - Exonic
1162541731 19:11300664-11300686 AGTCATTGGCATGGAGTGGGAGG + Intronic
1163469191 19:17486966-17486988 AGGCGTGGGCATCAGGTGGGCGG + Intronic
1163513470 19:17749161-17749183 GGTCCTGGGCAGGAGGGGGTGGG + Intronic
1163518076 19:17776729-17776751 AGACATGGGGAGGTGGAGGGAGG - Intronic
1163518686 19:17779584-17779606 AGTCAAGGGAAGGAGGAGGATGG + Intronic
1164457655 19:28421825-28421847 AATCCAGGGTAGGAGGTGGGGGG - Intergenic
1164539683 19:29113584-29113606 AGTGATGAGCAGCAGGTGGGTGG - Intergenic
1164755761 19:30688146-30688168 AGCCCTGGGCAGGAGATGGGAGG - Intronic
1165006973 19:32815210-32815232 AAATATGGGCAGGTGGTGGGGGG - Intronic
1165406611 19:35634538-35634560 AGCCATGGGCCGGAGCTTGGTGG + Intronic
1165877898 19:39022553-39022575 ACTCAGGAGCATGAGGTGGGAGG - Intronic
1165915608 19:39257238-39257260 ACTCAGGGGCCTGAGGTGGGAGG + Intergenic
1166851913 19:45765317-45765339 AGACCTGGACAGGAGGTGGCCGG + Exonic
1166881671 19:45933966-45933988 GGTGGTGGGCAGGAGGCGGGCGG + Exonic
1167102925 19:47415106-47415128 AAACGTGGGCGGGAGGTGGGGGG + Intronic
1167130413 19:47581877-47581899 AGTCATGGGCTGGAGGGCAGGGG - Intergenic
1167244646 19:48365685-48365707 AGTCAGGGGCACGGGGTGGAAGG - Intronic
1167280969 19:48568350-48568372 AGTAATGTGCACGGGGTGGGAGG + Intronic
1167460074 19:49620486-49620508 AGGCCTGGGGAGGAGGGGGGGGG + Intronic
1167598084 19:50437755-50437777 ACTCAAGGGGAGGAGGTGGTGGG + Intronic
1167744980 19:51345433-51345455 ACCCATGGGAAGGAGGTGGCAGG - Intronic
1167889381 19:52527615-52527637 AGGCCTGGGCGGGAGGTGGGAGG - Intergenic
1167915260 19:52735075-52735097 AGGCCTGGGCGGGAAGTGGGAGG + Intergenic
1168276881 19:55283889-55283911 AGGGATGGAGAGGAGGTGGGAGG - Intronic
1168316841 19:55488339-55488361 AGGCATGGGGGGGAGGGGGGTGG - Intergenic
1168563528 19:57403672-57403694 AGCCATGGGCTGGAGCAGGGTGG + Intronic
925121421 2:1421527-1421549 AGTCCTGGGGAGGTGGGGGGCGG + Intronic
925554733 2:5117423-5117445 ATACTTGGGCAGGCGGTGGGGGG + Intergenic
925789586 2:7470477-7470499 AGTCACCTGCAGGAGGTGGCTGG + Intergenic
925965787 2:9064663-9064685 AGTGATAGGCAGGAAGCGGGAGG - Intergenic
926275790 2:11402330-11402352 AGTCAATGGCAGGAGGCGGGTGG + Intergenic
926820750 2:16849094-16849116 GGTGTTGGGCAGGTGGTGGGAGG - Intergenic
927519437 2:23690112-23690134 AGGCATGGCCAGGAGGAGAGGGG - Intronic
930118994 2:47744387-47744409 AGCCATGGGCTGGAGTGGGGTGG + Intronic
931336222 2:61346681-61346703 AGGCATGGGTGGGGGGTGGGGGG + Intronic
931904416 2:66826886-66826908 AGACAGGGGCAGGAGGTCAGAGG - Intergenic
932307467 2:70714289-70714311 AGCCATGGGCAGGTGGCGGTAGG - Intronic
934995341 2:98952715-98952737 AGTCATGTGGAGGAGGCTGGTGG - Intergenic
935593900 2:104864695-104864717 GGTCTTGGGGAGGAGGTGGGTGG + Intergenic
936444888 2:112587540-112587562 AGACAGGGGCGGGAAGTGGGTGG - Intronic
936675485 2:114709163-114709185 AGGCATTGGCAGGAGATTGGAGG + Intronic
936912729 2:117609535-117609557 AGGCTGAGGCAGGAGGTGGGAGG + Intergenic
936970784 2:118174762-118174784 AGTCAGGGTTAAGAGGTGGGAGG + Intergenic
937908447 2:127064084-127064106 AGGGGTGGGCAGGAGGTGGGAGG - Intronic
937982784 2:127624924-127624946 AGGCATGGGCAGGGGGTGGCAGG + Intronic
938107704 2:128544638-128544660 AGTCATCTCCAGGAGGTGGGGGG + Intergenic
938263078 2:129909036-129909058 AGGCAGGGGCTGGAGGTGGCTGG - Intergenic
938279895 2:130056368-130056390 AATCATGGATGGGAGGTGGGTGG - Intergenic
938330847 2:130447083-130447105 AATCATGGATGGGAGGTGGGTGG - Intergenic
938359099 2:130674420-130674442 AATCATGGATGGGAGGTGGGTGG + Intergenic
939053871 2:137338388-137338410 ATTCAAGGGTGGGAGGTGGGAGG + Intronic
939583304 2:143977214-143977236 AGACATGGGCTGGAGGAGAGGGG + Intronic
940945769 2:159615947-159615969 CGTCCTGGGTGGGAGGTGGGGGG - Intronic
941083436 2:161088955-161088977 AGGCATGGCTATGAGGTGGGGGG + Intergenic
942496383 2:176544515-176544537 GGTCATGGGAAGGAAGAGGGTGG - Intergenic
942630527 2:177946490-177946512 CGTCCCGGGAAGGAGGTGGGGGG + Intronic
942641547 2:178066488-178066510 AGTCCTGGGCAGGCAGTGGGAGG - Intronic
942893230 2:181017400-181017422 AGTTAGGGGCATGAGGGGGGTGG + Intronic
943064067 2:183069023-183069045 AATCATGGGAAGGAGGTTGGGGG + Intergenic
943526249 2:189020816-189020838 AGTCCTGGGCAGAAGTTGGTGGG + Intergenic
945147414 2:206752930-206752952 GGCCAGGGGCAGGGGGTGGGTGG - Intronic
945844647 2:214929598-214929620 ACTCAGGGGGATGAGGTGGGAGG + Intergenic
946163528 2:217850023-217850045 AGTGCTGGGGAGGAGCTGGGAGG - Intronic
946462739 2:219884026-219884048 AGACATGGGGAGGTGGTGGGAGG + Intergenic
947055201 2:226092071-226092093 AGCCATGGGGAGGAGGTGCCAGG - Intergenic
947181252 2:227413382-227413404 ATTCATGGGCAGGAGCTCAGAGG + Intergenic
947446129 2:230163936-230163958 TATCTTGGGCAGGGGGTGGGGGG - Intergenic
947937598 2:234021461-234021483 AGTGCTGGGCAGTAGGTGGTGGG - Intergenic
948800334 2:240430536-240430558 AGCCATGGGCTGGGGGTGGGGGG - Intergenic
948853917 2:240721314-240721336 TGGCATGGGCAGGAGGCGGCAGG - Intronic
948883704 2:240872841-240872863 ACTCCTGGGGTGGAGGTGGGAGG + Intronic
949026975 2:241770850-241770872 TGTCATGGGCAGGACGTGCCCGG - Intergenic
1169918795 20:10710979-10711001 AGTCATGAGTATGGGGTGGGGGG + Intergenic
1170290549 20:14764128-14764150 AGGCATTGGCAGGAGATGAGAGG + Intronic
1170771492 20:19336704-19336726 AGTCCAGGGCAGGAGGGGGTGGG - Intronic
1170792187 20:19517392-19517414 AGTCATCAGCTGGAGGTGGAGGG + Intronic
1170843786 20:19945328-19945350 TCACATGGGCAGGAGGTGGGTGG + Intronic
1170982251 20:21225734-21225756 AGTTATGGACATGAGGTGTGTGG - Intronic
1171363214 20:24605041-24605063 GGTCATGGGCAGGTAGTTGGGGG + Intronic
1171883709 20:30636250-30636272 AATTATGGACAGGAGGTTGGTGG - Intergenic
1172094198 20:32452730-32452752 AGACAAGGAGAGGAGGTGGGTGG - Intronic
1172676664 20:36677286-36677308 AGTCCTGGGCAGAAGGGGGCAGG + Intronic
1172874695 20:38157024-38157046 AGTCATGGGCAGGGCGAGGAGGG + Intronic
1173262343 20:41447758-41447780 GGTCCTGGGCAGGGGGTAGGAGG + Intronic
1174129404 20:48331721-48331743 AGTCACAGCTAGGAGGTGGGGGG - Intergenic
1174268829 20:49351916-49351938 AGTGGTGGGCAGGAGCAGGGAGG - Intergenic
1174534897 20:51243704-51243726 AAACAGGGGCAAGAGGTGGGAGG + Intergenic
1174616702 20:51841061-51841083 GGTCATGGCAAGCAGGTGGGAGG - Intergenic
1175084549 20:56447577-56447599 GGTGAGGGGTAGGAGGTGGGGGG - Intronic
1175262731 20:57684839-57684861 AGTTGTGGGGAGGAGCTGGGAGG + Intronic
1175491660 20:59384325-59384347 AGTGATGGGGAGGAGGTGAGGGG + Intergenic
1175491676 20:59384371-59384393 GGTGATGGGGAGGAGGTGAGTGG + Intergenic
1175491905 20:59385105-59385127 GGTGATGGGGAGGAGGTGAGAGG + Intergenic
1175805455 20:61826053-61826075 AGTCAAGGGCAGAAGCAGGGAGG - Intronic
1176030523 20:63009101-63009123 AGGGATGGGCAGGGGGTGAGGGG + Intergenic
1176047748 20:63101437-63101459 ACTGATGGGCAGGCGCTGGGTGG + Intergenic
1176385397 21:6136462-6136484 AGTCACGGGCACGAGGGGGACGG + Intergenic
1176386480 21:6140665-6140687 GGACATGGCCCGGAGGTGGGAGG + Intergenic
1177250867 21:18589170-18589192 AGTCATTTGCAGGGGGTGGTAGG - Intergenic
1177546182 21:22561840-22561862 AGCCATGGGCTAGAGGGGGGTGG + Intergenic
1177630933 21:23726404-23726426 AGTCATTGGCAGGGTGTGAGCGG - Intergenic
1178272022 21:31199480-31199502 AGGCCTGGGCAGGGGGAGGGTGG - Intronic
1178282337 21:31294197-31294219 AGTCATGAGCAGGGAGTGGGAGG - Intronic
1178294109 21:31394555-31394577 AGTCTGGGGCAGGATGTTGGTGG + Intronic
1178384610 21:32138915-32138937 GGTGATGGGTTGGAGGTGGGTGG + Intergenic
1178678285 21:34649437-34649459 AGTGATGGGCAGCGGGTTGGGGG - Intergenic
1178973153 21:37199052-37199074 AGTCATGGGCAGCAGTGGAGGGG + Intronic
1179561896 21:42220564-42220586 AGACATGGCCAGGCGGTGGGTGG + Intronic
1179736993 21:43397587-43397609 GGACATGGCCCGGAGGTGGGAGG - Intergenic
1179738076 21:43401790-43401812 AGTCACGGGCACGAGGGGGACGG - Intergenic
1180788215 22:18558595-18558617 AGGAATGGGCTGGTGGTGGGTGG + Intergenic
1180974716 22:19842024-19842046 CCTGATGAGCAGGAGGTGGGAGG - Intronic
1181082319 22:20423790-20423812 GGGCAGAGGCAGGAGGTGGGAGG + Intergenic
1181164594 22:20976626-20976648 GGTGATGGGCAGGGGGTGGCAGG - Intronic
1181233523 22:21436723-21436745 AGGAATGGGCTGGTGGTGGGTGG - Intronic
1181245127 22:21498120-21498142 AGGAATGGGCTGGTGGTGGGTGG + Intergenic
1181394973 22:22614806-22614828 AGGCATGGGCAGGATCTGAGGGG - Intergenic
1181528210 22:23502047-23502069 AGGAAAGGGCAGGTGGTGGGTGG - Intergenic
1181573616 22:23780810-23780832 TGTCCTGGGCAGGAGGTTCGGGG + Intronic
1182681019 22:32080182-32080204 AGGCAGAGCCAGGAGGTGGGAGG - Intronic
1182988049 22:34739707-34739729 AGACAATGGCAGGAGATGGGTGG - Intergenic
1183322419 22:37173112-37173134 GGTCAAGGCCAGGAGGTAGGAGG - Intronic
1183392977 22:37556378-37556400 AGACATGGACAGGAAGTAGGTGG + Intergenic
1183409565 22:37646945-37646967 AGCCCTGGGCAGGAGGTTGGGGG + Intronic
1183439427 22:37815094-37815116 AGACATGAGCAGATGGTGGGTGG - Intronic
1183513225 22:38248095-38248117 AGACATGGTCAGGAGGTGGGTGG - Intronic
1183587672 22:38762449-38762471 TGTCCTGGGCAGGACTTGGGTGG - Intronic
1183713660 22:39521077-39521099 AGTCAAGGGCGGGCGGTGGGCGG + Exonic
1183738194 22:39655380-39655402 AGCCAGAGGCAGGAGGTAGGGGG - Intronic
1183846190 22:40542202-40542224 AGACAGGGGTAGGGGGTGGGAGG - Intronic
1184609408 22:45593159-45593181 AGTCAGTGGCGGGGGGTGGGGGG - Intronic
1184940591 22:47761975-47761997 AGTCCTGGACAGGATGTGGCTGG - Intergenic
1184952672 22:47855370-47855392 AGACATGGGGAGTGGGTGGGTGG - Intergenic
1185206555 22:49542079-49542101 AGTCATGGGGAGAGGGTGGTGGG - Intronic
1185332988 22:50260010-50260032 TGTGATGGGCGGGTGGTGGGGGG + Intronic
1185345404 22:50308437-50308459 CTTCAGGGCCAGGAGGTGGGCGG + Intergenic
1185408848 22:50672506-50672528 AGACATGGGCAGGAAGACGGTGG + Intergenic
949868924 3:8570461-8570483 AGGCAGGGGCAGGTGCTGGGTGG - Intergenic
950068433 3:10132393-10132415 ACTCATGGGGCTGAGGTGGGAGG + Intergenic
950531521 3:13554865-13554887 TGTCAAGGACAGGAGGTAGGAGG - Intronic
950536340 3:13581199-13581221 AGTCAGGGGCGGCAGGTGGGGGG + Intronic
950813347 3:15672250-15672272 AGTCAGGGGGCTGAGGTGGGAGG - Intronic
951004194 3:17598009-17598031 AGTGATGGGCTGGGGTTGGGGGG - Intronic
951487908 3:23234647-23234669 AGGCTTGGGAAGGAGGTAGGGGG + Intronic
952273187 3:31852291-31852313 AGTCGGGGGCAGGGGGTCGGGGG + Intronic
952278061 3:31896756-31896778 AGGCATAGGCAGGAGCTGGCTGG - Intronic
953553694 3:43925027-43925049 ATGCATGGGCAAGATGTGGGAGG + Intergenic
954408953 3:50361267-50361289 AGACATGGGCAGGGGCGGGGTGG + Intronic
954568281 3:51618462-51618484 ACTCAGGGGCCTGAGGTGGGAGG + Intronic
955059084 3:55481472-55481494 AGGGAAGGGCAGGGGGTGGGGGG + Intronic
955750383 3:62180472-62180494 AGACATGGGGAGAAGGTGGAAGG + Intronic
956097644 3:65734216-65734238 AGGCTGAGGCAGGAGGTGGGAGG + Intronic
956389905 3:68760508-68760530 AGTGCTGGGCAGGAGGAGGAAGG - Intronic
956462330 3:69484983-69485005 CCTCCTGGGCAGAAGGTGGGGGG - Intronic
957058864 3:75465388-75465410 AGTCATGGTCAGCAGCTGTGGGG - Intergenic
957136980 3:76300948-76300970 AGCAATGGGAAGGAGATGGGTGG + Intronic
957372736 3:79316525-79316547 AGACATGTGGATGAGGTGGGGGG + Intronic
957994672 3:87673772-87673794 ACTCATGGAGTGGAGGTGGGAGG - Intergenic
958141720 3:89570916-89570938 AGTCACGGGGAGGTGGGGGGGGG + Intergenic
959883997 3:111478267-111478289 AGCCATGGACAGCAGGAGGGAGG - Intronic
960655686 3:120001459-120001481 AATCATGGGCAGAAGGTGAAGGG - Intronic
960965078 3:123098891-123098913 AGTCATTGGCTGGGGGAGGGAGG + Intronic
961055366 3:123783893-123783915 AGTCAAGGCCAGGAAGAGGGAGG - Intronic
961464326 3:127072236-127072258 AGTCTGGGGCAGGAGGCGAGAGG + Intergenic
961749242 3:129085874-129085896 AGGCCCAGGCAGGAGGTGGGTGG + Intergenic
961756155 3:129128411-129128433 AGGCCCTGGCAGGAGGTGGGTGG - Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962280506 3:134048574-134048596 ACTCAGGGCCAGGAAGTGGGTGG + Intronic
963770627 3:149382726-149382748 AGTCATGAGCAGGCTGAGGGTGG - Intergenic
963942413 3:151108237-151108259 GGTGAGGGGCAGGTGGTGGGTGG + Intronic
964431643 3:156612930-156612952 TGCCAGGGGCTGGAGGTGGGAGG - Intergenic
965628733 3:170708588-170708610 ACTCAGGGGCCTGAGGTGGGAGG + Intronic
966312491 3:178609743-178609765 ACTCATGGGGGTGAGGTGGGAGG - Intronic
966890774 3:184406109-184406131 CTTAAGGGGCAGGAGGTGGGGGG - Intronic
967335997 3:188345417-188345439 AGAAAAGGGCAGGAGGCGGGTGG - Intronic
967438358 3:189477648-189477670 AGTCATAACCAGGAGGTGGCAGG + Intergenic
967857047 3:194125984-194126006 GGTCCAGGGCAGGAGGTCGGGGG - Intergenic
967862184 3:194160538-194160560 AGTGAGGGGCAGGAGGTGCTTGG - Intergenic
967975899 3:195034740-195034762 GGGCCTGGGCAGGAGCTGGGGGG - Intergenic
968544889 4:1193648-1193670 GGGCATGGGAAGGATGTGGGGGG + Intronic
968565554 4:1310802-1310824 AAGCAGGGGCAGGAGGCGGGTGG - Intronic
968612803 4:1564704-1564726 AGTGAGGGGCAGGATGGGGGAGG + Intergenic
969156050 4:5210902-5210924 ACTCATGGGGCTGAGGTGGGAGG - Intronic
969343468 4:6556915-6556937 AGGCATTGCCAGGAGCTGGGAGG - Intronic
969951297 4:10838795-10838817 AGGGATGGGCAGGGGGTAGGGGG - Intergenic
970154806 4:13131010-13131032 ACTCCTGGGGAGGAGGTGGCGGG + Intergenic
973367364 4:49218521-49218543 AATTATGGACAGGAGGTTGGTGG - Intergenic
973537213 4:51895403-51895425 AGCCTGGGGCAGGACGTGGGTGG + Intronic
973581629 4:52349638-52349660 ATTCCGGGGCAGGGGGTGGGAGG + Intergenic
973611488 4:52639803-52639825 ACTCATGGGGCTGAGGTGGGAGG - Intronic
974061055 4:57036294-57036316 AGGCAGGAGGAGGAGGTGGGGGG + Intronic
975281717 4:72569289-72569311 AGGCAGGCGGAGGAGGTGGGAGG + Intergenic
975505726 4:75134572-75134594 ACTCAGGAGCCGGAGGTGGGAGG + Intergenic
975896187 4:79093771-79093793 TGCCAGGGGCAGGATGTGGGGGG - Intergenic
976145701 4:82041125-82041147 AGACTGGGGCTGGAGGTGGGGGG + Intronic
976987162 4:91315946-91315968 TGTCATGGGAAGGAGCTGGTGGG + Intronic
978282738 4:107036708-107036730 AGTCAGGGGCTGAAGATGGGTGG - Intronic
978904326 4:113987760-113987782 TGGCATGGGCCAGAGGTGGGAGG + Intergenic
979860000 4:125682275-125682297 AGACATGGGCAGGAGGTTATAGG - Intergenic
979926314 4:126569294-126569316 AGGTATGGGAAGGGGGTGGGAGG - Intergenic
979947402 4:126850454-126850476 AGTCATGAGCAGGAAGTGGAAGG - Intergenic
980093071 4:128462375-128462397 AATGATGTGCAGGAGGTGGGTGG + Intergenic
980848090 4:138348292-138348314 ATTCAAGGGCAGGATGTGGCTGG + Intergenic
981092272 4:140744110-140744132 AATAATGGGATGGAGGTGGGGGG + Intronic
981405816 4:144367505-144367527 AGTCAGTGGGAGGAGGTGAGGGG - Intergenic
981886207 4:149675789-149675811 AGTCATTGGCAGGAGAGAGGAGG - Intergenic
982129251 4:152212506-152212528 AGTCAAGGCCAGGAGGGGGCAGG + Intergenic
982202433 4:152973629-152973651 AGACTTGGGGACGAGGTGGGAGG + Intronic
983843695 4:172488829-172488851 AGTCCTGGGGTGGGGGTGGGGGG + Intronic
984165054 4:176296357-176296379 AGTCCTGGGTCGGGGGTGGGTGG + Intergenic
984769265 4:183423224-183423246 TGACAGGGGCAGGAGGTGAGAGG + Intergenic
984808852 4:183776257-183776279 AGAAATTGGCAGGAGCTGGGAGG - Intergenic
984941639 4:184937462-184937484 ATTCATGGGCACGGGGTGGGTGG - Intergenic
985620440 5:952213-952235 AGCCAGGGGAGGGAGGTGGGGGG - Intergenic
985673414 5:1218051-1218073 AGTGCAGGGCAGGAGGTGGGAGG - Intronic
985707713 5:1411113-1411135 AGTCAAGGACAGGAGGTCTGGGG + Intronic
985956527 5:3269880-3269902 CTTCATGGGGAGGAGGTGGCCGG - Intergenic
986171910 5:5321211-5321233 ACACATGGACAGGAGGTGGGGGG - Intergenic
986410578 5:7475056-7475078 AGGCCCAGGCAGGAGGTGGGAGG - Intronic
990449103 5:55918798-55918820 AGTCCTGGGTGGGTGGTGGGGGG - Intronic
991423348 5:66464276-66464298 AATAGTGGGCAGGGGGTGGGAGG + Intergenic
991719447 5:69481729-69481751 AGTCCATGGCAGGAGGTGAGAGG + Intergenic
992483782 5:77176502-77176524 GGGCATGAGCAGGAGGAGGGTGG + Intergenic
994121765 5:96121853-96121875 AGGGGTGGGCAGGGGGTGGGTGG - Intergenic
994200260 5:96966389-96966411 AGTCAGGAGGATGAGGTGGGAGG + Intronic
994766515 5:103924630-103924652 AGGCATGGGCAGGAGATTAGAGG + Intergenic
995553084 5:113299773-113299795 AGGTGTGGGCAGGAGGTGGCAGG + Intronic
995992942 5:118264489-118264511 TGTCATGGGCAGGGGGTAGCAGG - Intergenic
996304318 5:122029120-122029142 AGTCAAGGGTTGGGGGTGGGAGG + Intronic
997260083 5:132459245-132459267 AGTCATGGGGAGGAAGCGGAGGG + Intronic
997473518 5:134129818-134129840 TGTCAAGGCCAGGCGGTGGGTGG + Intronic
997822594 5:137079316-137079338 ATGCATGGGCAGGAGGATGGAGG + Intronic
998045812 5:138985788-138985810 AGCCATGGCCATGGGGTGGGAGG - Intronic
998135287 5:139671287-139671309 AATCAGGGGCTGGAGGTGGGAGG - Intronic
998138849 5:139688753-139688775 TGTGATGGGCTGGGGGTGGGGGG - Intergenic
998161455 5:139814963-139814985 GGCCAGGGGCAGGTGGTGGGTGG - Intronic
998462452 5:142319856-142319878 AGTCAAGGGGAGGGTGTGGGTGG - Intronic
998733065 5:145103375-145103397 AGTGATGGGCAGGGGGAGGTCGG + Intergenic
998969195 5:147572912-147572934 AGCCATGGGGAGGAAGTGGAAGG - Intergenic
999523906 5:152381712-152381734 AATCATGGCCTGGAGGTGAGAGG + Intergenic
999625562 5:153517020-153517042 AGAGAGAGGCAGGAGGTGGGAGG + Intronic
999628653 5:153546580-153546602 AGTCATGGGAAGCAGGTATGGGG + Intronic
1001137246 5:169112736-169112758 AGTCATGAGCAGGAGATCAGAGG + Intronic
1001289098 5:170443850-170443872 AGAAATGGGCAGGAAGTGGAAGG + Intronic
1001484076 5:172107070-172107092 AGTCCTGGGGAGGGGGCGGGTGG + Intronic
1002161053 5:177314366-177314388 AGACATGGCCAGGAGGTGGTGGG + Intergenic
1002741577 5:181438445-181438467 GGGGCTGGGCAGGAGGTGGGTGG - Intergenic
1002817838 6:695386-695408 AATCATCAGCAGGATGTGGGTGG + Intergenic
1003133205 6:3413271-3413293 GGTCATGGACAGGAGGTGGCTGG + Intronic
1003158839 6:3618510-3618532 ACTCAGGGGCCTGAGGTGGGAGG - Intergenic
1003384171 6:5652106-5652128 AGGCATGGGCAGGAGATGTGAGG + Intronic
1003673069 6:8177930-8177952 AGACATGGGAAGGAAGGGGGAGG - Intergenic
1003960161 6:11201393-11201415 AGTCATGATAAGTAGGTGGGTGG - Intronic
1004737167 6:18419206-18419228 AGCCATAGGCAGGAGGAGGAGGG - Intronic
1004770605 6:18776985-18777007 ACTCATGGGGCTGAGGTGGGAGG - Intergenic
1005805571 6:29471420-29471442 AGAGATGGGCAGGAAGAGGGAGG + Intergenic
1005868398 6:29955323-29955345 AGTCATGGGCAGCAGGCGAGGGG + Intergenic
1005943287 6:30577515-30577537 AGCCATGTGAAGGAGGTGGGAGG + Intronic
1006127439 6:31848696-31848718 ACTCATGGGGCTGAGGTGGGAGG + Intergenic
1006453307 6:34117774-34117796 GGTGAGGAGCAGGAGGTGGGAGG - Intronic
1007135015 6:39512435-39512457 AGGTATGGGCTGCAGGTGGGAGG - Intronic
1007418658 6:41706513-41706535 ACTCTTGGGCAGGATGGGGGTGG - Intronic
1008147421 6:47908341-47908363 ATTCATGGGCAAGAGCTGGAGGG - Intronic
1008751577 6:54739949-54739971 TGTCATGGGCAGGACCTGGTAGG + Intergenic
1009351840 6:62690049-62690071 TGTCATGGGGCGGTGGTGGGAGG + Intergenic
1009404311 6:63293106-63293128 ACTCAGGGGAATGAGGTGGGAGG - Intronic
1011794619 6:90938980-90939002 AATCAGGGGCAGGGGGTGAGGGG - Intergenic
1011925930 6:92644787-92644809 AGACATGGACAGAAGGTGGATGG - Intergenic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1013188719 6:107783956-107783978 GGGCAGGGGCAGGAGGTGGCAGG - Intronic
1015603117 6:134929704-134929726 AGGCAAGGACAGGAGGTGTGTGG + Intronic
1015744186 6:136492091-136492113 GGCCAGGGGCAGGGGGTGGGGGG + Intronic
1016647247 6:146424374-146424396 AGACAGGGGCAGGTAGTGGGAGG + Intronic
1017278624 6:152599377-152599399 TGTCAAGGGCGGGAAGTGGGAGG - Intronic
1017554231 6:155545727-155545749 ATTAATGGGCAGAGGGTGGGTGG + Intergenic
1018510252 6:164517186-164517208 AGTCATGGGAAGGACCTGGAAGG - Intergenic
1018683615 6:166284659-166284681 AGAGATGGGCTGGAGATGGGTGG - Intergenic
1019108551 6:169690555-169690577 AGTGCTGGGAAGGAGGTGGATGG - Intronic
1019246715 6:170714210-170714232 GGGGCTGGGCAGGAGGTGGGTGG - Intergenic
1019586438 7:1806673-1806695 AGGCATGGGCTGGAGGTCGGGGG + Intergenic
1020114242 7:5466749-5466771 AGGCCTGGGCAGGAGGCAGGAGG + Intronic
1020168781 7:5828523-5828545 AGTCATGAGGCTGAGGTGGGTGG - Intergenic
1020865395 7:13554842-13554864 AGACATGGGCTGGAGGTGGTAGG - Intergenic
1021812524 7:24417114-24417136 AGCCATGGGCAGGAGGTAGATGG - Intergenic
1022161239 7:27713365-27713387 AATCATGGGCAGAAGGTGAGAGG + Intergenic
1022211190 7:28211259-28211281 TGTCATGGGCAGGACCTGGTGGG - Intergenic
1022525406 7:31033983-31034005 AGGCTGGGGCTGGAGGTGGGGGG - Intergenic
1023523498 7:41073069-41073091 GTTCTTGGGCAGGAGATGGGAGG + Intergenic
1024226058 7:47327777-47327799 AATCCTGGGCAGGACTTGGGAGG - Intronic
1024254769 7:47532205-47532227 AGTCCTGGGCAGAAGGGGGTGGG + Intronic
1025213238 7:57033319-57033341 AGTGATGGGAAGAAGCTGGGTGG + Intergenic
1025658715 7:63543505-63543527 AGTGATGGGAAGAAGCTGGGTGG - Intergenic
1026215251 7:68342742-68342764 TGTCATTGGCAGGAGGTTGTAGG - Intergenic
1026491773 7:70869806-70869828 GGTCCTGGGAAGGAGCTGGGAGG - Intergenic
1026813095 7:73485515-73485537 AGTCAGAAGCATGAGGTGGGAGG + Intronic
1026988985 7:74572579-74572601 AGTCTTGGGCAGCAGAAGGGAGG - Intronic
1027299679 7:76818307-76818329 TGTGCTGGGCAGAAGGTGGGGGG + Intergenic
1028416866 7:90589963-90589985 ACTCATGAGCCTGAGGTGGGAGG - Intronic
1028747613 7:94345959-94345981 CTTCATAGGCTGGAGGTGGGTGG - Intergenic
1028892230 7:96001296-96001318 AGTGAATGGCTGGAGGTGGGTGG - Intronic
1029436412 7:100566401-100566423 AGACCTGGTCAGGGGGTGGGTGG + Exonic
1029604431 7:101590159-101590181 ACTCATGGGCAGGAGAGGTGAGG + Intergenic
1029688623 7:102165711-102165733 AGGGATGGGCAGGGGTTGGGGGG + Intronic
1029709714 7:102292993-102293015 GGTGCTGGGGAGGAGGTGGGGGG + Intronic
1030058938 7:105607773-105607795 GGCCATGGGGAGGAGGAGGGAGG - Exonic
1030454847 7:109760463-109760485 AGCAATGGGCTGGGGGTGGGGGG + Intergenic
1031605613 7:123763825-123763847 AGTGAGGGGTTGGAGGTGGGAGG - Intergenic
1032518542 7:132525073-132525095 TGTCAGGGGCAGGGGGTGAGGGG - Intronic
1032558711 7:132865316-132865338 AATCATGGGGAAGAGGTTGGAGG + Intronic
1033152261 7:138925581-138925603 AGGCCGAGGCAGGAGGTGGGAGG + Intronic
1034606224 7:152318436-152318458 AGAGATGGGGAGGGGGTGGGTGG - Intronic
1035380765 7:158439246-158439268 AGGCATGCGCAGGAGGTGGACGG - Intronic
1035390110 7:158497915-158497937 ACACATGAGCAGGAGCTGGGAGG + Intronic
1035452802 7:158989336-158989358 AGTCATGGATAGGAGGTGGTGGG - Intergenic
1035501427 8:93751-93773 GGGGCTGGGCAGGAGGTGGGTGG + Intergenic
1036915099 8:12796990-12797012 AGTCATCTGCAGGATGTGGGTGG + Intergenic
1036933285 8:12976950-12976972 AGGCATAGGCAGGATTTGGGAGG - Intronic
1038014224 8:23499609-23499631 AGTCAGGGGCAGGTGGAGGTGGG + Intergenic
1038955998 8:32469451-32469473 AGTCATGGGCAGGCTGTAGCAGG + Intronic
1039619349 8:38982302-38982324 ACCCAGGGGCTGGAGGTGGGAGG + Intronic
1039926857 8:41941928-41941950 AGACATGGGCAAGAGGAAGGAGG + Intronic
1040103613 8:43526295-43526317 AATCATGGACAGGAGGATGGTGG + Intergenic
1041397906 8:57410458-57410480 AGTGATGGGCAGGAAGTGAGAGG + Intergenic
1042156922 8:65854151-65854173 ACTCCGGGGGAGGAGGTGGGAGG + Intergenic
1042435237 8:68756491-68756513 AGTAACGGGTAGGGGGTGGGAGG + Intronic
1042554948 8:70026486-70026508 AGTCTTAGGAAGGAGGTGAGAGG + Intergenic
1042845823 8:73168571-73168593 AGTCAGGGGAGGGAAGTGGGAGG + Intergenic
1043414467 8:80033381-80033403 AGCCATGGGCTGGAGTGGGGTGG - Intronic
1043622925 8:82219320-82219342 AGTGGTGGGCAGCAGGTGGGAGG + Intergenic
1045236162 8:100354210-100354232 GGTCAGGGGCAGGAGGTTGATGG - Intronic
1045353710 8:101366023-101366045 ACCCTTGGGGAGGAGGTGGGGGG - Intergenic
1046112419 8:109741436-109741458 ACTAATTGGCAGCAGGTGGGGGG - Intergenic
1047572265 8:126111871-126111893 TGTCATGGGCAAGAGGGAGGAGG - Intergenic
1047728692 8:127707440-127707462 AGTAATGGGCAGGAGTGGGCAGG - Intergenic
1048845536 8:138601264-138601286 AGTCATGGGAAGGAGACAGGAGG + Intronic
1048856270 8:138689125-138689147 AGTCATGGGCAGGGAGGAGGTGG - Intronic
1049038381 8:140094438-140094460 GGTGGTGGGCAGGAGGTGTGAGG - Intronic
1049128764 8:140817238-140817260 AAGTATGGGCAGGGGGTGGGGGG + Intronic
1049281523 8:141751474-141751496 AGTGCTGGGGAGGATGTGGGAGG + Intergenic
1049344653 8:142132143-142132165 AGTCTTTGGTAGGAGGTGGACGG - Intergenic
1049361549 8:142214481-142214503 AGTTCTGGGCAGGAAGTGAGGGG - Intronic
1049404204 8:142444399-142444421 AGTCATGGGGAGGAGTTGCGAGG - Intergenic
1049426772 8:142541258-142541280 ATTCATTGGCAGGAAGTCGGGGG + Intronic
1049488438 8:142878545-142878567 AGTCCGGGGCAGGAGGCAGGTGG - Intronic
1049493334 8:142916565-142916587 AGTCCGGGGCAGGAGGCAGGTGG - Intronic
1049562224 8:143317538-143317560 AGTCCTGGGGAGGAGGAGGGAGG - Intronic
1049730753 8:144176906-144176928 AGTCATGTGTAGCCGGTGGGTGG + Intronic
1049768187 8:144365257-144365279 AATCAAGGGCAGGAGGTGAAAGG - Intergenic
1049772620 8:144390772-144390794 AGTGGTGGGCATGAGGTGGTGGG + Intronic
1050527922 9:6562375-6562397 AGTCATGTGCAGGGAGTGTGGGG - Intronic
1051726182 9:20089685-20089707 AGTGGTGGGCAGGGGGTGGCGGG - Intergenic
1052351555 9:27464198-27464220 AGAAATAGGCAGGAGGTGGTAGG + Intronic
1052439749 9:28480889-28480911 AGTAAGGGGCAAGAGGTGGTTGG - Intronic
1052450999 9:28631304-28631326 TGTCATGGGGTGGGGGTGGGGGG - Intronic
1053267376 9:36724993-36725015 AGAGATGGGCAGGAGGAGTGAGG + Intergenic
1053914670 9:42936921-42936943 AATTATGGACAGGAGGTTGGTGG + Intergenic
1055382540 9:75724614-75724636 TCACATGGGCAGGAGGTGGGTGG + Intergenic
1055434837 9:76282224-76282246 AGTCAGGAGGATGAGGTGGGAGG - Intronic
1056287193 9:85101445-85101467 GGTCATGGGTAGGAGGAAGGAGG - Intergenic
1056586354 9:87929925-87929947 AATCATGGATGGGAGGTGGGTGG - Intergenic
1056610526 9:88123018-88123040 AATCATGGATGGGAGGTGGGTGG + Intergenic
1056792372 9:89634074-89634096 TGACATGGGCAGGAGCTAGGAGG + Intergenic
1057205709 9:93171191-93171213 AGAACTGGGTAGGAGGTGGGAGG + Intergenic
1057369454 9:94456970-94456992 TGTAAGGGGTAGGAGGTGGGGGG - Intronic
1057444211 9:95102746-95102768 AGTGGTGGTCAGGAGGTGGAAGG - Intronic
1057971356 9:99561374-99561396 AGTCATTGACAGGAAGTGGATGG + Intergenic
1058695881 9:107558732-107558754 AGACACTGGCAGGAGATGGGAGG - Intergenic
1058910073 9:109512896-109512918 ACTTAGGGGCAGGAGGAGGGAGG - Intergenic
1059873473 9:118604268-118604290 AGTTGTGAGGAGGAGGTGGGAGG + Intergenic
1060044383 9:120328090-120328112 TGTGAGGGGCAGAAGGTGGGGGG + Intergenic
1060112493 9:120916691-120916713 AGCCCTGGGCAGTTGGTGGGTGG - Intronic
1060376604 9:123120206-123120228 AGTCTTGGAAAGGAGATGGGTGG - Intronic
1060699615 9:125739374-125739396 GGTCAAGGGCAAGAGCTGGGAGG + Intergenic
1060885560 9:127149704-127149726 AGCCATGGCCAGGAGGTTGAAGG + Intronic
1061250166 9:129421799-129421821 AGCAAGGGGCAGGGGGTGGGTGG + Intergenic
1061826305 9:133260447-133260469 AGTCATGGGCAGACAGTGGCTGG - Intronic
1061933703 9:133846216-133846238 AGGCATGGCCAGGTGGTGTGAGG - Intronic
1062021065 9:134319634-134319656 AGTCTTGGGTAGGAGGCGGAGGG + Intronic
1062465455 9:136678859-136678881 AGTCAGGAGCCTGAGGTGGGAGG - Intronic
1062581506 9:137231057-137231079 AGGCTTGGGCAGCAGGAGGGAGG + Intronic
1062698275 9:137886332-137886354 GGCCACGGGGAGGAGGTGGGAGG + Intronic
1203607488 Un_KI270748v1:69661-69683 GGGGCTGGGCAGGAGGTGGGTGG - Intergenic
1185701446 X:2233728-2233750 AGACATGGGCAGTGGGTGGATGG + Intronic
1186505886 X:10091787-10091809 AGTCAGGGGCAGTAGGAGGATGG - Intronic
1186510993 X:10129670-10129692 AGGGATGGACAGGAGTTGGGAGG + Intronic
1188136376 X:26499144-26499166 GTTCTTGGGCAGGGGGTGGGGGG + Intergenic
1189240198 X:39518991-39519013 TGTCACGGGCAGGAGGTCGGGGG - Intergenic
1189360168 X:40343885-40343907 AGTCCTGGGCAGAAGGGGGTGGG + Intergenic
1189617018 X:42794400-42794422 AGTCCTGGCCAGGAGGGGAGTGG + Intergenic
1190007836 X:46757731-46757753 AGTCATGGGCAGGGCGAGGGGGG + Intronic
1190128242 X:47724403-47724425 GGTCAGGGGCAGGATGTGGGTGG + Intergenic
1192452384 X:71252490-71252512 AGTAGTGGGGAGGAGGAGGGTGG - Intronic
1195473549 X:105260060-105260082 AGTCACCTGAAGGAGGTGGGTGG + Intronic
1196092978 X:111766697-111766719 TGTCATGGGGTGGGGGTGGGGGG - Intergenic
1196722144 X:118864475-118864497 TGTCATGGACTGGGGGTGGGGGG - Intergenic
1197252752 X:124232367-124232389 ACTCAGGGGGATGAGGTGGGAGG + Intronic
1199655840 X:149994688-149994710 AATGCTGAGCAGGAGGTGGGGGG - Intergenic
1200075610 X:153549168-153549190 AGGCAGTGGGAGGAGGTGGGGGG + Intronic
1200397450 X:155999502-155999524 AGGGATGGGCAGGAGGCAGGAGG - Intronic
1201276900 Y:12307483-12307505 AGTCATGAGGCTGAGGTGGGAGG - Intergenic