ID: 1112572559

View in Genome Browser
Species Human (GRCh38)
Location 13:100607185-100607207
Sequence TTAAGGAATGCGAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 217}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112572559_1112572569 19 Left 1112572559 13:100607185-100607207 CCATCCACCTTCGCATTCCTTAA 0: 1
1: 0
2: 0
3: 20
4: 217
Right 1112572569 13:100607227-100607249 GTATCACATGCTGGGCATGGTGG 0: 1
1: 1
2: 13
3: 161
4: 1293
1112572559_1112572566 10 Left 1112572559 13:100607185-100607207 CCATCCACCTTCGCATTCCTTAA 0: 1
1: 0
2: 0
3: 20
4: 217
Right 1112572566 13:100607218-100607240 CTTTCATCAGTATCACATGCTGG 0: 1
1: 0
2: 1
3: 25
4: 256
1112572559_1112572568 16 Left 1112572559 13:100607185-100607207 CCATCCACCTTCGCATTCCTTAA 0: 1
1: 0
2: 0
3: 20
4: 217
Right 1112572568 13:100607224-100607246 TCAGTATCACATGCTGGGCATGG 0: 1
1: 0
2: 0
3: 22
4: 246
1112572559_1112572567 11 Left 1112572559 13:100607185-100607207 CCATCCACCTTCGCATTCCTTAA 0: 1
1: 0
2: 0
3: 20
4: 217
Right 1112572567 13:100607219-100607241 TTTCATCAGTATCACATGCTGGG 0: 1
1: 0
2: 0
3: 14
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112572559 Original CRISPR TTAAGGAATGCGAAGGTGGA TGG (reversed) Intronic
900351043 1:2234706-2234728 CTAAGGATTGCGAAAGTTGAGGG + Intronic
900758064 1:4451247-4451269 TGAAGGACTGGGAAGGAGGAAGG - Intergenic
901444903 1:9302262-9302284 TTAAGGAATACCCAGGTAGATGG + Intronic
901881389 1:12195897-12195919 TTAAGGGAGGCCAAGGTGGGAGG + Intronic
902095599 1:13942042-13942064 TTAAGGTCTGCTAAGGAGGAAGG + Intergenic
902285841 1:15408333-15408355 TTAAGGAATGCAAAGGACTAGGG - Intergenic
902603911 1:17558245-17558267 TGAATGAATGAGTAGGTGGATGG - Intronic
903556694 1:24199117-24199139 TTTTGGAATGCTGAGGTGGATGG - Intergenic
905891271 1:41520005-41520027 TGAAAGAATGGGAAGTTGGATGG + Intronic
907722078 1:56981456-56981478 TGAAGGAATGCACAGGTGGAGGG - Intergenic
907935828 1:59041463-59041485 TTAAGGAAGGGCAAGGAGGAAGG + Intergenic
908511706 1:64854802-64854824 GGAAGGAAGGTGAAGGTGGAAGG - Intronic
909175682 1:72355087-72355109 TTCAGGAGTCGGAAGGTGGAAGG + Intergenic
909258675 1:73458296-73458318 CTAAGGAATGCCAAGGTGATGGG + Intergenic
909330278 1:74400893-74400915 TTATGGAATGCCAGGGTGAATGG - Intronic
910053056 1:82998925-82998947 TTATTGAATGAGAAGATGGAAGG - Intergenic
910118412 1:83757843-83757865 CTAAGGAATGCCCAGGTGGCTGG + Intergenic
910260336 1:85288133-85288155 TTAAAAAATGAGAAGGTGGCTGG + Intergenic
911330443 1:96520192-96520214 GCAAGGAATGCAAAGGGGGAGGG - Intergenic
912441618 1:109703438-109703460 TTAAGGATTGCAAAAGGGGAGGG - Intronic
912442406 1:109709441-109709463 TTAAGGATTGCAAAAGGGGAGGG - Intronic
914684458 1:149965924-149965946 TTCAGAAATAGGAAGGTGGAAGG - Intronic
920258384 1:204672299-204672321 TTAAGCAATGGGGAGGGGGAAGG - Intronic
922303639 1:224325326-224325348 CTTAGGGAGGCGAAGGTGGAAGG + Intronic
922689732 1:227678668-227678690 TTATGGAATGCCAGGGTGAAGGG - Intergenic
923442287 1:234031993-234032015 TTCAGGAATGGGAAAATGGATGG - Intronic
924328397 1:242918813-242918835 TTAAGAAATGGGTAGGTGGTCGG + Intergenic
1063718817 10:8557579-8557601 TAAAAGAATGGGAGGGTGGAAGG + Intergenic
1065681048 10:28233176-28233198 TTAAGTAAATCGATGGTGGATGG + Intronic
1066640286 10:37548541-37548563 TTAAGAAATGGGAAGTTGGTGGG + Intergenic
1069066198 10:63944276-63944298 GTAAGGAATGCCAAGCTGGCTGG - Intergenic
1070025234 10:72625948-72625970 TTAGGGAAGGCGAAGGGGAAGGG - Intronic
1070229994 10:74555500-74555522 TTTTGGAAGGCCAAGGTGGAAGG + Intronic
1070771837 10:79087104-79087126 ACAAGCAATGGGAAGGTGGAGGG - Intronic
1072589774 10:96818771-96818793 TTTTGGAAGGCCAAGGTGGAAGG - Intergenic
1072757625 10:98031030-98031052 GGAAGGAACGCGAAGGGGGAGGG + Intergenic
1073348516 10:102802102-102802124 GGAAGGAAGGAGAAGGTGGAAGG - Intronic
1074168131 10:110904399-110904421 TTAAGGAATGCTGAGGGGGGTGG + Intronic
1077537565 11:3131785-3131807 TGAATGAATGGGTAGGTGGATGG - Intronic
1077704730 11:4473886-4473908 TTAAGGAAATGGAAGATGGACGG + Intergenic
1078081075 11:8205151-8205173 TTAGGGAAAAAGAAGGTGGAGGG - Intergenic
1079023005 11:16924526-16924548 TTTAGGAAGGCAAAGGAGGAGGG + Intronic
1079026312 11:16950677-16950699 TGAGGGAATGGGCAGGTGGAGGG - Intronic
1079362117 11:19777777-19777799 TCCAGGAATTCGTAGGTGGAAGG - Intronic
1082062910 11:47875699-47875721 TTAAGGATTTCAAAAGTGGAGGG + Intergenic
1085139278 11:74125856-74125878 CTAAGGAGTGCAGAGGTGGAGGG - Intronic
1085940524 11:81201279-81201301 TTATGGAATGCCAAGGTGAAGGG - Intergenic
1086358216 11:86028309-86028331 TTAAAGAATGGCAATGTGGAAGG + Intronic
1089422784 11:118344189-118344211 TTAAGGAGGGTGAAGGTGGTGGG - Intergenic
1089710553 11:120311451-120311473 TTAATGAATGGAAAGCTGGATGG + Intronic
1090391157 11:126388573-126388595 TTCTGGAAGGCCAAGGTGGATGG - Intronic
1091827525 12:3524088-3524110 TTATGGAATGTCAAGGTGAATGG - Intronic
1091866717 12:3844385-3844407 TTAAGGAATGAGAAGATAGAGGG + Intronic
1092333193 12:7604210-7604232 TTATGGAATGCCAGGGTGAAGGG - Intergenic
1092830714 12:12441871-12441893 TTGAGAAATGTGAAGCTGGATGG + Intronic
1093495338 12:19750672-19750694 TTAAGGCATGAGTAGGTGGGGGG - Intergenic
1095994426 12:48068115-48068137 TTTGGGAAGGCCAAGGTGGATGG - Intronic
1096379518 12:51144275-51144297 TTTTGGAAGGCTAAGGTGGAAGG - Intronic
1097297769 12:57985450-57985472 TTAAGGAAGGCAGTGGTGGATGG + Intergenic
1097989288 12:65818168-65818190 TTCAGGAATTCCAAGGTGGCAGG + Intergenic
1098979436 12:76939059-76939081 TAAAGGAAAGCGAAGGAGTAGGG + Intergenic
1099272659 12:80530945-80530967 TGAAGGAAGGCTAAGGTGGTAGG + Intronic
1101084902 12:101225956-101225978 CTAAGCAATGAGAAGGAGGAGGG - Intergenic
1101532785 12:105589736-105589758 TTAATGAAAGCAAAGATGGAAGG + Intergenic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1106065140 13:26340595-26340617 TTAAGAAATGTAAAGGAGGAAGG - Intronic
1107384767 13:39896065-39896087 GGAAGGAATGTGAAGGTGTAAGG + Intergenic
1107836512 13:44416213-44416235 TTTAGGAATGAAAGGGTGGATGG - Intergenic
1107962949 13:45575234-45575256 GTAAGGAATGCGCAGGCAGAAGG + Intronic
1109797952 13:67341392-67341414 TTATGGAATGCCAGGGTGAAGGG + Intergenic
1110690503 13:78426171-78426193 TTATGGAATGCCAAGGTGAATGG + Intergenic
1111250854 13:85599306-85599328 GTAAGAACTGCTAAGGTGGATGG - Intergenic
1111689636 13:91546975-91546997 TTTAGCAATGAGAAGGTAGATGG + Intronic
1111692411 13:91580707-91580729 GCAAGGAATAGGAAGGTGGATGG - Intronic
1112572559 13:100607185-100607207 TTAAGGAATGCGAAGGTGGATGG - Intronic
1113298266 13:108986377-108986399 TTAAGGGAGGCTGAGGTGGATGG + Intronic
1117536796 14:56710266-56710288 TAAGGGAATGGGAAGGAGGAAGG + Intronic
1117793867 14:59370912-59370934 TTAAGGAATAGACAGGTGGAGGG + Exonic
1117973080 14:61271392-61271414 TGAAGGCGTGAGAAGGTGGAGGG - Intronic
1121005009 14:90484511-90484533 GGTAGGAATGGGAAGGTGGATGG - Intergenic
1121385183 14:93514644-93514666 TAAAGAAATGCTAAGGCGGATGG - Intronic
1122570020 14:102690903-102690925 TGAATGAATGAGAAGGTGGTGGG + Intronic
1126771717 15:52063304-52063326 TTCAAGAAGGCCAAGGTGGATGG - Intronic
1126901565 15:53319725-53319747 TTAAGGAATGAGTAGGTTAATGG - Intergenic
1129166860 15:73783411-73783433 TTAAGGGATGGGAAGATGGCAGG - Intergenic
1130743838 15:86629290-86629312 TTAAGAAATGCCAAGATGCATGG + Intronic
1133511490 16:6462209-6462231 TGGAGGACTGCGAAGGTAGATGG - Intronic
1133912700 16:10080377-10080399 TTGCAGAAAGCGAAGGTGGAAGG + Intronic
1135669550 16:24363384-24363406 TGGGGGAATGGGAAGGTGGATGG + Intergenic
1137728439 16:50672656-50672678 TAAAGCAATTCCAAGGTGGAAGG + Exonic
1139525372 16:67512537-67512559 TTTAGGGATGCTGAGGTGGAAGG - Intergenic
1139932551 16:70540302-70540324 TTCGGGAAGGCCAAGGTGGATGG - Intronic
1140456481 16:75108788-75108810 TGAAGGAATGCTAAGGAGGTAGG - Exonic
1140561066 16:75982458-75982480 TTAAGGAAAGCATAGGTGGCCGG - Intergenic
1141171622 16:81695263-81695285 TTTAGGAAGGAGAAGGTAGAAGG - Intronic
1143301822 17:5916086-5916108 TCAAGGAGTGTGAAAGTGGAAGG - Intronic
1144073467 17:11695280-11695302 TTGAGGATGGCAAAGGTGGAAGG + Intronic
1145032562 17:19516058-19516080 CTTAGGAAGGCCAAGGTGGAGGG + Intronic
1145774134 17:27515053-27515075 TTAAGGAAGGAAAAGGAGGATGG + Intronic
1146768540 17:35546804-35546826 GTAAGGATTTCAAAGGTGGAGGG + Intergenic
1147055158 17:37828489-37828511 TTAAGGAAAGTGGAGGAGGAAGG + Intergenic
1147295401 17:39478138-39478160 TTTAGGGATGCCAAGGTGGAAGG - Intronic
1148619700 17:49025282-49025304 TAAAGGAATGAGAAAGTGGTGGG + Intronic
1150747207 17:67825682-67825704 AGAAGGAAAGCGAAGGGGGAGGG - Exonic
1153856150 18:9149440-9149462 TTAAGGAAAGCGATGGTTGGGGG + Intronic
1154239879 18:12643329-12643351 TTTAGGAATGAGAACTTGGAGGG + Intronic
1154307978 18:13244203-13244225 TTAATGGATGGGTAGGTGGATGG - Intronic
1155126055 18:22876824-22876846 ATAAGGAATGAGATGGTGAAAGG - Intronic
1158253675 18:55519991-55520013 TCAGGGGATGGGAAGGTGGAGGG - Intronic
1159179957 18:64890059-64890081 TTAAGGAAGGGGAAGGAGGAGGG + Intergenic
1160996428 19:1884217-1884239 TAAAGGAATGGGCAGGTGGTAGG + Intronic
1161258514 19:3322876-3322898 TGAATGGATGGGAAGGTGGATGG + Intergenic
1161258537 19:3322976-3322998 TGAATGGATGGGAAGGTGGATGG + Intergenic
1161782878 19:6305276-6305298 TTAAAGGATGGGTAGGTGGATGG + Intergenic
1165254904 19:34570603-34570625 TTAAGGACTTCGAAAGGGGAAGG - Intergenic
1166905526 19:46105948-46105970 TTAAGGAATGGAAAGGGGAATGG + Intergenic
1168138665 19:54369517-54369539 TAGAGGAATGCAAAGGTGGAGGG - Intronic
1168159411 19:54499266-54499288 TAGAGGAATGCAAAGGTGGAGGG + Intronic
1168437273 19:56329103-56329125 TTTAGGGAGGCCAAGGTGGATGG + Intronic
925056865 2:863070-863092 GGAAGGAAAGAGAAGGTGGAGGG - Intergenic
927037151 2:19189764-19189786 ATTGGGAATGGGAAGGTGGAAGG + Intergenic
936619039 2:114075985-114076007 ATAAGGAATGTGAAGTTGGCAGG + Intergenic
937733030 2:125257989-125258011 TTATGGAATGCCAGGGTGAATGG + Intergenic
937773409 2:125747918-125747940 AAAAGCAATGGGAAGGTGGAAGG + Intergenic
938595729 2:132785345-132785367 TGGAGCAATGCTAAGGTGGAAGG + Exonic
940799249 2:158115342-158115364 TGTAAGAATGCGAAGCTGGAGGG - Intronic
942997207 2:182277191-182277213 TTAAGGATTTCAAAGGGGGATGG - Intronic
943627894 2:190219103-190219125 TTCTGGAATGCCAAGGTGAATGG - Intronic
944805955 2:203281398-203281420 GTAAGGAAGGCTAAGGTGGGAGG + Intronic
946023830 2:216659975-216659997 CAAAGGAGTGAGAAGGTGGAAGG - Intronic
947135159 2:226970057-226970079 TTAAGGAATGCGGGGGGAGAGGG - Intronic
948358672 2:237401926-237401948 CTTAGGAAGGCTAAGGTGGAAGG - Intronic
948619952 2:239228032-239228054 CAAAGGGATGGGAAGGTGGAAGG + Intronic
1169056619 20:2627227-2627249 TTAAGCCCTGCCAAGGTGGAGGG - Intronic
1170258323 20:14372647-14372669 TAAAGGAATGGGGAGATGGAAGG - Intronic
1172068489 20:32238879-32238901 GTGAGGAATGCGGAGGTGAAGGG - Intergenic
1173609999 20:44360172-44360194 TGAATGAATGGGAAGATGGATGG + Intronic
1175005463 20:55677625-55677647 TTAAGAAATGCAAAGGTGGGTGG - Intergenic
1178155326 21:29846692-29846714 TTAAAGAATGAGAAGGGAGAAGG + Intronic
1179515120 21:41900851-41900873 TTTTGGAAGGCCAAGGTGGATGG + Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1183536717 22:38406057-38406079 CTTAGGAAGGCCAAGGTGGACGG - Intergenic
949554575 3:5142080-5142102 TTATGGAATGCCAGGGTGAAGGG + Intronic
952749202 3:36811533-36811555 TTAGGGACTCAGAAGGTGGAGGG + Intergenic
953446184 3:42969843-42969865 TTAAGAGTTGCGAAGGTGGGCGG - Intronic
953488477 3:43326027-43326049 TGAAGGAATGCTGAGTTGGAAGG + Intronic
953810928 3:46112307-46112329 TTATGGAATGCCAAGGTGAAGGG + Intergenic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
954954832 3:54510056-54510078 TTCATGAATGAGTAGGTGGATGG + Intronic
959541641 3:107546215-107546237 TTAAGGAATGAAAATATGGATGG - Intronic
961662131 3:128474844-128474866 TGAATCAATGCAAAGGTGGAGGG - Intergenic
962109170 3:132424762-132424784 TTAAGGAAGGCTAAGATGGTAGG + Intronic
966078197 3:175964697-175964719 TTTAGGGAGGCCAAGGTGGAAGG - Intergenic
966668839 3:182504611-182504633 TTAAGGATTGTGAAAGTGCATGG + Intergenic
966868401 3:184275062-184275084 TTAAGGAATGACAATATGGAAGG + Intronic
968160743 3:196424627-196424649 CTTTGGAATGCCAAGGTGGAAGG - Intronic
969618753 4:8268502-8268524 TCGGGGAATGGGAAGGTGGAGGG - Intergenic
970309029 4:14762247-14762269 GTAAGGAATGGGAAGAGGGAAGG + Intergenic
971439174 4:26661323-26661345 GTAAGGAAAAAGAAGGTGGAGGG - Intronic
971660919 4:29414793-29414815 TTAAGGAAGGAGAACTTGGAGGG + Intergenic
974713420 4:65633472-65633494 TTAATAAATGGGAAGATGGAAGG + Intronic
974804109 4:66857767-66857789 TTTAGGGAGGCTAAGGTGGAAGG - Intergenic
975757697 4:77587373-77587395 TTAAGGAATACGAAGCTGTAAGG + Intronic
978995087 4:115140768-115140790 TTCAGAAATGCGGAGGTGGAAGG - Intergenic
980522073 4:133948300-133948322 TTATGGAATGCCAGGGTGAATGG + Intergenic
980742238 4:136966886-136966908 TTAAGGCATGCATTGGTGGATGG + Intergenic
980954021 4:139410115-139410137 TTAAGGAATGCTGAGGAGGCAGG + Intronic
981046667 4:140271108-140271130 TGAAGCAATGAGAAGGAGGAGGG + Intronic
981471046 4:145135534-145135556 TTAAGGAATGAGAAGATAGAGGG - Exonic
981619972 4:146684588-146684610 TTAAGGAAGGAGGAGGTAGAGGG - Intergenic
981995645 4:150971463-150971485 TTGAGGAAAGAGAAGGTGGCTGG - Intronic
986921973 5:12696058-12696080 TTAAATAATGGGAAGGTGAAAGG + Intergenic
987593494 5:19964335-19964357 TTTTGGAAGGCCAAGGTGGAAGG + Intronic
988069497 5:26267945-26267967 TTAAGGAATGTGATGATGCAGGG - Intergenic
988995926 5:36714953-36714975 TTAAGGAATGAAAATGGGGAGGG - Intergenic
992271999 5:75074366-75074388 GTAGGGAATGCTATGGTGGAAGG - Intronic
995499208 5:112784953-112784975 TTAAGGAATGCTGAGGTGGTAGG + Intronic
996917852 5:128732781-128732803 TTAAGGAATGGAAAGGGGAATGG - Intronic
998309764 5:141117003-141117025 TTTTGGAAGGCCAAGGTGGAAGG + Intronic
999100702 5:149023517-149023539 TCAAGGAAAGGGAAGTTGGAAGG + Intronic
1001037852 5:168310727-168310749 TTGTGGAATGCTGAGGTGGAAGG + Intronic
1003851457 6:10227005-10227027 TTTTGGAAGGCCAAGGTGGAAGG + Intergenic
1005659281 6:27978022-27978044 TTAAGGAATAAGGAGGTGAAAGG + Intergenic
1007348505 6:41251240-41251262 TTCAGTGATGAGAAGGTGGAAGG - Intergenic
1007648300 6:43399627-43399649 TTATGGAATGCCAGGGTGAAGGG - Intergenic
1008899132 6:56591419-56591441 TTAAGGAATGGACAGTTGGAAGG - Intronic
1010213055 6:73377916-73377938 TTCAGGAAGGCCAAGGTAGAAGG - Intronic
1012878031 6:104752899-104752921 TTAAGTAATTCAAATGTGGATGG + Intronic
1012910021 6:105107775-105107797 TTGAAGAATGGGAATGTGGAAGG + Intronic
1013843081 6:114421246-114421268 GAAATGAATGTGAAGGTGGAGGG + Intergenic
1015485644 6:133766952-133766974 TTAGGGAATGAGAGAGTGGAAGG - Intergenic
1016393286 6:143596593-143596615 TTATGGGATGCCAAGGTGGGAGG + Intronic
1018397860 6:163394013-163394035 TTAGGGAATGGGGAGGTGTAAGG - Intergenic
1024022633 7:45385828-45385850 GTAGGGAATGGGAAGGTGGAAGG + Intergenic
1027878590 7:83802703-83802725 CTTTGGAATGCCAAGGTGGATGG + Intergenic
1028296812 7:89143149-89143171 TTAAGAAAAGCCAAGTTGGAGGG + Intronic
1028478551 7:91278355-91278377 GTAAAGAATGAGAATGTGGAAGG - Intergenic
1029083077 7:97990036-97990058 TCCAGGAATGCCAAGGTAGAGGG - Exonic
1029157584 7:98528302-98528324 CTAAGGAATGCCAAGGCGGCCGG - Intergenic
1030154758 7:106442867-106442889 TTAAGCAATTGGATGGTGGATGG + Intergenic
1031816423 7:126443347-126443369 ATAAGTAATACGAAGCTGGATGG - Intronic
1035948521 8:3992670-3992692 ACAAGGAATGCTAAGGTGGAAGG + Intronic
1040723815 8:50356974-50356996 TTAGGGAATGCGTAACTGGAAGG + Intronic
1042474840 8:69235507-69235529 TTAAGGAGTGAGAAGGTAGAGGG - Intergenic
1042589713 8:70385668-70385690 TTTTGGAAGGCCAAGGTGGAAGG - Intronic
1047561726 8:125993393-125993415 TTATGGAATGCCAGGGTGAATGG - Intergenic
1047658860 8:127010498-127010520 TAAAGGAATGAGAAGTTGAATGG + Intergenic
1049052455 8:140209431-140209453 TTAAGGACAGAGAAGGGGGACGG - Intronic
1053330434 9:37201346-37201368 GAAAAGAATGAGAAGGTGGAAGG - Intronic
1055985309 9:82053078-82053100 TTAAGTAATGTCAAGGTGGGAGG + Intergenic
1056102502 9:83313301-83313323 TTAAAAAATGGGAAAGTGGAAGG - Intronic
1057109000 9:92448937-92448959 TTAAGGAAAGGGAAGATGGAGGG + Intronic
1061218015 9:129232930-129232952 TGAATGAATGAGTAGGTGGATGG - Intergenic
1062199676 9:135295471-135295493 TTATGGAATGCCAGGGTGAATGG - Intergenic
1186307092 X:8273499-8273521 TTTAGGAATGAGAAGGTTTAAGG - Intergenic
1186434297 X:9529697-9529719 CTGTGGAATGCCAAGGTGGAAGG + Intronic
1186481906 X:9902348-9902370 TGGAGGCATGGGAAGGTGGATGG + Intronic
1187480178 X:19648228-19648250 TGAAGGGATGGGTAGGTGGAAGG + Intronic
1188346986 X:29079243-29079265 TTAATGAATGGGTAGATGGATGG - Intronic
1188977153 X:36689452-36689474 TTGAGGAATGCGTAGATGGCTGG + Intergenic
1190801882 X:53796710-53796732 TGAAGTAAGGGGAAGGTGGAGGG - Intergenic
1193049580 X:77085875-77085897 TTATAGAATGCCAAGGTGAATGG - Intergenic
1193611585 X:83637924-83637946 TGAATGAATGTGAAGGTGTAGGG + Intergenic
1194277519 X:91903886-91903908 CTAACGAATGAGATGGTGGAGGG + Intronic
1195455516 X:105064820-105064842 TTGAAGGATGTGAAGGTGGAAGG + Intronic
1195724089 X:107896101-107896123 TTTAGGAGGCCGAAGGTGGATGG + Intronic
1195906567 X:109850362-109850384 TTAAGGAATGACTAGGAGGAGGG + Intergenic
1196131391 X:112160712-112160734 TTACTGAATTAGAAGGTGGAGGG + Intergenic
1196645729 X:118116298-118116320 GAAAGGGATGCGAAGGTGTAAGG + Intronic
1196725373 X:118890464-118890486 TTATGGAATGCCAGGGTGAAAGG - Intergenic
1197077558 X:122371409-122371431 TCAGGGACTGGGAAGGTGGAGGG - Intergenic
1198870724 X:141175555-141175577 TTAAGAAATGCGTTGGTGAAGGG + Intergenic
1199924104 X:152444689-152444711 TTAAGGGAAGGGGAGGTGGATGG - Intronic
1201225780 Y:11817770-11817792 TTAAGAAATGGGTAGGTGGTAGG + Intergenic
1201305911 Y:12550401-12550423 TGGAGGCATGGGAAGGTGGATGG + Intergenic
1201920341 Y:19227023-19227045 TTTTGGGATGCCAAGGTGGATGG - Intergenic