ID: 1112574733

View in Genome Browser
Species Human (GRCh38)
Location 13:100625542-100625564
Sequence CCAGACTGTTACTACAACCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 92}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112574733_1112574737 8 Left 1112574733 13:100625542-100625564 CCGAGGTTGTAGTAACAGTCTGG 0: 1
1: 0
2: 1
3: 6
4: 92
Right 1112574737 13:100625573-100625595 TTCTGTGTTTAATTGCTGTCCGG 0: 1
1: 0
2: 3
3: 54
4: 751

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112574733 Original CRISPR CCAGACTGTTACTACAACCT CGG (reversed) Exonic
906190207 1:43894027-43894049 CCACACTGTTCCTGCAATCTGGG - Intronic
910576248 1:88767546-88767568 ACATGCTGTTACTACAGCCTAGG - Intronic
910779404 1:90912537-90912559 CCATACCTTTACTACAACCTTGG - Intergenic
913134199 1:115872363-115872385 CCCGACTTTTACTACATTCTAGG - Intergenic
921838610 1:219804312-219804334 CCAAACCATTACTACACCCTAGG - Intronic
922880445 1:228976449-228976471 TCAGAGTGTCACTTCAACCTGGG - Intergenic
924657429 1:245985605-245985627 CAAGACTGTTGCTCCAACTTCGG + Intronic
1065799980 10:29343387-29343409 CAAGACTTTTTCTACAACCTGGG + Intergenic
1073262941 10:102204141-102204163 CCAGACTGTAAGTACCACCTTGG - Intergenic
1077699681 11:4430110-4430132 TCAGACTTTTACTACATTCTTGG + Intergenic
1081633375 11:44704350-44704372 CCAGTCTGTTACCAGAGCCTGGG - Intergenic
1087252475 11:95918652-95918674 CCAGATTGAACCTACAACCTTGG - Intronic
1088390591 11:109310340-109310362 TCAAACTGTTACTTCAAACTAGG + Intergenic
1090106117 11:123854907-123854929 CCAGACTGCTTCTTTAACCTGGG + Intergenic
1090760811 11:129835610-129835632 CCAGGCTGCTACTGCCACCTTGG + Intronic
1093383790 12:18525348-18525370 CACCACTGTTACTCCAACCTGGG + Intronic
1098282068 12:68871787-68871809 CCTGACTGTTATTACAGCATCGG - Exonic
1099354588 12:81618330-81618352 CCAAACTGTTCCTACATACTAGG - Intronic
1104861187 12:131924786-131924808 CCAGACGGTCACTACAAACATGG + Intergenic
1108802102 13:54111127-54111149 CCAGACTGTTTCTAAGACCTAGG + Intergenic
1111400369 13:87725816-87725838 CCAGGTAGTTACAACAACCTTGG + Intergenic
1112574733 13:100625542-100625564 CCAGACTGTTACTACAACCTCGG - Exonic
1113368041 13:109696179-109696201 CCATACTGTTACTATTAGCTTGG - Intergenic
1116655842 14:47652924-47652946 CCAGATTCTTACTACACCATGGG + Intronic
1116855461 14:49948523-49948545 CCAGACTCTTATCTCAACCTTGG - Intergenic
1119379756 14:74221061-74221083 CCAGAATGTTTCACCAACCTCGG + Intergenic
1121391313 14:93577315-93577337 TCAGACTCTTACTACCTCCTTGG - Intronic
1124966890 15:34438903-34438925 CCATACTTTTATTACTACCTTGG - Intergenic
1128754765 15:70174164-70174186 GCAGACCCTGACTACAACCTTGG + Intergenic
1135405825 16:22197067-22197089 CCCAACTGTCTCTACAACCTTGG - Intergenic
1136033206 16:27518518-27518540 TCTGATCGTTACTACAACCTTGG + Intronic
1137067580 16:35864246-35864268 CCAGTCTGTTCCTGCAAGCTGGG + Intergenic
1139247949 16:65464706-65464728 CAAGACTGTTATGACCACCTAGG + Intergenic
1150897733 17:69233897-69233919 CCAGATTTTTCATACAACCTGGG - Intronic
1155273001 18:24158870-24158892 CCAGCCTTTTACTGCCACCTAGG + Intronic
926598473 2:14815978-14816000 TCAAGCTGTTGCTACAACCTTGG - Intergenic
933054449 2:77644138-77644160 CCTGACTGTTTCTCCAGCCTGGG - Intergenic
934675339 2:96245896-96245918 TCAGACTAGAACTACAACCTCGG + Intergenic
939928973 2:148208342-148208364 CCAGAATCTCACTAGAACCTGGG - Intronic
940161996 2:150723543-150723565 CCAGAATGATACCTCAACCTTGG - Intergenic
943227448 2:185196612-185196634 GCAGACTGTTAAGATAACCTAGG - Intergenic
947154853 2:227152162-227152184 CCAGACAGTTCTTACACCCTGGG + Intronic
948717530 2:239874891-239874913 CCCGCCTCTTGCTACAACCTTGG - Intergenic
1169595485 20:7193728-7193750 TCAGACTGTTACAACAATCAGGG - Intergenic
1173727512 20:45307797-45307819 CAGGACTGATACTAGAACCTGGG + Intronic
1183135116 22:35879803-35879825 GCAGACTATTACAAAAACCTGGG + Intronic
952871453 3:37904594-37904616 CCAGACTGAGACTAGACCCTGGG + Intronic
953890976 3:46751215-46751237 CCAGCCTCTGACTACACCCTTGG + Intronic
955009059 3:54996716-54996738 CCAGACTGGTACTAAGCCCTGGG + Intronic
957839623 3:85651733-85651755 CCAAACTCTGACTACACCCTTGG + Intronic
959007031 3:101031138-101031160 CCAGACTTTGACAACAACCAAGG - Intergenic
961539200 3:127589097-127589119 ACAGACTGTTTCTTCCACCTGGG + Intronic
963954365 3:151237089-151237111 CGAGACTGGTACTCCAGCCTGGG - Intronic
964209857 3:154214653-154214675 CCAGACTTTGTCTACATCCTAGG - Intronic
964539163 3:157759658-157759680 CCAGCCAGCTACAACAACCTAGG + Intergenic
967899089 3:194428974-194428996 CCAAACTATTAATAAAACCTGGG - Intronic
971918778 4:32909936-32909958 CCAGACTGTTTCTTTAACCAGGG + Intergenic
974787278 4:66635383-66635405 CCAGACTCCTATTACACCCTAGG + Intergenic
977003308 4:91531384-91531406 CCACACTGATACTACAAGATAGG - Intronic
978232127 4:106412365-106412387 CCAAACTGTTACTCCAATCTCGG - Intergenic
978628880 4:110719716-110719738 TCAGAATGTTTCTACACCCTCGG + Intergenic
982483370 4:155938046-155938068 CAAGACTGTTACTAGATCCATGG - Intronic
983366638 4:166799432-166799454 CCAGGCTATTGCTACAACCGAGG + Intronic
984073090 4:175140721-175140743 TCAGACTGTCATTACAATCTAGG + Intergenic
984927751 4:184821173-184821195 CCAGGCTGTGGCTACCACCTCGG + Exonic
988845098 5:35119763-35119785 CCAGACTGTTTTTACACTCTTGG + Intronic
993325172 5:86525541-86525563 CCAGAAAATTACTACAAACTAGG - Intergenic
996829056 5:127719941-127719963 CCAGACTCTTCCTCCAACATTGG + Intergenic
996891930 5:128431054-128431076 CTAGACTGCTATTAAAACCTGGG - Intronic
997204176 5:132031968-132031990 CCAGAATGTAAATACAACCCAGG + Intergenic
999391917 5:151199465-151199487 CCAGACTGTTCCCTCAACCCAGG + Intronic
999470174 5:151848208-151848230 CCAGATTGTTTGTACAATCTAGG - Intronic
1003423538 6:5980030-5980052 CCAGACTGCTACAACAATCAGGG + Intergenic
1004861935 6:19813217-19813239 TCAGGCTGTTACTTCTACCTGGG + Intergenic
1006946540 6:37788179-37788201 CCAAACTCCTACTCCAACCTAGG + Intergenic
1011528976 6:88299203-88299225 CCCTCCTGTTACTCCAACCTAGG + Intergenic
1013118998 6:107124798-107124820 CCAGAATGTGACTACAACCTGGG + Intergenic
1013460994 6:110375363-110375385 CTAGACTGCTTCTTCAACCTGGG - Intergenic
1013796860 6:113897712-113897734 CCAGCCTGTCAGTTCAACCTTGG + Intergenic
1017710177 6:157160506-157160528 CGAGGCTGTTACCACAACCAAGG - Intronic
1023125994 7:36954677-36954699 CCAGCCTATTAATAAAACCTTGG - Intronic
1027372745 7:77523396-77523418 CCAGACTTTTACTATGAACTTGG + Intergenic
1029288508 7:99483579-99483601 CAAGACTGTCACTCCAGCCTGGG + Intronic
1030759075 7:113328470-113328492 CCTCAATGTTTCTACAACCTTGG - Intergenic
1033867697 7:145713101-145713123 CCACACTGTAACCACAACTTGGG + Intergenic
1035866136 8:3084183-3084205 CCAAAGTGTTTCTACAACTTAGG + Intronic
1040650114 8:49438480-49438502 CCTGACTGTTTCTCCAAGCTTGG - Intergenic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1044298946 8:90561491-90561513 ACAGACTGTTACAACAATCCAGG + Intergenic
1046068129 8:109219684-109219706 CCAGACTGTTAGTAAAATGTAGG + Intergenic
1047573209 8:126123973-126123995 CGTGACTGTTCCTTCAACCTAGG - Intergenic
1048608626 8:135997344-135997366 CCAGTCTGTTCCTCCAATCTTGG - Intergenic
1051517657 9:17948846-17948868 CAAGACTGTTTCTACCAGCTGGG + Intergenic
1058551921 9:106123865-106123887 CCAGAGTGTTAGTGCAATCTGGG + Intergenic
1059935200 9:119303464-119303486 ACAGACTGTTCCTATCACCTGGG + Intronic
1061401183 9:130369379-130369401 CCCTACTGCTACTACAGCCTGGG - Intronic
1190211389 X:48451346-48451368 TCAAACTGATGCTACAACCTGGG + Intergenic
1190940068 X:55031402-55031424 CCAAATTGTTACAACAACCGGGG - Intergenic
1197245649 X:124163859-124163881 CAAGACTCTTTCTACAACCTAGG + Intronic
1201902418 Y:19057188-19057210 CCAGATTGTCACTCCAGCCTGGG + Intergenic