ID: 1112576751

View in Genome Browser
Species Human (GRCh38)
Location 13:100642959-100642981
Sequence GGGATGTTTTGGCTTCTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112576751_1112576759 14 Left 1112576751 13:100642959-100642981 CCAACAAGAAGCCAAAACATCCC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1112576759 13:100642996-100643018 CTGTAAGAAGCTCAGGTGGGTGG 0: 1
1: 0
2: 15
3: 351
4: 5713
1112576751_1112576756 7 Left 1112576751 13:100642959-100642981 CCAACAAGAAGCCAAAACATCCC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1112576756 13:100642989-100643011 GTGAACACTGTAAGAAGCTCAGG 0: 1
1: 0
2: 1
3: 18
4: 151
1112576751_1112576758 11 Left 1112576751 13:100642959-100642981 CCAACAAGAAGCCAAAACATCCC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1112576758 13:100642993-100643015 ACACTGTAAGAAGCTCAGGTGGG 0: 1
1: 0
2: 2
3: 90
4: 1402
1112576751_1112576757 10 Left 1112576751 13:100642959-100642981 CCAACAAGAAGCCAAAACATCCC 0: 1
1: 0
2: 2
3: 12
4: 165
Right 1112576757 13:100642992-100643014 AACACTGTAAGAAGCTCAGGTGG 0: 1
1: 0
2: 6
3: 110
4: 1870

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112576751 Original CRISPR GGGATGTTTTGGCTTCTTGT TGG (reversed) Intronic
908904167 1:68988758-68988780 GGTATGTTGTCTCTTCTTGTTGG - Intergenic
909135181 1:71789810-71789832 GGGTTGGTTTGGCTTATTTTTGG - Intronic
911177670 1:94833292-94833314 GGCATGTTTTGGGTTCTTCGGGG + Intronic
915645920 1:157272265-157272287 GGGATGCTGTGTCTTCATGTGGG - Intergenic
916088905 1:161291735-161291757 GGGATGTTTTGGGTATCTGTGGG + Intergenic
916664046 1:166949199-166949221 GGGATGCTGTGGCATCTAGTGGG - Intronic
919691299 1:200530791-200530813 TGGAGGTTTTGGCTTAATGTGGG - Intergenic
919813325 1:201422561-201422583 GGGATCTGTTGGCTTCTGGCTGG - Intronic
920460050 1:206132454-206132476 GGGATCCTTTGGCTTTGTGTCGG - Intergenic
920894762 1:210035877-210035899 TGGCTATTTGGGCTTCTTGTTGG + Intronic
921985609 1:221308822-221308844 GGGGTGTTATGGCTTGTTATAGG + Intergenic
922585431 1:226731136-226731158 GTGATGTTTTGGCTCTGTGTGGG + Intronic
1063428080 10:5965181-5965203 GAGATGGTTTGGCTGCTTCTGGG + Intronic
1064918804 10:20492711-20492733 AGGGCATTTTGGCTTCTTGTTGG + Intergenic
1071805864 10:89120079-89120101 TGGATATTTTGCCTTTTTGTTGG - Intergenic
1073718370 10:106135961-106135983 GGGTTGTTATGGCTTCTTGGTGG - Intergenic
1077179108 11:1204307-1204329 GGGAAGTTTTGGCTCCTGGAGGG - Intergenic
1077611423 11:3645335-3645357 GGGAAGTTTGGGATTCCTGTGGG + Intronic
1078693196 11:13602660-13602682 ATGATGTTTTGGCTTCTTGTGGG + Intergenic
1086667478 11:89501106-89501128 GGTATGTTTTGGCTGCTACTTGG + Intergenic
1087950764 11:104218480-104218502 GGGATGGTTTCTCTGCTTGTGGG - Intergenic
1092927643 12:13286867-13286889 GCTTTGTTTTGGCTTCTTGGAGG + Intergenic
1095327776 12:40918241-40918263 GAGAGGTTTTGGCTTCCTGTTGG + Intronic
1095866788 12:46980734-46980756 AGGCAGTTTTGGCTTTTTGTAGG - Intergenic
1095902016 12:47337668-47337690 GGGATGTTTTTGCTGGTTATAGG + Intergenic
1096532344 12:52249790-52249812 GGGATGTGTTGGCTTCTGGGAGG + Intronic
1097460213 12:59852655-59852677 AGGATGATTTGGCTTTTTTTTGG + Intergenic
1098026603 12:66210442-66210464 GGGATATTTTAGTTTTTTGTTGG + Intronic
1101039506 12:100740105-100740127 GGTAAGTGTTGGCTTCCTGTTGG + Intronic
1102606089 12:114068451-114068473 GAGATGGTTAGGCTTCTTCTGGG - Intergenic
1103773713 12:123349499-123349521 GAGATGTTTAGTGTTCTTGTGGG - Intronic
1104986805 12:132601795-132601817 GGTTTGTTTTGACTTCTTATGGG + Intergenic
1105321573 13:19328099-19328121 TGGCTGTTGTGGCTTTTTGTTGG - Intergenic
1105715728 13:23062302-23062324 GGTATGCTGTGGCTTCTTCTAGG - Intergenic
1106265895 13:28109700-28109722 AAGATGTTTTGTCTGCTTGTAGG - Intergenic
1108309209 13:49169584-49169606 GGGATGTTTTGAAATTTTGTGGG - Intronic
1109645407 13:65247825-65247847 GAGATATTTTTGCTTCTTATAGG - Intergenic
1111881388 13:93961146-93961168 TGGTTGTTTTGGCATCCTGTTGG + Intronic
1112151069 13:96764792-96764814 GGGGTGTTTTTGCTTTTTATGGG + Intronic
1112576751 13:100642959-100642981 GGGATGTTTTGGCTTCTTGTTGG - Intronic
1114590126 14:23856518-23856540 CAGATGTTTTAGCTTTTTGTTGG - Intergenic
1114810956 14:25898897-25898919 GGGATGCTTGGGCTTTTAGTTGG - Intergenic
1114831621 14:26149596-26149618 GGGATGTTGTGGCTTATCATTGG + Intergenic
1116491434 14:45507958-45507980 GGGATATTCTTTCTTCTTGTTGG - Intergenic
1117888517 14:60391929-60391951 GGGACGTTTTTGGTTCTTGGGGG + Intergenic
1118857038 14:69631708-69631730 GGGATGTTTTGTCATCCTGCAGG - Intronic
1119133654 14:72196953-72196975 GGGACATTTTGACCTCTTGTTGG + Intronic
1124242189 15:28037825-28037847 GGGATGTGTTGCCTTCTGGTGGG - Intronic
1125783352 15:42291501-42291523 GGTATGTTCTGGATTCTCGTGGG - Intronic
1134329195 16:13235189-13235211 GGGATGTGGGGGCATCTTGTTGG - Exonic
1135135556 16:19883943-19883965 GGGATGTGTGGGGTCCTTGTGGG + Intronic
1135142243 16:19931798-19931820 GGGGAGGTTTGGCTTCATGTAGG + Intergenic
1138078154 16:54063099-54063121 TGGATGTTGTGTCTTTTTGTTGG + Intronic
1141756878 16:85997149-85997171 TGGATGTTGTGGCTTCATGTGGG - Intergenic
1146687892 17:34853897-34853919 GGGCTATATTGGCTTCTTCTTGG + Intergenic
1146973007 17:37087665-37087687 GGCATGTTTTGGGTTTTTTTTGG - Intronic
1148454739 17:47804973-47804995 AGGTTGTTTTTGCTTCTTCTGGG - Intergenic
1148875879 17:50686895-50686917 GGGATGCTGTGGCCTCTGGTTGG + Intronic
1150156466 17:62857817-62857839 GGGATGTTCTGGAATCTTCTGGG + Intergenic
1151047442 17:70937949-70937971 CGGCTGTTTTGGATTCTTGTAGG + Intergenic
1152475198 17:80513381-80513403 GGGGTGTTTTGGATTCTTCCTGG - Intergenic
1152896432 17:82913993-82914015 GGAATGTTGTGGGTTCTAGTTGG + Intronic
1153475376 18:5493616-5493638 AGGTTGTTTTGGTTTCTTTTTGG - Intronic
1153645468 18:7192374-7192396 GGGATTTTTTGGCTTTTTTCCGG + Intergenic
1154030385 18:10748356-10748378 GGGATTTCTTAACTTCTTGTGGG + Intronic
1154120640 18:11649236-11649258 GGGGTGTTTTTGTTTTTTGTGGG + Intergenic
1157700508 18:49759132-49759154 GGGATGATTTAGCTTCCTGATGG + Intergenic
1159103311 18:63978771-63978793 GGAATATTTTGCTTTCTTGTGGG - Intronic
1160324369 18:77929779-77929801 TGGATGATTTTGCTTCTTATAGG - Intergenic
1167258566 19:48444656-48444678 GGGAAGTTTTGGCTTCAGGGAGG - Exonic
925866425 2:8231816-8231838 GGGTTGTTATGTCTTCTCGTTGG - Intergenic
928140989 2:28728795-28728817 GGGGTCTTTTGGGTTCTTGAAGG + Intergenic
929394703 2:41509589-41509611 GGGCTGGTCTGGCTTCTTATAGG - Intergenic
931298007 2:60948572-60948594 GGGTTGTTTTGGTTTTTTTTTGG + Intronic
931779433 2:65566674-65566696 GGGCTGTTTTGGTTTGTTTTTGG + Intergenic
932021764 2:68094702-68094724 GGGATGATGTGGCTCCTTGCTGG + Intronic
933108843 2:78371349-78371371 GGTATGATTTGACTTCTTATGGG + Intergenic
934188058 2:89763654-89763676 GGGATCTTTGGGGTTCTTGTGGG + Intergenic
935038937 2:99407015-99407037 GGGTTGTTCTGGCTTGATGTGGG - Intronic
935188265 2:100753904-100753926 GGGCTATTGTGGCTTCATGTAGG - Intergenic
935931780 2:108134395-108134417 GGGATGTGTTTGCATCATGTGGG - Intergenic
936066209 2:109334440-109334462 TGGGTGTCTTGGCTTCCTGTTGG + Intronic
939202927 2:139061941-139061963 GGGATCTTTGGGCTGCATGTGGG + Intergenic
942212501 2:173685477-173685499 GGGATGTTTTGAAATTTTGTGGG + Intergenic
943928285 2:193817367-193817389 GGGACTTTTTAGCTTCTTCTGGG - Intergenic
945741850 2:213673122-213673144 GGTAGGTTTTGGGTTCTTGAAGG - Intronic
946009816 2:216555479-216555501 GGGCTGCTTTGGCTTCTTGTGGG - Intronic
1169401036 20:5280627-5280649 TTGATGTTTTTGCTTTTTGTTGG - Intergenic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1173641051 20:44602115-44602137 AGGAGGTTTTGGTATCTTGTGGG - Intronic
1177072663 21:16529842-16529864 GGGATGCTATGTCTTCTTGCTGG + Intergenic
1180635030 22:17257287-17257309 AGGATGTTTTGGCTGCTTAGAGG + Intergenic
1181928270 22:26377831-26377853 GAAATGTTTTGTCTTATTGTTGG - Intronic
1184992051 22:48177270-48177292 GGGAGGTTTTGTCATCCTGTAGG + Intergenic
953179233 3:40581088-40581110 TGCATGTTTTGGGGTCTTGTAGG - Intergenic
953317670 3:41943757-41943779 GGGAGGTTTTGGCTTTTGGAAGG - Intronic
954101815 3:48379382-48379404 GGGATGCTTTGGTTTCAGGTTGG + Exonic
956566652 3:70646121-70646143 CTGATCTTTTGGCTTCTGGTTGG - Intergenic
956870302 3:73410431-73410453 TGGATGTGTTGGGTTCTAGTTGG + Intronic
957036825 3:75301280-75301302 GGGATGTTTTGGCATTCCGTTGG + Intergenic
957128821 3:76197805-76197827 AGGATGTTTTGAAATCTTGTTGG + Intronic
957712986 3:83888407-83888429 GGTATGTATTTCCTTCTTGTAGG + Intergenic
957830375 3:85508918-85508940 GAAATATTTTGGCTTCATGTTGG - Intronic
961312413 3:126011934-126011956 GAGATGTTGTGTCTTTTTGTTGG - Intronic
961568060 3:127777715-127777737 GGGAAGTTTTGTCTTCTTCCAGG - Intronic
964417619 3:156464310-156464332 AGGATGAATTGGCTTCTTATGGG + Intronic
966528470 3:180945762-180945784 AGGATGATCTGGGTTCTTGTTGG + Intronic
968061715 3:195730917-195730939 GGGATGGTGTGGCTTGTTGGAGG + Intronic
970378614 4:15483043-15483065 GGGATGTTTTCTCTTCGTCTTGG - Intronic
970754417 4:19407903-19407925 GGTATGTTTAGGGTTCTTGCTGG + Intergenic
970785641 4:19793121-19793143 ATGATGCTCTGGCTTCTTGTTGG - Intergenic
971864586 4:32152928-32152950 GGGGAGTTTTGTCTTCTTTTGGG - Intergenic
974579869 4:63782904-63782926 GGGATTTTTTTGCTTATTTTTGG - Intergenic
976592162 4:86859884-86859906 GGGGTTTTTTGGGTTTTTGTGGG + Intergenic
978421705 4:108540689-108540711 GGGATGATTTGACTGCATGTAGG - Intergenic
978929516 4:114293870-114293892 GGGATGCTTTTGCTTCCTGATGG + Intergenic
980755270 4:137150386-137150408 GGGATGATTTTGCTTATTATTGG - Intergenic
981037986 4:140191966-140191988 GGGAGTCTTGGGCTTCTTGTGGG + Intergenic
982386482 4:154810334-154810356 GGAATGTTTTGGTTGCTTTTGGG + Intronic
983120270 4:163874869-163874891 GGGATATTTTGTCCTCTTTTAGG + Intronic
983431596 4:167658029-167658051 GGGATTTTTTCACTTCTTCTAGG + Intergenic
984301371 4:177923072-177923094 GGGTTGTTTTGGTTTGTTCTTGG + Intronic
986350810 5:6878028-6878050 GTGATTTTTTGGCTTCTCCTTGG - Intergenic
986999910 5:13650113-13650135 GGATGGTTTTGGCTTCTTCTAGG + Intergenic
990893321 5:60671376-60671398 GGGAGCTGTTGGCTTCTTGGAGG - Intronic
991212706 5:64124431-64124453 GGAATGATTTGTCTTTTTGTAGG - Intergenic
992848305 5:80777343-80777365 GGGATGTTTTCTCTTTTTGCAGG + Intronic
993886126 5:93417864-93417886 GGGATTTTTTTTCTCCTTGTAGG + Intergenic
994225528 5:97248043-97248065 GGGATGTGTGAGCTTCCTGTGGG + Intergenic
994983124 5:106902181-106902203 GGTATGTTGTGTCTTCTCGTTGG + Intergenic
995908381 5:117154983-117155005 GAACTGTTTTGGCTTGTTGTAGG - Intergenic
996947236 5:129084961-129084983 GGGAAGTCTGGGCTTCTTGTAGG - Intergenic
997653657 5:135539736-135539758 GGCATGTTGTGGCTCCTTCTTGG + Intergenic
998223961 5:140311938-140311960 GTGGTGTCTTGGCTTCTTCTAGG - Intergenic
998282500 5:140825051-140825073 AGAATGTTTTGGCTTCATGAAGG - Intronic
1000131946 5:158308785-158308807 AGGATGCTTTGGGTTCTGGTGGG + Intergenic
1001145650 5:169182022-169182044 CTGATGGTTTGGCCTCTTGTTGG - Intronic
1002426474 5:179179644-179179666 GGGATGTTTTGTGTTCTCTTGGG + Intronic
1003330763 6:5126557-5126579 GGGCTGTTTTCACTTCTTGGCGG - Intronic
1004375347 6:15086324-15086346 GGGATGTTTTGGGTACATGTGGG - Intergenic
1005455616 6:26017217-26017239 GGGTTTTTTTGGATTCTTGGAGG + Exonic
1005457225 6:26032646-26032668 GGGATGTTTTGCTTTGTTTTGGG - Intergenic
1010845308 6:80700174-80700196 GGGATGTGTAGGCTTCTCTTGGG + Intergenic
1010928496 6:81772278-81772300 GGGAAGAGTTGGCTTCTTCTTGG - Intergenic
1011008450 6:82675649-82675671 GGGATGTTATTGCTTCTAGAAGG - Intergenic
1012661981 6:101911068-101911090 GGGCTGTTTTGTCTTCTGTTGGG + Intronic
1012830023 6:104192316-104192338 GGATTGTTTTATCTTCTTGTTGG - Intergenic
1013942016 6:115675967-115675989 GTGTTGTTCTAGCTTCTTGTTGG - Intergenic
1014117583 6:117683127-117683149 GGGTTTTTTCGGCATCTTGTTGG - Intronic
1015751382 6:136563173-136563195 TGGAGGTTTTGAATTCTTGTCGG - Intronic
1016517501 6:144911149-144911171 GGGAGGTTTTAGCTACTTTTGGG - Intergenic
1017888436 6:158620177-158620199 GGGATGGTTTGGCACCATGTGGG + Intronic
1021330322 7:19330157-19330179 GAGTTGTTTTTGCTTCTTGAAGG + Intergenic
1021407726 7:20292505-20292527 GGGAACTTCTGGCTTCTGGTGGG + Intergenic
1021920699 7:25482028-25482050 GGGATGTATGAGCTTCTTGCAGG + Intergenic
1024247451 7:47481000-47481022 GGGATCTTTTGGCTTCCTCTAGG - Intronic
1025587135 7:62804673-62804695 GGGATATTTTGGATTGTTTTGGG - Intergenic
1029024475 7:97401489-97401511 GGGCTCTTTTTGCCTCTTGTGGG + Intergenic
1032063978 7:128750406-128750428 AGGATGTTCTGGCTCCTTGCAGG + Intronic
1034205472 7:149310861-149310883 GGGATGTACAGGCTTCTTCTGGG - Intergenic
1035219504 7:157397467-157397489 GGAATCTTTTGGCCTTTTGTTGG + Intronic
1036937602 8:13018897-13018919 TGCATGTTTGTGCTTCTTGTTGG - Intronic
1037417420 8:18667007-18667029 GGGAGTTTTTTCCTTCTTGTGGG + Intronic
1039339912 8:36636490-36636512 CAGATGTGTTGGCTGCTTGTTGG - Intergenic
1044530867 8:93306241-93306263 CTGAAGTTTTGCCTTCTTGTGGG - Intergenic
1051932979 9:22408668-22408690 GGATTGTTATGTCTTCTTGTGGG - Intergenic
1055356845 9:75446490-75446512 GGAATGTTCTGGCATCTTGCTGG + Intergenic
1055737922 9:79352500-79352522 GGCATTCTTTTGCTTCTTGTTGG - Intergenic
1060305520 9:122407471-122407493 GGAATCTTTTGCCTTCTTGCTGG - Intergenic
1185925063 X:4136738-4136760 GAGGAGTATTGGCTTCTTGTGGG + Intergenic
1186592876 X:10950123-10950145 AGGATGGCTTGGCTTCTTTTGGG + Intergenic
1187038748 X:15570570-15570592 TGGATTTTTTGGCTCTTTGTGGG - Intronic
1187887546 X:23903753-23903775 GGTATGTTTTGGAAACTTGTGGG - Intronic
1190232014 X:48589676-48589698 GCAATGTTTTAGCTTATTGTAGG - Intergenic
1193198484 X:78660449-78660471 TGTGTGTTTTGGCTTCTTGGAGG - Intergenic
1197136218 X:123062671-123062693 AGGATGTTTTGACATCTGGTAGG + Intergenic
1200111777 X:153744256-153744278 GGGATCTTTGGGGCTCTTGTGGG - Exonic
1200244952 X:154517998-154518020 GGGATGGTTTGGATTCCTGTGGG + Intergenic
1201511548 Y:14769842-14769864 GGGATGCTGTGGCTTGGTGTGGG + Intronic
1201735129 Y:17251604-17251626 GTGATTTTTCTGCTTCTTGTTGG - Intergenic