ID: 1112578981

View in Genome Browser
Species Human (GRCh38)
Location 13:100662284-100662306
Sequence GCGGTGCCTGCACTCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112578981_1112578989 26 Left 1112578981 13:100662284-100662306 CCCCAGCAGAGTGCAGGCACCGC 0: 1
1: 0
2: 1
3: 11
4: 186
Right 1112578989 13:100662333-100662355 GCATCTCCTCAGTGGAGGCCTGG 0: 1
1: 1
2: 7
3: 55
4: 406
1112578981_1112578990 27 Left 1112578981 13:100662284-100662306 CCCCAGCAGAGTGCAGGCACCGC 0: 1
1: 0
2: 1
3: 11
4: 186
Right 1112578990 13:100662334-100662356 CATCTCCTCAGTGGAGGCCTGGG 0: 1
1: 0
2: 3
3: 24
4: 236
1112578981_1112578988 21 Left 1112578981 13:100662284-100662306 CCCCAGCAGAGTGCAGGCACCGC 0: 1
1: 0
2: 1
3: 11
4: 186
Right 1112578988 13:100662328-100662350 CATCAGCATCTCCTCAGTGGAGG 0: 1
1: 1
2: 1
3: 17
4: 197
1112578981_1112578987 18 Left 1112578981 13:100662284-100662306 CCCCAGCAGAGTGCAGGCACCGC 0: 1
1: 0
2: 1
3: 11
4: 186
Right 1112578987 13:100662325-100662347 GTACATCAGCATCTCCTCAGTGG 0: 1
1: 0
2: 2
3: 18
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112578981 Original CRISPR GCGGTGCCTGCACTCTGCTG GGG (reversed) Intronic
902415420 1:16236122-16236144 GAGGTGCCTGGAATCAGCTGTGG - Intronic
902712067 1:18247289-18247311 TGGGTGCCTGGACTGTGCTGGGG + Intronic
902740847 1:18436937-18436959 GCTGTGACTGCACTCAGCTCTGG + Intergenic
903054408 1:20625571-20625593 GGGGAGCCTGAACTCTGCTAAGG - Intergenic
904443885 1:30551795-30551817 GCGTTGCCTGCTGTCAGCTGTGG + Intergenic
904917553 1:33981267-33981289 GCTGTGACTGCACACTCCTGAGG - Intronic
905630180 1:39514229-39514251 GAGACGCCTGCACGCTGCTGTGG + Intronic
905667580 1:39771961-39771983 GAGACGCCTGCACGCTGCTGTGG - Intronic
907518036 1:55005854-55005876 GCCGGGCCTGCACTCAGCAGTGG + Intronic
909496178 1:76281439-76281461 GAGATGCCTGCAGCCTGCTGGGG + Intronic
910513782 1:88036316-88036338 GAGGTGGCTGCACTGTGCTGGGG - Intergenic
911381432 1:97119995-97120017 TCAGTGCCTGCCCTCTGCAGAGG + Intronic
913110637 1:115654362-115654384 GCGATGCCTGCAGTCTCCAGAGG + Intronic
915944484 1:160140004-160140026 GTGGGGCTTGCACTTTGCTGGGG - Intronic
924062597 1:240191070-240191092 GCGTTGCCTGCGTTCTTCTGTGG + Intronic
1064120110 10:12611230-12611252 GGGTTGCCTGCACTTTGATGGGG - Intronic
1064453318 10:15463867-15463889 GCAGTGTCTGCACAATGCTGGGG - Intergenic
1065068933 10:22002940-22002962 GCGATGCCTTCTCTCTGCTCCGG - Intronic
1065829902 10:29605381-29605403 GCTGCTCTTGCACTCTGCTGAGG - Intronic
1067084030 10:43228831-43228853 GCAGTGCCTGCACACAGCAGGGG + Intronic
1067526253 10:47040458-47040480 GCAGTGACTGCTCTCCGCTGAGG + Intergenic
1067765538 10:49083069-49083091 GGGGTTCCTGGACTCTGCTGAGG - Intronic
1067776339 10:49167415-49167437 GAGGAGCCTGCAGTCAGCTGGGG + Intronic
1069956872 10:72057339-72057361 GAGGAGCCTGCAGCCTGCTGAGG - Intergenic
1070954258 10:80454200-80454222 GCGGCGCCTGCCGTCTGCCGAGG - Exonic
1073945518 10:108745506-108745528 AAGGTGTTTGCACTCTGCTGTGG - Intergenic
1077802161 11:5550649-5550671 AGGGTGCCTGCACTCAGCCGGGG + Intronic
1079630340 11:22666936-22666958 GCGGTGCGCGCACGCTGCGGCGG - Intronic
1079869521 11:25780588-25780610 GGGGTGGCTACACTGTGCTGGGG - Intergenic
1082083365 11:48029085-48029107 GGGGTGCAGGCCCTCTGCTGAGG + Intronic
1083857607 11:65400877-65400899 GTGGTGCCTGCACACGGGTGGGG + Intronic
1084485068 11:69443409-69443431 GCGGTGGCTGCAGGCAGCTGAGG + Intergenic
1085039009 11:73315978-73316000 GGGGTGCCTCCACCCTGCTTTGG - Intronic
1085408882 11:76280111-76280133 GCCCTGCCCTCACTCTGCTGTGG - Intergenic
1089528225 11:119110566-119110588 GCGTTGCCAGCTCTCTGCTGAGG + Exonic
1092994513 12:13935991-13936013 ACAGTGGCTGCACTGTGCTGAGG + Intronic
1095970879 12:47901359-47901381 GCAGTGCCTGCATCCCGCTGTGG - Intronic
1102983127 12:117258238-117258260 GAGGTGTCTGCAGTCTACTGGGG - Intronic
1104972259 12:132537171-132537193 GTGGTGGGTGCCCTCTGCTGTGG + Intronic
1106000936 13:25722409-25722431 GTGCTGCCTGCATTTTGCTGGGG + Intronic
1109785186 13:67164664-67164686 CAGGTGCCTGCACTCTGATCAGG + Intronic
1112290832 13:98143143-98143165 GCGGTGCGGGCGCTCGGCTGGGG + Intronic
1112578951 13:100662154-100662176 GCGGTGCCCGTACCCTGCTGGGG + Intronic
1112578981 13:100662284-100662306 GCGGTGCCTGCACTCTGCTGGGG - Intronic
1113050417 13:106205402-106205424 GTAATGCCTGCACTCTACTGTGG + Intergenic
1113600619 13:111565810-111565832 GCGGTCCCCTTACTCTGCTGTGG + Intergenic
1113715468 13:112503082-112503104 GCTGGGCCTGCACTCTCCTCAGG - Intronic
1114878365 14:26751997-26752019 GAGGAGCCTGAACTCTGCTAAGG - Intergenic
1116872696 14:50083272-50083294 GAGGTGACATCACTCTGCTGTGG - Intergenic
1119323438 14:73744952-73744974 GTGGAGCCTGCTGTCTGCTGGGG - Intronic
1119665072 14:76479642-76479664 GGGCTGCCTACACTCTGCTGGGG + Intronic
1122197167 14:100097151-100097173 GCAGTCACTGCACTTTGCTGGGG - Intronic
1122599879 14:102915900-102915922 GCTGGGCCTGCTGTCTGCTGGGG - Intergenic
1122651232 14:103228311-103228333 GCGGTGTCTGCCCTCTGCCTGGG - Intergenic
1122742926 14:103882166-103882188 GCGGTGGCTGCTCTCAGCCGGGG - Intergenic
1122881383 14:104691965-104691987 GTGGTGCCTGTCCTCTCCTGAGG + Intronic
1124139101 15:27061881-27061903 GCACTGCCTGCCCTCTGCTCTGG + Intronic
1132800303 16:1748746-1748768 GCTGTGCCTGCACAATGCTGGGG + Intronic
1132869767 16:2110696-2110718 GCCGTACCTGTTCTCTGCTGTGG - Exonic
1133695708 16:8260474-8260496 GTGGTCCTTGCTCTCTGCTGTGG - Intergenic
1134135236 16:11673031-11673053 GGGGTGCCTGCCCTCCCCTGGGG - Intronic
1134492141 16:14703316-14703338 GCGCTGCCTGGAGGCTGCTGCGG + Intergenic
1134497522 16:14742438-14742460 GCGCTGCCTGGAGGCTGCTGCGG + Intronic
1134717654 16:16364905-16364927 GCCGTACCTGTTCTCTGCTGTGG + Intergenic
1134957098 16:18387254-18387276 GCCGTACCTGTTCTCTGCTGTGG - Intergenic
1135509033 16:23066009-23066031 GCGGTGGCTACACACTGATGGGG + Exonic
1136682593 16:31976715-31976737 GCGGGACCAGCCCTCTGCTGTGG + Intergenic
1136782854 16:32917883-32917905 GCGGGACCGGCCCTCTGCTGTGG + Intergenic
1136886942 16:33935967-33935989 GCGGGACCGGCCCTCTGCTGTGG - Intergenic
1137661505 16:50210704-50210726 TCAGAGCCTGCCCTCTGCTGGGG + Intronic
1138373886 16:56549165-56549187 CAAGTGGCTGCACTCTGCTGTGG - Intergenic
1141409239 16:83821292-83821314 GCCGTGGCTGGTCTCTGCTGGGG - Intergenic
1203085502 16_KI270728v1_random:1181867-1181889 GCGGGACCGGCCCTCTGCTGTGG + Intergenic
1142891910 17:2949129-2949151 GCAGAGCCAGCACTCAGCTGAGG - Intronic
1145202071 17:20954856-20954878 GAGAAGCCTACACTCTGCTGAGG - Intergenic
1146952481 17:36916517-36916539 GTGGGGCCAGCACTCTGCAGAGG - Intergenic
1147143114 17:38470055-38470077 GCGGGACCCGCCCTCTGCTGTGG + Intronic
1147170663 17:38616979-38617001 GCGGTCCCTGCCCTGTTCTGGGG - Intergenic
1148625701 17:49067441-49067463 GAGATGCCAGGACTCTGCTGTGG - Intergenic
1149083592 17:52687138-52687160 TGGGTGCCTGCATTCAGCTGAGG - Intergenic
1150617585 17:66784208-66784230 GCGTGGCCTGCACCCTGCAGGGG - Intronic
1151719841 17:75848774-75848796 GCTGGGCCTGCACTGTGATGGGG + Intronic
1151799706 17:76371045-76371067 GCGGAGGCTGCAGTCAGCTGAGG - Intronic
1152316448 17:79583429-79583451 ACAGTGACTGCACTCAGCTGGGG + Intergenic
1152575326 17:81137473-81137495 GCGGTGGGTGCACTCGGCTGTGG - Intronic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1155870113 18:31016661-31016683 GCTGTGCCTGCTGTCTGCTGAGG - Intronic
1159581387 18:70237350-70237372 GCAGTGCCTGAGCTCTGCTAAGG + Intergenic
1166140105 19:40800840-40800862 GCAGCGCCTTCACTCTGCAGCGG - Exonic
1167119503 19:47508085-47508107 GCAGAGGCTGCTCTCTGCTGGGG + Intronic
925048049 2:789553-789575 GCCGTGCCTCCCCTCTGCAGCGG - Intergenic
925646800 2:6044472-6044494 GAGGTGACTGCTCTGTGCTGGGG - Intergenic
926168285 2:10535120-10535142 GTGGTCCCTGTACTCTGCTCTGG + Intergenic
927212151 2:20645557-20645579 GCCCTGCCTGCACTTTGCTCGGG - Intronic
927254103 2:21024945-21024967 TGGGTGCCCGCACTCTGCAGGGG - Exonic
930938717 2:56987355-56987377 GTGGTGTCTGGACTCTGCTAAGG + Intergenic
934662021 2:96148061-96148083 GCCCTGCCTCCTCTCTGCTGTGG - Intergenic
934990831 2:98920483-98920505 GGGGTGCCAGCACTTTCCTGCGG + Intronic
935012798 2:99151393-99151415 GCGGAGGCTGCACTGAGCTGAGG + Exonic
935707781 2:105871430-105871452 GTGTTGCCTGCAGTCTGCTCAGG + Intronic
935717928 2:105954910-105954932 GCGGTCCCTGTGCTGTGCTGAGG + Intergenic
936151330 2:110023902-110023924 GATGAGCCTGCACTCTGATGGGG + Intergenic
936193345 2:110347467-110347489 GATGAGCCTGCACTCTGATGGGG - Intergenic
937113506 2:119385937-119385959 GCTCTGCCTGCATTCGGCTGGGG - Intergenic
938452159 2:131431072-131431094 AGGGAGCCTGCATTCTGCTGAGG + Intergenic
938618019 2:133019901-133019923 TCGGAGCCTGCACACTGCTATGG + Intronic
944547254 2:200811277-200811299 GCGGTCCCTGCGCGCTGCAGCGG - Intronic
945101542 2:206266891-206266913 GCAGTGGCTGCCGTCTGCTGGGG + Intergenic
946327723 2:218993355-218993377 CCGGTGAATGCCCTCTGCTGGGG - Exonic
949010558 2:241676032-241676054 GTGGGGTCTGGACTCTGCTGGGG + Exonic
949014374 2:241701525-241701547 GCGGTGCCGGCCCTCGGCTCAGG + Intergenic
1171017238 20:21553094-21553116 GAGGTGCCAGCATTATGCTGGGG + Intergenic
1171217223 20:23361546-23361568 GCGGTGCCCCCGCCCTGCTGGGG - Intergenic
1172249051 20:33465984-33466006 GCAGTTCCTGCCGTCTGCTGTGG + Intergenic
1173866895 20:46317981-46318003 GCTGTGCCTGCCCTGGGCTGTGG + Intergenic
1174164413 20:48574676-48574698 GAGGTGCCTGCCATCTGCTGGGG + Intergenic
1174955201 20:55090255-55090277 GAGGTGCCTGCACCTAGCTGTGG - Intergenic
1175458437 20:59132855-59132877 GCTGAGGCTCCACTCTGCTGAGG + Intergenic
1175848887 20:62076310-62076332 GCGGAGCTTGCACTGAGCTGAGG + Intergenic
1176107980 20:63398586-63398608 TCCTTGCCTGCCCTCTGCTGAGG - Intergenic
1180130080 21:45821537-45821559 TCCCTGCCTGCACCCTGCTGTGG + Intronic
1182624815 22:31638120-31638142 GCTGTGCCTGCCCTTGGCTGTGG + Intronic
1183186033 22:36292177-36292199 GGGGTGCCTGGAAACTGCTGAGG - Exonic
1185068110 22:48642065-48642087 GAGGGGCCTGCACTTTTCTGAGG + Intronic
1185284294 22:49993460-49993482 GCGGTGGGTGCACTGGGCTGTGG + Intergenic
1185289801 22:50017622-50017644 GTGGGGCCTGGACCCTGCTGAGG + Intronic
949891586 3:8737454-8737476 GGGGTGCCTCCCCTCTACTGGGG - Intronic
953405023 3:42655710-42655732 GGGGTGGCTGAACCCTGCTGAGG + Intronic
954215272 3:49121028-49121050 GCGGTGCATGGGTTCTGCTGGGG + Intergenic
954455807 3:50599290-50599312 GCTGTGCTTGTACTCTGCAGTGG - Intergenic
959105365 3:102059033-102059055 GCGGTACCTGCTGTCTGCTTTGG + Intergenic
961182374 3:124887027-124887049 GCGGTCGCTGCACTCCGCGGGGG + Exonic
961684501 3:128620361-128620383 AGGGTGCCTGCACTTTGCTGTGG - Exonic
962640855 3:137384906-137384928 GCTGTTCTTGAACTCTGCTGTGG + Intergenic
963001378 3:140684827-140684849 GCAGTGCCTTCACCATGCTGAGG - Intronic
965058340 3:163750003-163750025 GGGGTGGTTGCACTGTGCTGGGG - Intergenic
968709430 4:2102251-2102273 GTGGATCCTGCACTCTGTTGGGG - Intronic
968905706 4:3449693-3449715 GAGGGGGCTGGACTCTGCTGGGG - Intergenic
979863459 4:125723605-125723627 GCGGTGGCTGCACAGTGATGGGG + Intergenic
980250678 4:130310543-130310565 GTGGTGTTTGCTCTCTGCTGGGG - Intergenic
980917272 4:139045281-139045303 GGTGTGCCTGCACTCCCCTGAGG - Exonic
985988342 5:3535860-3535882 GCGGTGCCTGCCCTCCACGGCGG + Intergenic
990381850 5:55227063-55227085 GCAGTGCCAGCATTCTGTTGGGG + Exonic
993018545 5:82563879-82563901 GAGGTGGTTGCTCTCTGCTGGGG - Intergenic
997444295 5:133930107-133930129 ACGGTGCCTCCTCTCTTCTGAGG + Intergenic
998231386 5:140363489-140363511 GCGGTGCCTGTCCTCAGCCGAGG - Exonic
1002171881 5:177379273-177379295 GCCTTGCCTGCTCTGTGCTGGGG + Intronic
1002198450 5:177513613-177513635 GGGGTCCCTGCAGTCTGATGTGG + Intronic
1003564089 6:7207983-7208005 GTGATGCCTCCAGTCTGCTGTGG + Intronic
1005348513 6:24912228-24912250 GGAGTGCCTGCTCTGTGCTGGGG - Intronic
1005737768 6:28764933-28764955 GCTGAGGCTGCACTCAGCTGGGG - Intergenic
1006938933 6:37738587-37738609 GCGGGAACTGAACTCTGCTGAGG + Intergenic
1015910089 6:138161571-138161593 GCGGCGCCTGCACCACGCTGGGG + Intergenic
1021571304 7:22067979-22068001 GAGGTGCCTTCCCTTTGCTGCGG + Intergenic
1022439417 7:30420859-30420881 GCGGTGCCTGAACACTGGTCTGG + Intergenic
1023973315 7:45008108-45008130 GCGGAGCCTGCAGTGAGCTGAGG - Intronic
1024234076 7:47384717-47384739 GCTGTGACTCCACTGTGCTGAGG - Intronic
1026188513 7:68103085-68103107 GAGGTGCCTGCACCCCGCCGAGG + Intergenic
1026895486 7:74007842-74007864 CCCGTGCCTGCACTCCACTGTGG - Intergenic
1028147258 7:87331671-87331693 GAGGTGCCTGAATTCTGCTAAGG + Intergenic
1028985572 7:97006190-97006212 GCACTGCCTGCACTCGGCGGCGG + Exonic
1029110179 7:98210118-98210140 GCGGTGACTGCACGCTGCTGGGG - Intergenic
1030679186 7:112416242-112416264 GCGGTGCCTTCATGCTGCTAGGG - Intergenic
1033367641 7:140683802-140683824 GCTGTCCCTGCACTCTGGGGTGG - Intronic
1033589671 7:142798569-142798591 GGGGTTCCTGCAGTCAGCTGGGG + Intergenic
1034825226 7:154256326-154256348 GAGGTGCCTGCCTTCTGCAGGGG - Intronic
1036710676 8:11076641-11076663 TCGGGGCCTGCCCTGTGCTGGGG - Intronic
1037842588 8:22255906-22255928 GAGGAGCCTGCACTCTAGTGAGG + Intergenic
1038388414 8:27171905-27171927 GATCTGCCTGCACTTTGCTGTGG + Intergenic
1038453229 8:27653201-27653223 TCGGTGCCTGCGCTCTTCTCTGG - Intronic
1039902056 8:41759894-41759916 GCTGTGCCTCCTCCCTGCTGTGG - Intronic
1040434858 8:47380429-47380451 GCGGGGCCTGCTGTTTGCTGTGG + Intronic
1042555225 8:70028735-70028757 GAGGTGCCTCCATTCTGCTCTGG + Intergenic
1045544079 8:103112416-103112438 TCAGTGCCTGCTCTCTTCTGTGG - Intergenic
1046596980 8:116272693-116272715 GCCCTGCCTCCACTGTGCTGTGG - Intergenic
1048161696 8:132027416-132027438 GCAGTCCATGCACTGTGCTGAGG + Intronic
1049102064 8:140587080-140587102 TCTGTGCCTGGACTCTGCTTGGG - Intronic
1049421985 8:142521069-142521091 GAGTTCCCTGCCCTCTGCTGTGG + Intronic
1049423773 8:142528292-142528314 GGGGTCCCTGCGCTCAGCTGAGG - Intronic
1049568338 8:143355160-143355182 CCGGTACCTGCCCTCTGGTGAGG - Intronic
1049867145 8:144946550-144946572 GTGGGGCCTGTACCCTGCTGTGG + Intronic
1049867229 8:144946898-144946920 GTGGGGCCTGTACCCTGCTGTGG + Intronic
1049867283 8:144947115-144947137 GTGGGGCCTGTACCCTGCTGTGG + Intronic
1049867318 8:144947262-144947284 GTGGGGCCTGTACCCTGCTGTGG + Intronic
1049867324 8:144947281-144947303 GTGGGGCCTGTACCCTGCTGCGG + Intronic
1050181766 9:2930749-2930771 GATATGCCTGCATTCTGCTGGGG - Intergenic
1055373503 9:75624915-75624937 GAGGTGGCTGCACTGTGATGGGG + Intergenic
1055428325 9:76218218-76218240 GCTTTTCCTGCACTGTGCTGTGG - Intronic
1055695744 9:78882354-78882376 GATCTGCCTGAACTCTGCTGTGG + Intergenic
1056907521 9:90666246-90666268 ACGGTGCATGGTCTCTGCTGTGG - Intergenic
1062580554 9:137227508-137227530 GCTCTGCCTGCAGTCTGGTGTGG + Exonic
1062707568 9:137953856-137953878 GAGGTGCCTGGGCTGTGCTGAGG + Intronic
1186290611 X:8093710-8093732 GAGGAGCCTGCAGTTTGCTGTGG + Intergenic
1191019305 X:55842532-55842554 AGGGTGGCTGCACTGTGCTGGGG + Intergenic
1192149752 X:68704969-68704991 GCGGTGACTGCTCTCCACTGTGG - Intronic
1194539787 X:95156365-95156387 GGGGTGGCTGCATTCTGCTAGGG - Intergenic
1196234402 X:113261887-113261909 GGGATGGCTGCACTGTGCTGGGG + Intergenic
1198960250 X:142175271-142175293 GCGGGGCCTCCACTCTGCAGAGG + Intergenic
1200215401 X:154365992-154366014 GCCCTGACTGCCCTCTGCTGTGG - Intronic