ID: 1112582487

View in Genome Browser
Species Human (GRCh38)
Location 13:100688435-100688457
Sequence GGGCAGATTAATGCACATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112582481_1112582487 3 Left 1112582481 13:100688409-100688431 CCACTTTCAAGCACATGCAAATT No data
Right 1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG No data
1112582480_1112582487 4 Left 1112582480 13:100688408-100688430 CCCACTTTCAAGCACATGCAAAT No data
Right 1112582487 13:100688435-100688457 GGGCAGATTAATGCACATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112582487 Original CRISPR GGGCAGATTAATGCACATTG GGG Intergenic
No off target data available for this crispr