ID: 1112583479

View in Genome Browser
Species Human (GRCh38)
Location 13:100696357-100696379
Sequence GAGCCAGAAAATAAGGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112583479_1112583487 6 Left 1112583479 13:100696357-100696379 CCAGAAGCCTTATTTTCTGGCTC No data
Right 1112583487 13:100696386-100696408 TATTGAGGCAGGTGGTAGAGGGG No data
1112583479_1112583482 -5 Left 1112583479 13:100696357-100696379 CCAGAAGCCTTATTTTCTGGCTC No data
Right 1112583482 13:100696375-100696397 GGCTCACCTGATATTGAGGCAGG No data
1112583479_1112583485 4 Left 1112583479 13:100696357-100696379 CCAGAAGCCTTATTTTCTGGCTC No data
Right 1112583485 13:100696384-100696406 GATATTGAGGCAGGTGGTAGAGG No data
1112583479_1112583481 -9 Left 1112583479 13:100696357-100696379 CCAGAAGCCTTATTTTCTGGCTC No data
Right 1112583481 13:100696371-100696393 TTCTGGCTCACCTGATATTGAGG No data
1112583479_1112583483 -2 Left 1112583479 13:100696357-100696379 CCAGAAGCCTTATTTTCTGGCTC No data
Right 1112583483 13:100696378-100696400 TCACCTGATATTGAGGCAGGTGG No data
1112583479_1112583486 5 Left 1112583479 13:100696357-100696379 CCAGAAGCCTTATTTTCTGGCTC No data
Right 1112583486 13:100696385-100696407 ATATTGAGGCAGGTGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112583479 Original CRISPR GAGCCAGAAAATAAGGCTTC TGG (reversed) Intergenic