ID: 1112583482

View in Genome Browser
Species Human (GRCh38)
Location 13:100696375-100696397
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112583479_1112583482 -5 Left 1112583479 13:100696357-100696379 CCAGAAGCCTTATTTTCTGGCTC No data
Right 1112583482 13:100696375-100696397 GGCTCACCTGATATTGAGGCAGG No data
1112583477_1112583482 28 Left 1112583477 13:100696324-100696346 CCTGCTCTAGGGGACTTTGAATC No data
Right 1112583482 13:100696375-100696397 GGCTCACCTGATATTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112583482 Original CRISPR GGCTCACCTGATATTGAGGC AGG Intergenic
No off target data available for this crispr