ID: 1112583568

View in Genome Browser
Species Human (GRCh38)
Location 13:100697140-100697162
Sequence CTTTGCATGTAATTGAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112583568_1112583578 29 Left 1112583568 13:100697140-100697162 CCCACTTTCAATTACATGCAAAG No data
Right 1112583578 13:100697192-100697214 GTTATTTAGCACCTTTTAAGGGG No data
1112583568_1112583577 28 Left 1112583568 13:100697140-100697162 CCCACTTTCAATTACATGCAAAG No data
Right 1112583577 13:100697191-100697213 AGTTATTTAGCACCTTTTAAGGG No data
1112583568_1112583575 5 Left 1112583568 13:100697140-100697162 CCCACTTTCAATTACATGCAAAG No data
Right 1112583575 13:100697168-100697190 AGTGGGTTAATGCAAATTTGGGG No data
1112583568_1112583574 4 Left 1112583568 13:100697140-100697162 CCCACTTTCAATTACATGCAAAG No data
Right 1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG No data
1112583568_1112583573 3 Left 1112583568 13:100697140-100697162 CCCACTTTCAATTACATGCAAAG No data
Right 1112583573 13:100697166-100697188 GGAGTGGGTTAATGCAAATTTGG No data
1112583568_1112583576 27 Left 1112583568 13:100697140-100697162 CCCACTTTCAATTACATGCAAAG No data
Right 1112583576 13:100697190-100697212 GAGTTATTTAGCACCTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112583568 Original CRISPR CTTTGCATGTAATTGAAAGT GGG (reversed) Intergenic
No off target data available for this crispr