ID: 1112583574

View in Genome Browser
Species Human (GRCh38)
Location 13:100697167-100697189
Sequence GAGTGGGTTAATGCAAATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112583568_1112583574 4 Left 1112583568 13:100697140-100697162 CCCACTTTCAATTACATGCAAAG No data
Right 1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG No data
1112583569_1112583574 3 Left 1112583569 13:100697141-100697163 CCACTTTCAATTACATGCAAAGT No data
Right 1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112583574 Original CRISPR GAGTGGGTTAATGCAAATTT GGG Intergenic
No off target data available for this crispr