ID: 1112585547

View in Genome Browser
Species Human (GRCh38)
Location 13:100715842-100715864
Sequence TGCCCCCATCTCCCAGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112585542_1112585547 0 Left 1112585542 13:100715819-100715841 CCCATTCTCCCTGCTTACTCGCA No data
Right 1112585547 13:100715842-100715864 TGCCCCCATCTCCCAGGACCAGG No data
1112585541_1112585547 12 Left 1112585541 13:100715807-100715829 CCTGCTGGGGTGCCCATTCTCCC No data
Right 1112585547 13:100715842-100715864 TGCCCCCATCTCCCAGGACCAGG No data
1112585543_1112585547 -1 Left 1112585543 13:100715820-100715842 CCATTCTCCCTGCTTACTCGCAT No data
Right 1112585547 13:100715842-100715864 TGCCCCCATCTCCCAGGACCAGG No data
1112585544_1112585547 -8 Left 1112585544 13:100715827-100715849 CCCTGCTTACTCGCATGCCCCCA No data
Right 1112585547 13:100715842-100715864 TGCCCCCATCTCCCAGGACCAGG No data
1112585540_1112585547 13 Left 1112585540 13:100715806-100715828 CCCTGCTGGGGTGCCCATTCTCC No data
Right 1112585547 13:100715842-100715864 TGCCCCCATCTCCCAGGACCAGG No data
1112585545_1112585547 -9 Left 1112585545 13:100715828-100715850 CCTGCTTACTCGCATGCCCCCAT No data
Right 1112585547 13:100715842-100715864 TGCCCCCATCTCCCAGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112585547 Original CRISPR TGCCCCCATCTCCCAGGACC AGG Intergenic
No off target data available for this crispr