ID: 1112586093

View in Genome Browser
Species Human (GRCh38)
Location 13:100720285-100720307
Sequence CTGAATATACACATAGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112586091_1112586093 14 Left 1112586091 13:100720248-100720270 CCTTCAGTAGAAATAGCCAACTG No data
Right 1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG No data
1112586092_1112586093 -2 Left 1112586092 13:100720264-100720286 CCAACTGTAGTAGATGAGAGACT No data
Right 1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112586093 Original CRISPR CTGAATATACACATAGACAG TGG Intergenic
No off target data available for this crispr