ID: 1112589042

View in Genome Browser
Species Human (GRCh38)
Location 13:100747185-100747207
Sequence CCATATTTATAGAGTCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112589042_1112589049 21 Left 1112589042 13:100747185-100747207 CCTTCTAGACTCTATAAATATGG No data
Right 1112589049 13:100747229-100747251 CAGCTTTGGGGCCTCTGAGCAGG No data
1112589042_1112589044 7 Left 1112589042 13:100747185-100747207 CCTTCTAGACTCTATAAATATGG No data
Right 1112589044 13:100747215-100747237 ATAAATAAAAAGCCCAGCTTTGG No data
1112589042_1112589046 9 Left 1112589042 13:100747185-100747207 CCTTCTAGACTCTATAAATATGG No data
Right 1112589046 13:100747217-100747239 AAATAAAAAGCCCAGCTTTGGGG No data
1112589042_1112589045 8 Left 1112589042 13:100747185-100747207 CCTTCTAGACTCTATAAATATGG No data
Right 1112589045 13:100747216-100747238 TAAATAAAAAGCCCAGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112589042 Original CRISPR CCATATTTATAGAGTCTAGA AGG (reversed) Intergenic
No off target data available for this crispr