ID: 1112590081

View in Genome Browser
Species Human (GRCh38)
Location 13:100754911-100754933
Sequence GTTTTAAATGGGATTGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112590081_1112590087 27 Left 1112590081 13:100754911-100754933 CCTTCATCAATCCCATTTAAAAC No data
Right 1112590087 13:100754961-100754983 CAGATCTTTGTGACATAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112590081 Original CRISPR GTTTTAAATGGGATTGATGA AGG (reversed) Intergenic
No off target data available for this crispr