ID: 1112591610

View in Genome Browser
Species Human (GRCh38)
Location 13:100768393-100768415
Sequence TTCCTTTGAATGTGTCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112591609_1112591610 13 Left 1112591609 13:100768357-100768379 CCATCTCAAAAAAAAAAAAAAAA No data
Right 1112591610 13:100768393-100768415 TTCCTTTGAATGTGTCCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112591610 Original CRISPR TTCCTTTGAATGTGTCCTGC TGG Intergenic