ID: 1112594929

View in Genome Browser
Species Human (GRCh38)
Location 13:100799157-100799179
Sequence GGGAACAAAGCAAAGCAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112594929_1112594935 3 Left 1112594929 13:100799157-100799179 CCATATTGCTTTGCTTTGTTCCC No data
Right 1112594935 13:100799183-100799205 ACTGTGCATGTGTCAGGGCATGG No data
1112594929_1112594937 19 Left 1112594929 13:100799157-100799179 CCATATTGCTTTGCTTTGTTCCC No data
Right 1112594937 13:100799199-100799221 GGCATGGAATTTTCCATTGTGGG No data
1112594929_1112594936 18 Left 1112594929 13:100799157-100799179 CCATATTGCTTTGCTTTGTTCCC No data
Right 1112594936 13:100799198-100799220 GGGCATGGAATTTTCCATTGTGG No data
1112594929_1112594938 28 Left 1112594929 13:100799157-100799179 CCATATTGCTTTGCTTTGTTCCC No data
Right 1112594938 13:100799208-100799230 TTTTCCATTGTGGGCATGTCTGG No data
1112594929_1112594933 -2 Left 1112594929 13:100799157-100799179 CCATATTGCTTTGCTTTGTTCCC No data
Right 1112594933 13:100799178-100799200 CCCTTACTGTGCATGTGTCAGGG No data
1112594929_1112594931 -3 Left 1112594929 13:100799157-100799179 CCATATTGCTTTGCTTTGTTCCC No data
Right 1112594931 13:100799177-100799199 CCCCTTACTGTGCATGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112594929 Original CRISPR GGGAACAAAGCAAAGCAATA TGG (reversed) Intergenic