ID: 1112594930

View in Genome Browser
Species Human (GRCh38)
Location 13:100799177-100799199
Sequence CCTGACACATGCACAGTAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112594930_1112594936 -2 Left 1112594930 13:100799177-100799199 CCCCTTACTGTGCATGTGTCAGG No data
Right 1112594936 13:100799198-100799220 GGGCATGGAATTTTCCATTGTGG No data
1112594930_1112594937 -1 Left 1112594930 13:100799177-100799199 CCCCTTACTGTGCATGTGTCAGG No data
Right 1112594937 13:100799199-100799221 GGCATGGAATTTTCCATTGTGGG No data
1112594930_1112594938 8 Left 1112594930 13:100799177-100799199 CCCCTTACTGTGCATGTGTCAGG No data
Right 1112594938 13:100799208-100799230 TTTTCCATTGTGGGCATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112594930 Original CRISPR CCTGACACATGCACAGTAAG GGG (reversed) Intergenic