ID: 1112594934

View in Genome Browser
Species Human (GRCh38)
Location 13:100799179-100799201
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112594934_1112594937 -3 Left 1112594934 13:100799179-100799201 CCTTACTGTGCATGTGTCAGGGC No data
Right 1112594937 13:100799199-100799221 GGCATGGAATTTTCCATTGTGGG No data
1112594934_1112594936 -4 Left 1112594934 13:100799179-100799201 CCTTACTGTGCATGTGTCAGGGC No data
Right 1112594936 13:100799198-100799220 GGGCATGGAATTTTCCATTGTGG No data
1112594934_1112594938 6 Left 1112594934 13:100799179-100799201 CCTTACTGTGCATGTGTCAGGGC No data
Right 1112594938 13:100799208-100799230 TTTTCCATTGTGGGCATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112594934 Original CRISPR GCCCTGACACATGCACAGTA AGG (reversed) Intergenic