ID: 1112594937

View in Genome Browser
Species Human (GRCh38)
Location 13:100799199-100799221
Sequence GGCATGGAATTTTCCATTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112594929_1112594937 19 Left 1112594929 13:100799157-100799179 CCATATTGCTTTGCTTTGTTCCC No data
Right 1112594937 13:100799199-100799221 GGCATGGAATTTTCCATTGTGGG No data
1112594932_1112594937 -2 Left 1112594932 13:100799178-100799200 CCCTTACTGTGCATGTGTCAGGG No data
Right 1112594937 13:100799199-100799221 GGCATGGAATTTTCCATTGTGGG No data
1112594934_1112594937 -3 Left 1112594934 13:100799179-100799201 CCTTACTGTGCATGTGTCAGGGC No data
Right 1112594937 13:100799199-100799221 GGCATGGAATTTTCCATTGTGGG No data
1112594930_1112594937 -1 Left 1112594930 13:100799177-100799199 CCCCTTACTGTGCATGTGTCAGG No data
Right 1112594937 13:100799199-100799221 GGCATGGAATTTTCCATTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112594937 Original CRISPR GGCATGGAATTTTCCATTGT GGG Intergenic