ID: 1112599714

View in Genome Browser
Species Human (GRCh38)
Location 13:100843031-100843053
Sequence GACTTCTTTGAGTCTTCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112599712_1112599714 8 Left 1112599712 13:100843000-100843022 CCCAAGGGTAAAAATTAGCTGAT No data
Right 1112599714 13:100843031-100843053 GACTTCTTTGAGTCTTCTTGTGG No data
1112599710_1112599714 16 Left 1112599710 13:100842992-100843014 CCCTTATTCCCAAGGGTAAAAAT No data
Right 1112599714 13:100843031-100843053 GACTTCTTTGAGTCTTCTTGTGG No data
1112599713_1112599714 7 Left 1112599713 13:100843001-100843023 CCAAGGGTAAAAATTAGCTGATA No data
Right 1112599714 13:100843031-100843053 GACTTCTTTGAGTCTTCTTGTGG No data
1112599711_1112599714 15 Left 1112599711 13:100842993-100843015 CCTTATTCCCAAGGGTAAAAATT No data
Right 1112599714 13:100843031-100843053 GACTTCTTTGAGTCTTCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112599714 Original CRISPR GACTTCTTTGAGTCTTCTTG TGG Intergenic
No off target data available for this crispr