ID: 1112602430

View in Genome Browser
Species Human (GRCh38)
Location 13:100869535-100869557
Sequence CTGTGGATCTGGCACACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112602430_1112602436 0 Left 1112602430 13:100869535-100869557 CCCACTGTGTGCCAGATCCACAG No data
Right 1112602436 13:100869558-100869580 TCAGTCACCATATATCTGGAGGG No data
1112602430_1112602434 -4 Left 1112602430 13:100869535-100869557 CCCACTGTGTGCCAGATCCACAG No data
Right 1112602434 13:100869554-100869576 ACAGTCAGTCACCATATATCTGG No data
1112602430_1112602435 -1 Left 1112602430 13:100869535-100869557 CCCACTGTGTGCCAGATCCACAG No data
Right 1112602435 13:100869557-100869579 GTCAGTCACCATATATCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112602430 Original CRISPR CTGTGGATCTGGCACACAGT GGG (reversed) Intergenic
No off target data available for this crispr