ID: 1112610291

View in Genome Browser
Species Human (GRCh38)
Location 13:100948701-100948723
Sequence TCATTCCCACAGAAGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112610291_1112610297 17 Left 1112610291 13:100948701-100948723 CCCTGCTTCTTCTGTGGGAATGA No data
Right 1112610297 13:100948741-100948763 GTCTAGAAAAGAGTGCAGTTGGG No data
1112610291_1112610294 -5 Left 1112610291 13:100948701-100948723 CCCTGCTTCTTCTGTGGGAATGA No data
Right 1112610294 13:100948719-100948741 AATGATCTCGACCTTGGCAAAGG No data
1112610291_1112610296 16 Left 1112610291 13:100948701-100948723 CCCTGCTTCTTCTGTGGGAATGA No data
Right 1112610296 13:100948740-100948762 GGTCTAGAAAAGAGTGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112610291 Original CRISPR TCATTCCCACAGAAGAAGCA GGG (reversed) Intergenic
No off target data available for this crispr