ID: 1112616570

View in Genome Browser
Species Human (GRCh38)
Location 13:101013087-101013109
Sequence CAACTAGGTGGCAGGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112616561_1112616570 27 Left 1112616561 13:101013037-101013059 CCAAAACACATGCCATTTCCAAA No data
Right 1112616570 13:101013087-101013109 CAACTAGGTGGCAGGAAGCTAGG No data
1112616564_1112616570 9 Left 1112616564 13:101013055-101013077 CCAAAGCGGATTTCATATTGTCT No data
Right 1112616570 13:101013087-101013109 CAACTAGGTGGCAGGAAGCTAGG No data
1112616563_1112616570 15 Left 1112616563 13:101013049-101013071 CCATTTCCAAAGCGGATTTCATA No data
Right 1112616570 13:101013087-101013109 CAACTAGGTGGCAGGAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112616570 Original CRISPR CAACTAGGTGGCAGGAAGCT AGG Intergenic
No off target data available for this crispr