ID: 1112617877

View in Genome Browser
Species Human (GRCh38)
Location 13:101023993-101024015
Sequence CTAAGATTCTTTCAGAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112617873_1112617877 10 Left 1112617873 13:101023960-101023982 CCAATGTGACCTGAATGAACTAT No data
Right 1112617877 13:101023993-101024015 CTAAGATTCTTTCAGAGGGCAGG No data
1112617874_1112617877 1 Left 1112617874 13:101023969-101023991 CCTGAATGAACTATAATTACAAA No data
Right 1112617877 13:101023993-101024015 CTAAGATTCTTTCAGAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112617877 Original CRISPR CTAAGATTCTTTCAGAGGGC AGG Intergenic
No off target data available for this crispr