ID: 1112622719

View in Genome Browser
Species Human (GRCh38)
Location 13:101067935-101067957
Sequence CTTTCAAATAATATGGAACA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 316}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112622719_1112622722 7 Left 1112622719 13:101067935-101067957 CCATGTTCCATATTATTTGAAAG 0: 1
1: 0
2: 1
3: 28
4: 316
Right 1112622722 13:101067965-101067987 GATCATTGTAACTTAAAAGCTGG 0: 1
1: 0
2: 1
3: 7
4: 143
1112622719_1112622723 20 Left 1112622719 13:101067935-101067957 CCATGTTCCATATTATTTGAAAG 0: 1
1: 0
2: 1
3: 28
4: 316
Right 1112622723 13:101067978-101068000 TAAAAGCTGGTCCTCCTCAGTGG 0: 1
1: 0
2: 0
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112622719 Original CRISPR CTTTCAAATAATATGGAACA TGG (reversed) Exonic
901659512 1:10789655-10789677 ATTTCCAACAATATGGAAGAAGG + Intronic
905634377 1:39539600-39539622 CTTTGGATTTATATGGAACATGG - Intergenic
905661354 1:39728451-39728473 CTTTTAAATGATACGGAAAAGGG - Intronic
907966901 1:59340470-59340492 CTTTGAAAGGAAATGGAACATGG + Intronic
908778885 1:67670104-67670126 CTTTCAAATCAGATGGATGAAGG + Intergenic
908822065 1:68098794-68098816 TTTTAAAAAAATATGTAACATGG + Intronic
910164240 1:84307485-84307507 AATACAAATAATATGGGACAAGG - Intronic
910488792 1:87745653-87745675 TTTTCAAATATGATGGAACAAGG + Intergenic
912221422 1:107681591-107681613 ATTTCCAAAAATATGGAAAAAGG + Intronic
912342161 1:108927495-108927517 TGGTCAAATAATATGCAACAGGG + Intronic
913381995 1:118222306-118222328 ATTTCAAATAATTTCAAACATGG - Intergenic
914949010 1:152094472-152094494 CTTTCAAGTAATAAGAAACTTGG + Intergenic
914977353 1:152378583-152378605 CCTTTAAATAATATGGAAGCGGG - Intergenic
916367368 1:164046868-164046890 CTTTCATATATCATGGCACATGG + Intergenic
916522319 1:165575234-165575256 CTTTAACATATTAAGGAACAAGG + Intergenic
916690934 1:167189632-167189654 CTTACAAATAATATGAGAAATGG - Intergenic
917223820 1:172760545-172760567 CTTTCAAAGAATATTAATCAGGG + Intergenic
918024870 1:180733318-180733340 CTTTTAAATGATATGGAAGCGGG - Intronic
918267325 1:182856346-182856368 ACTTCAAATAATATACAACATGG - Intronic
920593731 1:207248070-207248092 CTTTCAGAGAATCTGGAATAAGG - Intergenic
922700150 1:227754509-227754531 CCTTTAAATGATATGGAAGAGGG - Intronic
923059184 1:230454948-230454970 CTTTCAAAGGAGATGGAAAAAGG - Intergenic
923352392 1:233121960-233121982 TTTTCCAATAAAATAGAACAGGG + Intronic
924671342 1:246129122-246129144 CCTTCAAAAAATATGCAAGATGG + Intronic
924771157 1:247080640-247080662 CTCTCAAAACATATGGTACAAGG - Intergenic
924840133 1:247700126-247700148 TTTCCAAATAGTAGGGAACAAGG + Intergenic
1062827792 10:585113-585135 CATTCAAATGGTAAGGAACAAGG + Intronic
1063172170 10:3518585-3518607 CTTTAAAAAAAGATGGGACAGGG - Intergenic
1063617766 10:7616524-7616546 CTTTTAATTAAAATGGAACATGG + Intronic
1065203342 10:23334886-23334908 CTTTCAAAAAAGATGGAAATAGG + Intronic
1065440070 10:25743906-25743928 TTTTAAAAGCATATGGAACATGG + Intergenic
1065793356 10:29282206-29282228 CTTTGAAATGATAAGGAAAAAGG - Intergenic
1066394752 10:35008389-35008411 CTTTCAGATAAAATGGAGAAAGG + Intergenic
1067515370 10:46936269-46936291 ATTTCAAATAATTAGGAAGAGGG - Intronic
1067646882 10:48115541-48115563 ATTTCAAATAATTAGGAAGAGGG + Intergenic
1068196816 10:53727671-53727693 CTTTAAAATGATATGTAAAAGGG + Intergenic
1068690460 10:59908476-59908498 CTTTAAGATAATATGGAATAGGG - Intergenic
1068790498 10:61025525-61025547 CCTTCAAATAATATGGCATTGGG + Intergenic
1069192140 10:65505091-65505113 CTTCAAGATAATGTGGAACATGG + Intergenic
1072985797 10:100139104-100139126 CTGTCAAAAAATATGGCTCATGG + Intergenic
1073971675 10:109051060-109051082 CTTTGAAATATTATGGAACCTGG - Intergenic
1074326147 10:112453340-112453362 CTTCCAAATAGTATGGAAAAGGG - Intronic
1075436408 10:122446766-122446788 CTTTCAACTGATATTGACCATGG - Intergenic
1075476776 10:122742512-122742534 CTTTCAAAGAATCAGGAAAATGG + Intergenic
1076934967 10:133561852-133561874 GTTCCAAATTATGTGGAACAAGG + Intronic
1078420995 11:11212805-11212827 CTTCAAAATAGTATGAAACAAGG - Intergenic
1081801474 11:45862600-45862622 CTTTAGAATAACATAGAACAAGG - Intronic
1081952284 11:47054591-47054613 CCTTCAAATAAGATGGGGCATGG - Intronic
1082879795 11:58026379-58026401 CTTGTTAAAAATATGGAACATGG + Intronic
1084257311 11:67951980-67952002 GTTTCAAATATCATGGAGCAAGG - Intergenic
1084815467 11:71643286-71643308 GTTTCAAATATCATGGAGCAAGG + Intergenic
1086328461 11:85728776-85728798 CTTTCAAATAAGACTAAACAAGG + Intronic
1087047616 11:93856173-93856195 ATTTCAAATTATGGGGAACAAGG - Intergenic
1087122561 11:94590006-94590028 CTTTCAAAAAGAATTGAACATGG - Intronic
1087145926 11:94811593-94811615 GTTTCAAATTATGGGGAACAAGG - Intronic
1087265473 11:96055986-96056008 CTGACAAATAATATAAAACAAGG - Intronic
1087283969 11:96244145-96244167 ATTTCAAAACATCTGGAACACGG - Intronic
1087517752 11:99186051-99186073 CTTTAAAAGAATATGTAACATGG - Intronic
1087586941 11:100133717-100133739 CTTTCAGATTATATGGTAAAGGG - Intronic
1087788858 11:102385629-102385651 CCTTCAAATGATATGGAAGTGGG - Intergenic
1088230146 11:107665660-107665682 CTTTAAAATAATACAAAACAGGG + Exonic
1088983880 11:114888765-114888787 CTTTCAAATAATTTTGTACAAGG + Intergenic
1090135972 11:124199533-124199555 CCTTTAAATGATATGGAACGGGG - Intergenic
1090887819 11:130894725-130894747 CTTTCAAATAAAAAGCAACCTGG - Intronic
1091111436 11:132972594-132972616 CTGTCAAATAATATGGCATTTGG + Intronic
1093316125 12:17652461-17652483 CTTTCAAATAATATTGTTCTGGG + Intergenic
1096424143 12:51486811-51486833 TTTTCAGACAATATGGAAGAAGG - Intronic
1096742514 12:53704282-53704304 CTTTCGAATTATAAGAAACATGG - Intergenic
1096936977 12:55291676-55291698 CTTGGAAATGATATGGAATATGG - Intergenic
1098769343 12:74534194-74534216 TATTCAAATAATCTGGATCATGG - Intergenic
1098915338 12:76251499-76251521 ATTACAAATAACATGGAAGACGG + Intergenic
1099256434 12:80319623-80319645 CTTTGAAATAATATTGAATTTGG + Intronic
1099769823 12:87036901-87036923 CTATAAAATAATAGGGAACAGGG + Intergenic
1100083478 12:90879471-90879493 CTTCCAGATAATGGGGAACATGG - Intergenic
1100162710 12:91879219-91879241 CTTTGAAATCAGATGGAACTGGG + Intergenic
1100206509 12:92355493-92355515 AATTCAAATAATATGGTAGATGG + Intergenic
1101298385 12:103451142-103451164 ATTTAAAATAAAATGGAACCTGG - Intronic
1104150516 12:126077885-126077907 CTTACAAATACTAAGGAAAATGG + Intergenic
1105880648 13:24603318-24603340 TTTTCAAAAAATATGCAAGATGG - Intergenic
1106190403 13:27447838-27447860 CTTAGAAATAAAAAGGAACAAGG - Intronic
1107111187 13:36699892-36699914 CTGTGAAATAATAAGCAACAAGG + Intergenic
1107148716 13:37087942-37087964 TTTTCAAATGATAGGGAAGAGGG + Intergenic
1109172965 13:59118384-59118406 CCTTTAAACAATATGGAAGAGGG - Intergenic
1110000423 13:70191569-70191591 CTCTCAAATATTATGGAGGAAGG - Intergenic
1110909967 13:80946839-80946861 GTTTAAAATAATATGATACAGGG - Intergenic
1112622719 13:101067935-101067957 CTTTCAAATAATATGGAACATGG - Exonic
1113014072 13:105807432-105807454 CTTTAAAATAACAGAGAACATGG + Intergenic
1114901824 14:27070805-27070827 ATTTAAAATAATATGGGAGATGG + Intergenic
1115314359 14:32010431-32010453 CTTACAAATAATATTTAATAGGG + Intronic
1115401440 14:32965631-32965653 CTCTCTAAAAATCTGGAACAAGG + Intronic
1115543113 14:34441389-34441411 CTCTCAAATATTCTGTAACAGGG + Intronic
1117363466 14:55001130-55001152 ATTAGAAATAATATAGAACAGGG - Intronic
1118147939 14:63160805-63160827 CTACCAAATAGTATAGAACAAGG + Intergenic
1118247293 14:64123616-64123638 CTGACAAATAAAATGAAACAGGG - Intronic
1119109558 14:71958778-71958800 CTTACAAATCATCTGGAAAATGG + Intronic
1120482946 14:85075341-85075363 CATGAAAATAAAATGGAACAGGG + Intergenic
1121995576 14:98600005-98600027 ATTTAAAATAATATGCAACTTGG + Intergenic
1122472649 14:101981953-101981975 CGTTAAAATAATATAGAACAGGG + Intronic
1126228219 15:46296072-46296094 CCTTTAAATAATAAGGAAGAGGG + Intergenic
1126402784 15:48291466-48291488 CTTTCAAATAATAAGAAATGTGG + Intronic
1126407843 15:48340052-48340074 CTTTCAAATAATGAGGAGTATGG + Intronic
1131154432 15:90066019-90066041 CTTTCAAATCAGATCGGACATGG + Intronic
1131995995 15:98133649-98133671 CTTTGAAATAATTTGAGACATGG + Intergenic
1132157773 15:99508578-99508600 ATTTCAAATAATATTGAAGAAGG - Intergenic
1132210854 15:100021103-100021125 CCTTCAGATACTAGGGAACAGGG + Intronic
1134343202 16:13364462-13364484 CTTTCAATGAATATGCAAGATGG + Intergenic
1137992862 16:53177719-53177741 CTTTCAAATATTTAGGCACACGG - Intronic
1139786125 16:69393660-69393682 CTTGCAAATGATATGAAGCAGGG + Intronic
1140615687 16:76660371-76660393 CTTTCAAAATATATGGATTAGGG - Intergenic
1140960130 16:79903775-79903797 TTTTCAAATAATTTGTAACTAGG + Intergenic
1141617523 16:85218618-85218640 TTTCCAAATCATATGGAAAATGG + Intergenic
1144164035 17:12590262-12590284 CTTTCAAATTATATGAAAAATGG - Intergenic
1150374806 17:64672139-64672161 ATGTCAAATAATATTTAACATGG - Intergenic
1150777978 17:68097119-68097141 ATGTCAAATAATATTTAACATGG + Intergenic
1150910017 17:69378138-69378160 CTCTTATATAATTTGGAACAAGG + Intergenic
1151381745 17:73730501-73730523 CTTGCAAATGCTATGGGACATGG - Intergenic
1155575128 18:27236911-27236933 TTTCCTAATAATATGGATCAAGG + Intergenic
1156451703 18:37270173-37270195 TTTTCAAATAGTCTGGCACACGG - Intronic
1156779738 18:40837167-40837189 CTCTCATAAAAAATGGAACAGGG - Intergenic
1157858999 18:51124391-51124413 CCTTTAAATGATATGGAAAAGGG - Intergenic
1158284970 18:55870196-55870218 CTTTCAAAAACTATGAACCAAGG - Intergenic
1158813524 18:61066397-61066419 CTTTACAATTATATGGATCAGGG - Intergenic
1159124169 18:64203732-64203754 CAGTCAAATAACTTGGAACAAGG + Intergenic
1159276393 18:66227133-66227155 GTTTGAAATAATATGGCATATGG + Intergenic
1159306592 18:66651362-66651384 CTTTGACATAATATGAACCATGG + Intergenic
1159493217 18:69165641-69165663 CTTTTTAATAATATGAAACATGG + Intergenic
1166667991 19:44692902-44692924 CTTTCAAATAATACAGGAGAGGG + Intergenic
1167673828 19:50872485-50872507 TTTTGAAATAATAGGGAACTTGG + Intronic
925039897 2:724127-724149 TTTACAAATAACAAGGAACAAGG - Intergenic
925446686 2:3932167-3932189 ATTGCAAAAAATATGGAACCAGG - Intergenic
926434987 2:12828213-12828235 CCTTTAAATAATATGGAAGTGGG - Intergenic
926964917 2:18399298-18399320 CTTTCACAGAAAATGGAATAGGG + Intergenic
927006069 2:18850499-18850521 CTTTCAAATAAAAAGGCACTGGG - Intergenic
927060921 2:19418694-19418716 CTGAAAAATAATATGGAATATGG + Intergenic
927204676 2:20599559-20599581 CTTGAAAATAAAATGGAACATGG - Intronic
929230418 2:39554432-39554454 CTTTCACAAATTATTGAACATGG - Intergenic
931020193 2:58035700-58035722 CTTCCAAATTATATAGAAGAAGG - Intronic
931112692 2:59129179-59129201 CTTTCAAATATTAGAGGACAGGG + Intergenic
933035786 2:77395786-77395808 GTTTTAAATAATTTGAAACAAGG - Intronic
934943251 2:98517775-98517797 CTTGCCAATAGTATAGAACATGG - Intronic
935665006 2:105503557-105503579 CTCTCAAATCATAAGGACCAGGG + Intergenic
935670263 2:105549712-105549734 CTCTAAAATTATATGGAACTGGG - Intergenic
936781092 2:116033688-116033710 CTTCCTAATAATGTGTAACAAGG - Intergenic
937483867 2:122293349-122293371 CTTTGAAATAAGATGCAACAAGG - Intergenic
937635106 2:124146618-124146640 CTTCCAAAGAATATTTAACAAGG + Intronic
937831746 2:126431833-126431855 CTTTCTCATAATATACAACAAGG + Intergenic
940148618 2:150574821-150574843 CTGGTAAATAATGTGGAACATGG - Intergenic
940317989 2:152345181-152345203 CTTTCTAATAATAGGGAACAGGG + Intronic
941117673 2:161490037-161490059 CATTCAAATGATATGGAAAGTGG + Intronic
941134173 2:161693029-161693051 CTTTAGAATAAAAGGGAACATGG - Intronic
941755473 2:169181238-169181260 CTTTTAAATCATATGGATCAGGG - Intronic
943016759 2:182521215-182521237 CTTTAAAAAAATATCAAACAGGG + Intronic
943845560 2:192641697-192641719 CATTAAAATAATAGGTAACAAGG - Intergenic
944037794 2:195317213-195317235 CTTTCAAGTTCTTTGGAACAAGG - Intergenic
944039974 2:195342299-195342321 ATCTGAAATAATCTGGAACAAGG - Intergenic
945987268 2:216364950-216364972 CTTTTAAATATTTTGGAGCATGG + Intronic
947168753 2:227289835-227289857 CCTTCAAATAAGAGGGAACTAGG - Intronic
947233754 2:227918891-227918913 CTTTCAAAAAATAAAGAGCAGGG + Intronic
1169603704 20:7291342-7291364 CTGTCACATAATATGTGACAAGG - Intergenic
1169777413 20:9271200-9271222 CTTTCAAATAAGATGTAAAATGG - Intronic
1170044913 20:12074822-12074844 CTTACAAATAAGATGAAAAAGGG + Intergenic
1170662163 20:18352588-18352610 CTTTCAAAGACCATGGAAAAGGG - Intergenic
1171086486 20:22242777-22242799 CTTTCAAAGAACATAGAGCACGG + Intergenic
1172263558 20:33590833-33590855 TTTTCAAATATTAAGGTACATGG + Intronic
1173182639 20:40816307-40816329 CTTGCACAGAACATGGAACACGG - Intergenic
1173698567 20:45045504-45045526 CTTTCAAATAACATGTGATAGGG + Intronic
1174126749 20:48312004-48312026 CCTTTAAATAATATGGAAGTGGG - Intergenic
1176524994 21:7859386-7859408 CTTACAAATGAGATGGAGCAGGG - Intergenic
1176816898 21:13611127-13611149 CTTTCAAATAAAATCCAATATGG + Intronic
1177804563 21:25861456-25861478 CTTTGAAATAATCTGGAATTAGG + Intergenic
1178186510 21:30228103-30228125 CTCTCAAATATTATGTATCAGGG + Intergenic
1178659014 21:34489399-34489421 CTTACAAATGAGATGGAGCAGGG - Intergenic
1179944538 21:44662934-44662956 ATGTCAAAATATATGGAACATGG + Intronic
1181948042 22:26533606-26533628 TTTTAAAATAAAATGAAACAAGG + Intronic
1183438157 22:37807405-37807427 CTTTAAAATAAATTGGAAAAGGG + Exonic
1185127172 22:49017698-49017720 CCTTCAAATAATATGGAAGGGGG - Intergenic
950750246 3:15122739-15122761 GTTTCAAATATCATGGAGCAAGG + Intergenic
951621718 3:24609091-24609113 CTTCCAAAAGATATGGAAAATGG + Intergenic
952325542 3:32317362-32317384 ATTTCAAGTAAGATGGACCAAGG - Intronic
952580171 3:34824141-34824163 CTTTTAAATGATATGGAAGGGGG + Intergenic
955931629 3:64063389-64063411 GTTTTAAAAAATATGCAACATGG - Intergenic
956002134 3:64740875-64740897 CTTTAAAAAAAAATGAAACAAGG + Intergenic
956311629 3:67887255-67887277 CTTTTGAATAATAAGGACCAAGG - Intergenic
957072247 3:75576461-75576483 GTTTCAAATATCATGGAGCAAGG - Intergenic
957490060 3:80913052-80913074 CTTTCAAAGATTAGGTAACATGG - Intergenic
957591603 3:82206194-82206216 GTTTGATATTATATGGAACATGG - Intergenic
958583523 3:96056570-96056592 CTTTCAAATAAGATGAAAGGAGG - Intergenic
959285869 3:104410093-104410115 CCTTCAAATACTGTGGATCAGGG + Intergenic
960285610 3:115825085-115825107 CATTCAAATAACATGAAACGAGG + Intronic
961252144 3:125516347-125516369 ATTTAAAATAATTTGGAAAATGG - Intronic
961281827 3:125770314-125770336 CTTTCAAATGCTGTGGGACAAGG + Intergenic
961908221 3:130284863-130284885 TTCTCACATAATTTGGAACAGGG - Intergenic
962489943 3:135883401-135883423 CTCCCAAATAATTTGGAAAAAGG - Intergenic
962726179 3:138229601-138229623 GTTTCCAGTAATAGGGAACAAGG - Intronic
963362313 3:144289990-144290012 CATTCAAATAAAATAGAAGAGGG + Intergenic
963406022 3:144865134-144865156 GTTTCAAAGAATATGGAAATAGG + Intergenic
964304007 3:155321433-155321455 CTTATACAAAATATGGAACAAGG - Intergenic
965793582 3:172414512-172414534 CTTCTAAAGAATATGCAACAGGG + Intergenic
966041108 3:175489403-175489425 CTTTCTAATATTCTGGAATATGG - Intronic
966217600 3:177519471-177519493 CCTTTAAATGATATGGAAGAGGG + Intergenic
968253318 3:197243544-197243566 CTTTCAACTAATAGGGATGAAGG + Intronic
968344294 3:197987747-197987769 CTTTTAAAAAAAATGTAACATGG - Intronic
969068252 4:4508090-4508112 CTATTAAATAAAATGGATCATGG + Intronic
969952017 4:10846822-10846844 CTATTTAATAAAATGGAACACGG + Intergenic
970114986 4:12684869-12684891 CTGGCAAGCAATATGGAACAAGG + Intergenic
970178632 4:13364437-13364459 ATTTCAAATAACAGGAAACAGGG - Intronic
970824296 4:20253665-20253687 GCACCAAATAATATGGAACAAGG - Exonic
971205964 4:24569194-24569216 CTTCGAAATAACATGGGACAGGG + Intronic
974194796 4:58559359-58559381 CTTGCAAATAATTTGGAATTTGG - Intergenic
974265906 4:59585492-59585514 ATTACAAATAATAGGAAACAGGG + Intergenic
974369426 4:60995769-60995791 CTTTAAAAAAAAATAGAACAAGG - Intergenic
974882521 4:67777236-67777258 CTTCAAAATAATTTGGAACTGGG + Intergenic
974900284 4:67988252-67988274 TTTTAAAATAACATGGACCAGGG + Intergenic
975609526 4:76190318-76190340 ATTTTAAATAAGATGTAACAGGG + Intronic
975681576 4:76882578-76882600 CTTTCAATTTATAAGGAATAAGG + Intergenic
976542786 4:86297169-86297191 CATTCAATTAATATGAAAGATGG - Intronic
977030266 4:91874611-91874633 ATTTAACATAATATGTAACATGG + Intergenic
978015297 4:103737112-103737134 CTTACCAATCATATTGAACAAGG - Intergenic
978525530 4:109661405-109661427 CTTTTAATTAATTTGGAACTTGG - Intronic
980222592 4:129938810-129938832 CAATCAAAGAATATGGATCAAGG - Intergenic
981165090 4:141548354-141548376 CTGTAAAATAAAATAGAACAAGG + Intergenic
981882750 4:149634712-149634734 CTATCAAATATAATGAAACACGG + Intergenic
982878774 4:160684350-160684372 ACTTCAAATAATATGTAAAATGG + Intergenic
982895010 4:160909207-160909229 CTTTCAATTAGTATTGTACAGGG + Intergenic
982900219 4:160989489-160989511 CTTTAAAATTACATGGAAGAGGG - Intergenic
983137055 4:164097831-164097853 CTTCCAAATAAAAGGGAATATGG - Intronic
983159379 4:164392734-164392756 ATTGCAAAGAATATGGAAAAGGG - Intergenic
983445469 4:167845072-167845094 CTTTCAAATAAGATCAAACAGGG + Intergenic
984381529 4:178998665-178998687 CTGTCAAATAATATGCAATGAGG + Intergenic
984468607 4:180134603-180134625 TTTTCAGATAATAAGGTACATGG - Intergenic
986470595 5:8070433-8070455 ATTTCACATAATAGGAAACAAGG - Intergenic
986753044 5:10807501-10807523 CTTTCAAATTAAAGGGAACTGGG - Intergenic
986766336 5:10931566-10931588 TTTTCAGATGATAGGGAACATGG - Intergenic
986926170 5:12755116-12755138 CCTTCAAATAAAATAGAACAAGG + Intergenic
988162272 5:27534148-27534170 CTTTCAAATAAAATGGAGCTTGG + Intergenic
988635109 5:32975030-32975052 CTTTCAAATAATACTTCACAGGG + Intergenic
989811963 5:45688271-45688293 CTTTTACATAATAAGAAACAAGG - Intronic
989829821 5:45901859-45901881 GTTTCAAATAAAAAGGAACATGG - Intergenic
990549169 5:56855295-56855317 CTTTCAAAAAGTATGAAAAAAGG - Intronic
991218280 5:64181750-64181772 CTCTGAAATACTATGGAACAAGG + Intronic
991942868 5:71870570-71870592 CTTTAAAATAATTTGGAATTTGG - Intergenic
992107474 5:73461914-73461936 CATTCAAATAATATAGATTACGG + Intergenic
993100500 5:83532831-83532853 ATTTCAAAAAATATGCAAAATGG - Intronic
993239503 5:85362931-85362953 TTTTCAAATAATATATAAAAAGG - Intergenic
993445468 5:88006643-88006665 CTTTCAAATAAATTGTAAGAAGG - Intergenic
993565903 5:89475074-89475096 CTTTCATATAGTAAGGAAAATGG - Intergenic
993605206 5:89981544-89981566 CTTTTAAAAAATATGGAAAGAGG + Intergenic
994286505 5:97975071-97975093 CTTTCAAATATGAAGGAAAAAGG - Intergenic
994465221 5:100119138-100119160 CCTAGACATAATATGGAACATGG + Intergenic
994975556 5:106800214-106800236 CTTTCAAATAAAATGGACAAGGG - Intergenic
996619847 5:125487267-125487289 GTTTCTAATTATATGGAACCTGG - Intergenic
997063291 5:130532725-130532747 CATTCAAATAATATGAAATGTGG + Intergenic
997502848 5:134391481-134391503 CCTTCAAATAGTATAGAAAATGG + Exonic
997773694 5:136578485-136578507 CTTTCAAATAATTAAGGACAAGG + Intergenic
998641573 5:144017589-144017611 CTTTCAAATAAAATCTGACATGG - Intergenic
998707475 5:144779771-144779793 CTTACAAAGAATAAGCAACATGG + Intergenic
999106997 5:149081874-149081896 CTTTCAACTAATTTTTAACAAGG + Intergenic
999811527 5:155131838-155131860 CTTTAAAAAAATAAGGAAAATGG + Intergenic
1001868027 5:175122612-175122634 CTTTCAAAGAATCCAGAACATGG + Intergenic
1001942818 5:175752720-175752742 CTTCAAAATAATATGGAAGGGGG + Intergenic
1002884168 6:1279142-1279164 GTTTCATTAAATATGGAACAGGG - Intergenic
1003804585 6:9712900-9712922 CTTTAAAAAAAAATGGAAGAAGG + Intronic
1004297635 6:14428313-14428335 ATTTCTAATAAAATGGAAGATGG + Intergenic
1004537041 6:16513211-16513233 CTTTCAAACAATATACAACAGGG + Intronic
1004998091 6:21213696-21213718 TTTTCAGATAATATAGTACACGG - Intronic
1007560424 6:42803506-42803528 CTTTCCAAGAATATGCACCAAGG - Intronic
1007797736 6:44363967-44363989 CTTTAAAAAAATATGAAATATGG - Intronic
1008180732 6:48325335-48325357 GTTTCAAATTCTATGGAAAAGGG - Intergenic
1009340536 6:62548823-62548845 TTTTCAGATGATATGGAATAAGG - Intergenic
1010084736 6:71904051-71904073 CTTTCAAATAATAATAAACAAGG - Intronic
1010142209 6:72623896-72623918 TTTTGAAATAACATGGAAGAAGG + Intronic
1011125383 6:84001930-84001952 TTTTAAAATAATGTGGAAAAGGG - Intergenic
1014247333 6:119082149-119082171 CCTTCAAATAATACAGAACGGGG - Intronic
1014927009 6:127284475-127284497 CTTTAAATAAATATGGAACTTGG + Intronic
1015868395 6:137751224-137751246 CTTTCAACTAATGTGAAGCAAGG - Intergenic
1020459244 7:8409929-8409951 CTTTCCAATAATATAAAAAATGG - Intergenic
1020473538 7:8567240-8567262 ATTTAAAATAAAATGAAACAGGG - Intronic
1020892881 7:13901594-13901616 CTTTCATATAGTATTGAGCAGGG - Intronic
1021772033 7:24013868-24013890 CTTCCAAAAAAAATGGAAGAGGG + Intergenic
1024012916 7:45285558-45285580 CTTTCATTTAAAATAGAACATGG + Intergenic
1024239404 7:47422660-47422682 CATTAAAAGAATATGGAAAAAGG - Intronic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1024930133 7:54660511-54660533 CTGTCAAATAGTCTGGATCAAGG + Intergenic
1025243838 7:57300846-57300868 CTTTCAAATAATATAATGCAAGG + Intergenic
1025820110 7:64955156-64955178 CGTTTAAATAATATGGAAGTGGG + Intergenic
1027008968 7:74725299-74725321 GTTTTAAGTCATATGGAACATGG - Intronic
1027969196 7:85056774-85056796 CTTTCAACTAATATATACCACGG - Intronic
1028279309 7:88901189-88901211 CTTTGAAAGAATATTGAAAAGGG - Intronic
1029333691 7:99881811-99881833 CTTTCCTATGATATGGCACATGG - Intronic
1030038830 7:105431805-105431827 CTCTAAAATAATATAGAACTTGG - Intergenic
1030096113 7:105901539-105901561 TTTCCAAATAAGATGGAATATGG + Intronic
1032744024 7:134767805-134767827 CTTTCATATAATCAGAAACACGG - Intronic
1033017560 7:137687278-137687300 CTTTCAAATAAAAAGGAAGGTGG - Intronic
1033483877 7:141768898-141768920 CCTTCAAAGAATATACAACATGG - Intronic
1034099346 7:148437723-148437745 CTTTTAAATGATATGGAAGTGGG - Intergenic
1035425677 7:158771119-158771141 CTTTTAAATAAAATGAATCAGGG + Intronic
1035954609 8:4062310-4062332 CTTCTAAATAATATGGTCCAGGG + Intronic
1036258853 8:7225190-7225212 GTTTCAAATAATGTGGGGCAAGG - Intergenic
1036307768 8:7614320-7614342 GTTTCAAATAATGTGGGGCAAGG + Intergenic
1036310908 8:7683786-7683808 GTTTCAAATAATGTGGGGCAAGG - Intergenic
1036358622 8:8062321-8062343 GTTTCAAATAATGTGGGGCAAGG + Intergenic
1036892338 8:12604631-12604653 GTTTCAAATAATGTGGGGCAAGG - Intergenic
1036899882 8:12662607-12662629 GTTTCAAATAATGTGGGGCAAGG - Intergenic
1037052772 8:14397489-14397511 CTTTCACATAAAATGTAACTTGG - Intronic
1037198049 8:16215935-16215957 CTTTTAAAAAATATTTAACAGGG + Intronic
1038127832 8:24693905-24693927 TTTTCAAATAGTATGGGAAAAGG - Intergenic
1039678268 8:39697113-39697135 CTTTCTAATAATATTGTAAATGG + Intronic
1042244504 8:66697142-66697164 CTTTCAAACAGTATGGTACCAGG + Intronic
1042584993 8:70326540-70326562 CTTTCATAAAATATAAAACAAGG + Intronic
1043151252 8:76718999-76719021 CTTTCAATGAATGTAGAACATGG + Intronic
1043735326 8:83734057-83734079 CTTTTACATAATATGCAAGAAGG + Intergenic
1043830549 8:84983428-84983450 TTCTCAAATAATATGAAATACGG - Intergenic
1044155753 8:88844389-88844411 CTTTCTAATAAAAAGAAACATGG + Intergenic
1044181744 8:89204525-89204547 CTTTCAAAGGATATAGAAAATGG - Intergenic
1044187233 8:89268678-89268700 ACTACAAATAATATGGAATAAGG + Intergenic
1046020715 8:108661490-108661512 CTTTCAAAGAAAATGGAAATTGG + Intronic
1046543257 8:115613906-115613928 CTTTCAATTAAAATTAAACAAGG + Intronic
1048824742 8:138413052-138413074 CTTTCAAATTAAAAGGAATACGG - Intronic
1048857292 8:138695778-138695800 CCTGCAATTCATATGGAACAAGG + Intronic
1049449353 8:142651585-142651607 GTTTCAAATTATGGGGAACAAGG - Intergenic
1050342555 9:4654960-4654982 CCTTTAAATGATATGGACCAGGG - Intronic
1050857228 9:10374699-10374721 CTTTCCAATCATAGAGAACATGG - Intronic
1050917270 9:11152923-11152945 CTTCCAAAAAAAATGGAAAAAGG + Intergenic
1051597271 9:18837849-18837871 CTTTCCAATAATAAGGTAGAGGG - Intronic
1051857789 9:21589177-21589199 CTTTCAAATATTTTGGGAAACGG + Intergenic
1054874399 9:70080126-70080148 CATTCAAATAATACAGAATATGG + Intronic
1055024184 9:71701935-71701957 TGTTTAAATAATATGTAACAAGG + Intronic
1056041458 9:82671844-82671866 CCTTCAGATAATAAGCAACATGG + Intergenic
1056056380 9:82828293-82828315 ATTTTAAATAATTTTGAACAAGG - Intergenic
1056120339 9:83481542-83481564 ATTTTAAAAAATATGGAAGAGGG + Intronic
1059717602 9:116928099-116928121 TTTTCACATAATTTGGAAGAGGG - Intronic
1061000785 9:127901193-127901215 CTGTGGAATAATATGTAACAGGG + Intronic
1203530465 Un_GL000213v1:138367-138389 CTTTCAAATAAAATCCAATATGG - Intergenic
1185678181 X:1865773-1865795 CTTGCAAAAAATATGGGGCAGGG - Intergenic
1186707705 X:12159571-12159593 CTATAAAAGAATATAGAACATGG - Intronic
1188333365 X:28898174-28898196 CTTTCAAATCATATGTATAAGGG - Intronic
1192966805 X:76185438-76185460 CTTTCAAATAATTCAGAACAAGG - Intergenic
1193534556 X:82697038-82697060 ATTTTTAAAAATATGGAACACGG - Intergenic
1193702573 X:84780589-84780611 CTTTTAAATGATATGGAAGTGGG - Intergenic
1194031845 X:88826718-88826740 CTTTCAAATAAAATTCTACATGG + Intergenic
1194159327 X:90431636-90431658 GTTTCAAATTATGGGGAACAAGG - Intergenic
1194182234 X:90726542-90726564 CTTCCAAAAAATAAAGAACAGGG + Intergenic
1194807895 X:98352194-98352216 CTATTAAATATTATGGAACATGG + Intergenic
1197019756 X:121672585-121672607 CTTTCTTATTATATGGAACATGG + Intergenic
1200505626 Y:4008605-4008627 GTTTCAAATTATGGGGAACAAGG - Intergenic
1201389540 Y:13482407-13482429 CATTCAAATAATGTAGAATATGG + Intergenic