ID: 1112623163

View in Genome Browser
Species Human (GRCh38)
Location 13:101073098-101073120
Sequence GGATGATGCTTGGGGAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112623157_1112623163 -1 Left 1112623157 13:101073076-101073098 CCTGTTTAAACTGAGACCAGAAG 0: 1
1: 0
2: 1
3: 7
4: 153
Right 1112623163 13:101073098-101073120 GGATGATGCTTGGGGAAGACAGG 0: 1
1: 0
2: 0
3: 11
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112623163 Original CRISPR GGATGATGCTTGGGGAAGAC AGG Intronic
900602588 1:3509472-3509494 GGATGAGGCTGGGGGCAGAGGGG - Intronic
903256586 1:22106321-22106343 GGATGATGCTTGGAGAAAATTGG + Intergenic
904419854 1:30384654-30384676 GGATGCTGCCTGGGGTGGACTGG + Intergenic
905534729 1:38712330-38712352 GAATGATGGTTGTGGTAGACAGG - Intergenic
906284890 1:44580821-44580843 GGAGGATGCTTTGGGAAGGAGGG - Intronic
906566216 1:46803055-46803077 GGATGAGGCTGGAGGTAGACGGG + Intronic
911063172 1:93764882-93764904 GGATGTGGCCTGGGGTAGACCGG - Intronic
911119654 1:94282734-94282756 GGATGATGAGAGGGGAAGCCTGG + Intergenic
911307606 1:96250139-96250161 AGATTATGTCTGGGGAAGACAGG + Intergenic
918217791 1:182408050-182408072 GGATGGTGCATTGGGGAGACAGG - Intergenic
920280217 1:204837612-204837634 GAAGGATGTTTGGGGCAGACGGG + Intronic
921250885 1:213297005-213297027 GGATGGTGCATCGGGAAGAAAGG - Intergenic
922602223 1:226865075-226865097 GGAAGATGCTTGGGGAAAGAAGG + Intergenic
924251160 1:242134347-242134369 GGAAGCTGACTGGGGAAGACTGG + Intronic
1063708168 10:8451427-8451449 CGATGGTGCTTGAGGAAGAGTGG + Intergenic
1067902129 10:50253106-50253128 GGAAGATGGCTGGGGAAGTCTGG - Intergenic
1067927356 10:50523242-50523264 AAATGATGATTGAGGAAGACAGG + Intronic
1069515948 10:69077318-69077340 GGATGTACCTTGGGGAAGGCTGG + Intergenic
1070750214 10:78959677-78959699 GGAGGGTGCGTGAGGAAGACAGG + Intergenic
1071524305 10:86349242-86349264 GGAGGCTGCTGGGGGAAGAGGGG + Intronic
1074612641 10:115036828-115036850 GGATGTTGGTTCGGGAAGAGGGG + Intergenic
1074631682 10:115262142-115262164 GGAATATGCTTTGGGAAGATAGG + Intronic
1074884995 10:117686292-117686314 TGATGGTCCTTGGGGAACACTGG + Intergenic
1076222732 10:128747485-128747507 AGATGGTGCTTTGGGAAAACAGG + Intergenic
1081489744 11:43558185-43558207 GGAAGGAGCTTGGGGAAGAGAGG + Intronic
1085279806 11:75322549-75322571 GGAGGGTTCTAGGGGAAGACAGG + Intronic
1086975082 11:93122126-93122148 GGAAGATGAATGGGGAAGAGAGG - Intergenic
1088469633 11:110178548-110178570 TGATCATGCTGTGGGAAGACGGG + Intronic
1089378093 11:118009161-118009183 GGATGGGGCCTGGGGAGGACTGG + Intergenic
1091013871 11:132031576-132031598 GAATGATGAGTAGGGAAGACTGG + Intronic
1091096098 11:132823496-132823518 TGATGATGCTGGGGAAAGACAGG - Intronic
1091546151 12:1502596-1502618 GGAGGAATCTTTGGGAAGACTGG - Intergenic
1093229882 12:16531030-16531052 TGATGGTGCTTGGGAAAGAGAGG + Intronic
1096109579 12:49020883-49020905 TGATGAAGATTGGGGATGACTGG - Exonic
1099519942 12:83648368-83648390 AGTTGATGCTTGGGCAACACAGG - Intergenic
1101924007 12:108956348-108956370 GCATCATGATTGGGGAAGACTGG - Intronic
1102583088 12:113904252-113904274 GGGTGATGCTTGCTGAAGATAGG + Intronic
1102742875 12:115223560-115223582 GGAGGAAGCTGGGGGAAGCCAGG + Intergenic
1102813331 12:115842694-115842716 GCATGATGCTGGGGGCACACGGG - Intergenic
1104253094 12:127115133-127115155 GGATGATCTTTGTGGAAGAAAGG - Intergenic
1104404552 12:128506689-128506711 GGATGGTGCATGGGGAGGCCGGG - Intronic
1104912961 12:132248559-132248581 GGATGAAGCATGGGGGAGGCGGG - Intronic
1104984261 12:132587714-132587736 GGATGATGCCTGGGGAGGGATGG - Intergenic
1106071830 13:26419667-26419689 GGATGGTGGTTGCTGAAGACTGG - Intergenic
1108263146 13:48678417-48678439 GAATGATGATTGAGAAAGACTGG - Intronic
1108483914 13:50905836-50905858 GAATGATGCTTGTGGAGAACAGG + Intergenic
1112354194 13:98660690-98660712 GGCTGTTGCCTGGGGAAGCCAGG + Intergenic
1112623163 13:101073098-101073120 GGATGATGCTTGGGGAAGACAGG + Intronic
1113313948 13:109158877-109158899 GGAAGAGGCCTGGGGAAGATAGG + Intronic
1116725858 14:48560997-48561019 AGATGATGCTGTGGGAAGTCAGG + Intergenic
1118839976 14:69502632-69502654 GGATGATGATGGGGGAAGGAGGG + Intronic
1119187407 14:72652451-72652473 GGATGGTGCTGGGGGGAGGCGGG + Intronic
1119599070 14:75962563-75962585 GGATGAGGTTTGGGGATGAAGGG - Intronic
1119762584 14:77162087-77162109 GGAAGAGGCTTGGCAAAGACCGG - Intronic
1120323634 14:82997764-82997786 GGGTGATGGTTGCTGAAGACTGG + Intergenic
1123168333 14:106347729-106347751 CCTTGATACTTGGGGAAGACTGG + Intergenic
1125608847 15:40957567-40957589 GGATGATGTATGGGGCAGGCTGG + Intergenic
1125904117 15:43374715-43374737 GAATAATGCTTGGTGAACACGGG - Intronic
1126109554 15:45167463-45167485 GTAAGAGGTTTGGGGAAGACAGG - Exonic
1126217634 15:46174715-46174737 GGAGGAGCCCTGGGGAAGACTGG - Intergenic
1126331011 15:47531661-47531683 GGATGAGTCTGGGGGGAGACTGG - Intronic
1126452701 15:48826845-48826867 GGAGGCTTCTTGGAGAAGACAGG - Intronic
1126802469 15:52311259-52311281 GGATGAAGCTGGGGGAGGTCTGG + Exonic
1127039461 15:54958215-54958237 GTATGAGGCATTGGGAAGACAGG - Intergenic
1127373043 15:58358042-58358064 TGTTGATGCTTTGGGAAGCCTGG - Intronic
1127762111 15:62149638-62149660 GAATGAGGCTTGGGGAGGAGAGG + Intergenic
1129367026 15:75062417-75062439 GGACGATCCTTGTGGAAGCCTGG - Intronic
1129383463 15:75182731-75182753 GCATGAAGCCTGGGGAGGACCGG + Intergenic
1130019481 15:80215840-80215862 GGACGTTGCTTAGGGGAGACTGG + Intergenic
1132744326 16:1430424-1430446 GGAAGAAGCCTGGGGAAGAAGGG + Intergenic
1133593315 16:7266907-7266929 GGAGGTTGCTGGGGGGAGACTGG + Intronic
1133758525 16:8780198-8780220 GGATGAAGCTGGGGGAGGAGAGG + Intronic
1135409897 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG + Exonic
1135561250 16:23478702-23478724 GGCTGATACCTGGGGGAGACAGG - Intronic
1135899127 16:26440126-26440148 GCAAGATGCATGTGGAAGACAGG - Intergenic
1136040607 16:27575935-27575957 GAAGGATGCTGTGGGAAGACAGG - Intronic
1139489293 16:67278155-67278177 GGATGATGCTTCCTGAAGCCAGG + Exonic
1139594862 16:67951594-67951616 GGCTGGTGGCTGGGGAAGACAGG + Intronic
1140129833 16:72150667-72150689 CGATGTTGCTCAGGGAAGACTGG + Exonic
1140218101 16:73024345-73024367 TGATGAGGCTTGGTGGAGACTGG - Intronic
1142656664 17:1399433-1399455 GGATGATGGTGGGGGGAGAGGGG - Intronic
1143675079 17:8426633-8426655 GCCTGAAGCTTGGGGAAGTCAGG + Intronic
1144200805 17:12940552-12940574 GGAGGAAGCTTGGATAAGACAGG - Intronic
1145035359 17:19536982-19537004 GGAGAAAGCTTGAGGAAGACTGG + Intronic
1145993525 17:29093051-29093073 GGAGGGAGCTTGGGGAAGATAGG - Intronic
1147885397 17:43680746-43680768 GGATGTGGGTTGGGGAATACGGG + Intergenic
1147978987 17:44263171-44263193 GAAGGATGTTTGGGGAAGATGGG + Intronic
1148875004 17:50681876-50681898 GGGTGATGCCTGGGGAAGCCAGG - Intronic
1148890071 17:50800805-50800827 GGAGGATGGTTAGGGAAGATGGG + Intergenic
1150598200 17:66626008-66626030 GGATGCTGCTGGGGGCAGAGTGG - Intronic
1151415196 17:73957433-73957455 GTGTGCTGCTTGGGGAAGAGTGG + Intergenic
1153130460 18:1850403-1850425 GGAGGAGTGTTGGGGAAGACTGG + Intergenic
1153500298 18:5742385-5742407 GGCTGAGGCTTGTGGAAGAAAGG + Intergenic
1153566237 18:6420587-6420609 AGTTGGTGCTTGCGGAAGACTGG + Intergenic
1156241790 18:35261950-35261972 GTATGATGCCTGGGGAAGGTTGG + Intronic
1158373053 18:56831425-56831447 GAATGATGCTGGGGCAAGTCGGG + Intronic
1158749049 18:60237461-60237483 GAATGATGGTTGCCGAAGACTGG - Intergenic
1159480543 18:68985757-68985779 GGAAGATGCTGGCAGAAGACTGG - Intronic
1159716434 18:71829248-71829270 GCATGATGTTAGGGGAACACAGG - Intergenic
1162330950 19:10029226-10029248 GGATGATGTTTTGGGATGATGGG + Intergenic
1162932692 19:13965325-13965347 GGATGATGCCTGTGGAGGAAGGG - Intronic
1164499021 19:28796784-28796806 GAATCATGCTTGGGGAAGGGAGG + Intergenic
1164638043 19:29805781-29805803 GGATGATGCCAGGAGAAGTCAGG + Intergenic
1164907315 19:31977848-31977870 GGCTGAGGCTTGGGGAAGTTGGG + Intergenic
1167262741 19:48468184-48468206 GGAGGATGCTTGGGGAAGGGAGG + Intronic
926584848 2:14674660-14674682 GGATGATGCTTCTGCAAGCCAGG + Intergenic
927200373 2:20574687-20574709 GGGTGCTGCTGGGGGAAGCCAGG - Intronic
927731519 2:25477021-25477043 GGATGGTGGTTGCTGAAGACTGG - Intronic
927862977 2:26571494-26571516 GGATTGGGCTTGGGGAAGGCAGG + Intronic
928095642 2:28403423-28403445 GCATCTTGCTTGGGGCAGACTGG - Intronic
928240560 2:29581902-29581924 GGATGATACTAAGGGAAGACTGG + Intronic
928888482 2:36177527-36177549 AGATGATTCTTGTGGTAGACTGG + Intergenic
935191864 2:100784266-100784288 GAATGAGGCCTGGGGAAGAAGGG + Intergenic
938114553 2:128594479-128594501 AGATGATGCCTGAGGAGGACAGG - Intergenic
938178299 2:129156538-129156560 GGCTGTGGCTTGGGGAAGATAGG - Intergenic
939096695 2:137840517-137840539 TGCTGATGCTTGGGGAACAAGGG + Intergenic
940774869 2:157875643-157875665 GGATCAAGCTTGGGGGAGAAAGG + Intronic
941747490 2:169102664-169102686 GGAAAGTGCTTGGGGATGACTGG - Intergenic
944627471 2:201586296-201586318 GGTTGATGCTTGGACAACACAGG - Intronic
945364255 2:208931430-208931452 GGATGTTACTTGGGGAGGATAGG + Intergenic
946339371 2:219058188-219058210 GGCTGAGGCCTGGGGACGACAGG + Intronic
948782170 2:240328634-240328656 GAGTGAAGCTTGGGGAAGGCAGG - Intergenic
1170375173 20:15692326-15692348 GGTGGATGCCTGGGAAAGACAGG - Intronic
1170880803 20:20295371-20295393 GGAGGAGGCCTGGGGAAGCCTGG + Intronic
1172411313 20:34725515-34725537 GGATGAGGCTGGGAGATGACAGG + Intronic
1173294048 20:41739914-41739936 GCAGGATGCCTGGGGAGGACGGG + Intergenic
1173295284 20:41750005-41750027 AGATGATGCTTGGGGGACAATGG + Intergenic
1174525819 20:51170397-51170419 GGGTGATGCTGGGGGAGGCCAGG - Intergenic
1175448657 20:59043677-59043699 GGATGATTTTTGAGCAAGACCGG - Intergenic
1176287758 21:5027751-5027773 GGATGACTCTTGGGCAGGACAGG + Intronic
1177699831 21:24623849-24623871 GGATGATGGTTGCTGAAGATTGG - Intergenic
1178976891 21:37227883-37227905 GGAGGATTCTTGGAGCAGACTGG - Intronic
1179869423 21:44235724-44235746 GGATGACTCTTGGGCAGGACAGG - Intronic
1179985839 21:44919869-44919891 GGAGGATGCATGGGGAGGGCTGG + Intronic
1181237536 22:21456726-21456748 CTAGAATGCTTGGGGAAGACAGG + Intergenic
1181694208 22:24584909-24584931 TGATGGTGCTTGGGGAGGAAGGG + Intronic
1181864323 22:25843498-25843520 GGATGATGTTTGGGAAAAACAGG + Intronic
1182792438 22:32964120-32964142 GGCTGTTGCTTAGGGAAGAAAGG + Intronic
1183086101 22:35488227-35488249 GGTTGATGCCTGGGGGACACAGG + Intergenic
1183366844 22:37411395-37411417 GGATGATGCTTGGGGGTCCCTGG + Intronic
1183487822 22:38098831-38098853 GGATTCTGCTTGGGAAAGTCAGG - Intronic
1184783202 22:46659276-46659298 AGATGATGCTGGGGGGAGGCTGG - Intronic
1184983779 22:48115292-48115314 GGAAGATATTTGTGGAAGACTGG - Intergenic
950161081 3:10761698-10761720 GGGAGCTGCTTGGGGAAGCCAGG - Intergenic
950449380 3:13057152-13057174 GTGTGGTGCTTGGGGAAGGCAGG - Intronic
951073504 3:18361477-18361499 GGAAGATGCTTGGTTCAGACTGG - Intronic
951545557 3:23821506-23821528 GGAAGATGCTAGTGGAAGAAGGG + Intronic
951863251 3:27277404-27277426 GGAGCATGCTGGGGAAAGACTGG - Intronic
953019760 3:39106119-39106141 GGATGATGGTAGGGAAAGAAGGG - Intronic
953446263 3:42970470-42970492 TGGTGCTGGTTGGGGAAGACTGG + Intronic
958917197 3:100062795-100062817 GGAGGAGGCTTGGGCCAGACAGG - Intronic
960084115 3:113572365-113572387 ACATGATGCCTGGGCAAGACAGG + Intronic
960289559 3:115867005-115867027 GGATGCTGCTAGGGGAAGAGGGG + Intronic
962036683 3:131659324-131659346 GGAAGATACTTGGGGAAAACTGG - Intronic
962087254 3:132204717-132204739 GGAGGATGGTGGGGGAAGAGAGG + Intronic
962817890 3:139019522-139019544 GTATGATGCTGGAGAAAGACTGG + Exonic
965011673 3:163101133-163101155 TGAGGATACTTGGGGAACACTGG + Intergenic
965637903 3:170802761-170802783 GGGTGATGTTGGGGGAAGCCAGG + Intronic
966695078 3:182781108-182781130 GGAGGATACTTGGGGAACTCAGG + Intergenic
967074533 3:185990316-185990338 GGAGGAGCCCTGGGGAAGACAGG - Intergenic
968468619 4:765849-765871 AGAAGTTGCTGGGGGAAGACGGG - Intronic
968817433 4:2829279-2829301 GGAGGATGAATGGGGAAGGCTGG + Intronic
973080632 4:45987959-45987981 GGATGATGATAGGGAAAGATAGG + Intergenic
974298747 4:60037906-60037928 GGATGATGCTGGGGGAATCTTGG - Intergenic
977859889 4:101944310-101944332 GGCTGAAGCTGAGGGAAGACTGG - Intronic
981605499 4:146536108-146536130 GGATGAGGGTTGGGGGAGGCAGG + Intergenic
982163018 4:152588633-152588655 GGATGTTTCTTGGGGAAATCAGG - Intergenic
984707698 4:182859870-182859892 GGATGGTGCATGGGAAATACAGG - Intergenic
985746589 5:1651833-1651855 GGATGATGCCTGGGGAGGGGTGG + Intergenic
986285254 5:6354294-6354316 GGCAGAGGCTGGGGGAAGACAGG + Intergenic
986724205 5:10582089-10582111 AGGAGATGCTGGGGGAAGACTGG - Intronic
986812355 5:11373646-11373668 GGATGCTTCTTGGAGAAGCCTGG - Intronic
987370250 5:17186520-17186542 GGGTGATCCTTGGAGATGACAGG - Intronic
988838264 5:35056002-35056024 GGATGTTGATTGGTGAATACTGG - Exonic
990153017 5:52841928-52841950 GGCTCAGGCTTGGGGAAGAGAGG + Intronic
991265783 5:64715488-64715510 GGAAGAGGCTTGGGGCAGAGAGG + Intronic
996785586 5:127233368-127233390 GGATTATGCTGGAGGAACACAGG - Intergenic
997516421 5:134493061-134493083 GGATGACTCTTGGTGAACACAGG - Intergenic
997577103 5:134988283-134988305 GGATGATGGTTGCTGAAGGCTGG + Intronic
997901882 5:137774189-137774211 GGATGGTGCTGGGGGCAGCCTGG - Intergenic
999434297 5:151551177-151551199 GGATGATGGTTGGGTAAGTGGGG - Intronic
999663555 5:153890322-153890344 GGATGTAACTTGGGGAAGAGAGG + Intergenic
1000023833 5:157341819-157341841 GGATGATGCTTGGAGAGTACAGG + Exonic
1002285876 5:178162358-178162380 GCAGGATGCCTGGGGAAGAGGGG + Intergenic
1003839393 6:10104534-10104556 GCATGATCCTTGGGCAAGAGGGG - Intronic
1004409535 6:15367855-15367877 GGATGATACTTGGAGTCGACTGG - Intronic
1005221778 6:23595735-23595757 GGATGCTGCATGGGGCTGACAGG + Intergenic
1006244611 6:32719875-32719897 GGATCATGGTTGGGGAAGGAAGG + Intergenic
1007836663 6:44679057-44679079 GGAAGATGCTGGGGAAAGCCTGG - Intergenic
1011358972 6:86501716-86501738 TAATGATGCTTGGCTAAGACAGG + Intergenic
1011501938 6:88000147-88000169 GGTGGAAGCTTGGGGAAGATAGG + Intergenic
1018662854 6:166104635-166104657 GGATGGTGCAGGGGGTAGACAGG - Intergenic
1019534566 7:1522108-1522130 CAATGATGCTTGTGGAAGATGGG + Intergenic
1019921013 7:4163336-4163358 GAATGATGGTTCGGGAAGTCAGG + Intronic
1026822971 7:73562019-73562041 GGATGATGCCTGGGGATGGATGG - Intergenic
1028297421 7:89151792-89151814 GTATGATGTTGGGGGAAGAGGGG + Intronic
1029984212 7:104907487-104907509 GGGTGATGATGGGGGAAGCCTGG - Intergenic
1031820459 7:126494567-126494589 AGAAAATGCTTGAGGAAGACAGG + Intronic
1032477023 7:132218577-132218599 AGATGATGCTTGAGGAACAAAGG - Intronic
1035050465 7:155995832-155995854 GGGAGATGCTTGGGAAAGAAAGG + Intergenic
1035812445 8:2504141-2504163 GCATGAAGTTTCGGGAAGACAGG + Intergenic
1040974508 8:53175147-53175169 GGAGGATGCCGTGGGAAGACGGG + Intergenic
1044621488 8:94194854-94194876 GCATGAAGCTTCTGGAAGACTGG - Intronic
1048360492 8:133693430-133693452 GGTTGATGCTTTGAGAACACAGG + Intergenic
1049056670 8:140242387-140242409 AGATGAGCCTTGGGGAAGAACGG + Intronic
1049087990 8:140493002-140493024 GCAGGATGCTTGCTGAAGACAGG - Intergenic
1049340028 8:142107161-142107183 GGTAGATGCTTTGGGGAGACTGG + Intergenic
1050119233 9:2291227-2291249 GGATCATTCTTGGGGATTACGGG + Intergenic
1050928654 9:11297603-11297625 GGATGAGACTTCAGGAAGACTGG - Intergenic
1052242848 9:26295378-26295400 AGATGGTGCTTGGGGATGGCAGG + Intergenic
1056017784 9:82409035-82409057 GGATGATGCTTTGTGAATCCAGG - Intergenic
1057082564 9:92184063-92184085 GGATGATGGGTGGAGAAGAAAGG - Intergenic
1057772271 9:97979165-97979187 GGATGCTGCTTGGGTAAGGAAGG + Intergenic
1059427664 9:114231218-114231240 AGATGATGCTGGGGGAAGGGAGG + Intronic
1060151060 9:121288669-121288691 GGATGATGTTTAGGGAGGACAGG - Intronic
1060369896 9:123058896-123058918 GGGGCATGCTGGGGGAAGACTGG - Intronic
1060944509 9:127561994-127562016 GGATGATGCTTGCAGGAGCCCGG + Intronic
1061940057 9:133879031-133879053 GGATGATGCCTGGGGAACGGGGG - Intronic
1061940235 9:133880074-133880096 AGACGCTGCATGGGGAAGACAGG + Intronic
1187372426 X:18721129-18721151 GGAAGATGGATGGGGAAGAAAGG - Intronic
1194614814 X:96087542-96087564 GGCTGATGTTTGGGGATGTCTGG - Intergenic
1195129694 X:101840233-101840255 GGAGGAGGCTTGGTGGAGACAGG + Intronic
1195176544 X:102319596-102319618 GGAGGAGGCTTGGTGGAGACAGG - Intronic
1195182320 X:102367497-102367519 GGAGGAGGCTTGGTGGAGACAGG + Intronic
1195202411 X:102564288-102564310 GGAGGAGGCTTGGTGGAGACAGG - Intergenic
1199107538 X:143888367-143888389 AGATGCTTCTTGGGGAACACAGG + Intergenic
1199710167 X:150463300-150463322 GGAATGTGTTTGGGGAAGACTGG + Intronic
1200403594 Y:2785419-2785441 GGAGGATTCTTGCTGAAGACAGG + Intergenic
1200869300 Y:8079775-8079797 GGATGATGCATGGAGAAATCAGG + Intergenic