ID: 1112624830

View in Genome Browser
Species Human (GRCh38)
Location 13:101092355-101092377
Sequence AAGATACAGCATGCCGTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112624830 Original CRISPR AAGATACAGCATGCCGTTTT TGG (reversed) Intronic
900788040 1:4661614-4661636 AAGTTACAGGTTGCCCTTTTGGG + Intronic
906882990 1:49613137-49613159 AAGTGACAGCATGCAGTATTTGG - Intronic
907585522 1:55613652-55613674 AAGATACAGCTTGACAGTTTGGG - Intergenic
908938727 1:69407323-69407345 AACATACAGCATACAGTGTTTGG + Intergenic
909164106 1:72195779-72195801 AAGATACTGCATGCCTTGTGTGG + Intronic
910622056 1:89266507-89266529 AAGATAAAGCATTTCTTTTTTGG + Exonic
919292939 1:195656494-195656516 AAAATACAGCCTGCAGTATTAGG + Intergenic
919328616 1:196140125-196140147 AAGATACAGAATTCCCCTTTGGG + Intergenic
923751321 1:236748820-236748842 AAGTTACAGTATGCCGTATGTGG + Intronic
1064273279 10:13884243-13884265 AATATACAGGATGCCTTTTAGGG - Intronic
1067242529 10:44508678-44508700 GAGATACAGCATGCTTTTTGAGG - Intergenic
1068389389 10:56374274-56374296 AAGATACTGCATTTTGTTTTAGG + Intergenic
1069399616 10:68029187-68029209 AAGTTACAGAATGCAGTTTAAGG + Intronic
1075326306 10:121534694-121534716 AACAAACAGAATGCCATTTTGGG - Intronic
1076531262 10:131146803-131146825 AAGACAAAGCCTGCCTTTTTAGG + Intronic
1078028676 11:7725676-7725698 CAAATACAGCATGTCCTTTTGGG - Intergenic
1082229762 11:49748989-49749011 AATAGACAGCATGCAATTTTTGG - Intergenic
1086598652 11:88606103-88606125 AAGATAGAGCATGCTATGTTTGG + Intronic
1086620314 11:88880136-88880158 AATAGACAGCATGCAATTTTTGG + Intronic
1086762532 11:90650676-90650698 AAGATACAGCATGCGGTCTTTGG - Intergenic
1087736516 11:101840408-101840430 AAGATGCAGCATGGGGTTTATGG - Intronic
1089594472 11:119568448-119568470 AAGCTGCAGGATGCTGTTTTGGG - Intergenic
1090321624 11:125849752-125849774 AAGTGACAGCATGCAGTGTTTGG - Intergenic
1098555563 12:71814991-71815013 AAGAAACGGCATCCCATTTTTGG + Intergenic
1107232595 13:38128363-38128385 AAGAGAGAGCATGCGGTATTTGG + Intergenic
1109050457 13:57474229-57474251 AAGATGCAGCATGTTGTGTTTGG - Intergenic
1112624830 13:101092355-101092377 AAGATACAGCATGCCGTTTTTGG - Intronic
1118935012 14:70279773-70279795 AAGTGAAAGCATGCGGTTTTTGG - Intergenic
1122827796 14:104379628-104379650 AAGATACAGAGTGATGTTTTTGG + Intergenic
1125494997 15:40184890-40184912 AAGATGCAGAATGTCTTTTTTGG + Intronic
1126966607 15:54061589-54061611 ATGGTACAGCAAGCCCTTTTAGG + Intronic
1127705944 15:61547211-61547233 AAGAAAGAGAATGCCATTTTAGG - Intergenic
1151060134 17:71082060-71082082 AAAATACATAATGCAGTTTTTGG - Intergenic
1151378399 17:73707844-73707866 AAGAGACAGCAAGCAGGTTTGGG - Intergenic
1153454273 18:5262536-5262558 GAGTTAGAGCATGCAGTTTTAGG + Intergenic
1155435694 18:25810685-25810707 AAGAAACAGCATGTCGTCCTAGG - Intergenic
1161323935 19:3653926-3653948 AGGATACAGCATTGCGTTTCCGG - Intronic
1167189237 19:47972522-47972544 AAGTGACAGCATGCAGTATTTGG + Intronic
925869615 2:8257916-8257938 AAGATATAGCATGACTTTTAGGG - Intergenic
928191215 2:29170390-29170412 AAGATACAGCACACTGTTATTGG - Intronic
930373944 2:50540360-50540382 AATATAAAGCATGGCATTTTGGG + Intronic
933600884 2:84328848-84328870 AAGATACAGCCTGCCCTTGTAGG + Intergenic
933700620 2:85252829-85252851 AAGTTGCAGCCTGCCGTTCTGGG - Intronic
934108113 2:88714932-88714954 GAGAATCAGCATGCTGTTTTGGG + Intronic
936905487 2:117531515-117531537 AAGTTACAACATGCAGTATTTGG - Intergenic
937747596 2:125433396-125433418 AAGATACAGAATGCCCAATTAGG + Intergenic
938608595 2:132922610-132922632 ATGAAACAGCATGCCCTGTTTGG - Intronic
942152071 2:173086587-173086609 GTGATACACCATGCCATTTTGGG - Intronic
945133514 2:206600213-206600235 AAGATACAACATGCAGTTTTTGG - Intronic
945906444 2:215598944-215598966 CAGTAACAGCATGCCTTTTTTGG + Intergenic
1169009760 20:2240623-2240645 AAGAAATAGTATGCCTTTTTTGG + Intergenic
1176955265 21:15095338-15095360 AAGATACCACAGGCCCTTTTGGG - Intergenic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
1182510412 22:30815758-30815780 AAGATAGAGGATGGCCTTTTGGG - Intronic
1184326218 22:43788972-43788994 ATGATACAGTATGTGGTTTTGGG - Intronic
949099052 3:121060-121082 AAAATAGAACATGCCTTTTTTGG + Intergenic
955121572 3:56065069-56065091 AAGATACAACATAGCATTTTAGG + Intronic
956764997 3:72477402-72477424 AAGATACAGCCTGCATTTTTTGG - Intergenic
957538322 3:81534577-81534599 AAGACACAGCATACCTTTGTAGG - Intronic
958684136 3:97371141-97371163 AAAATTCAGCATGGCATTTTAGG + Intronic
962563268 3:136630580-136630602 AAGAGACAACATGCCATATTTGG + Intronic
966670269 3:182518429-182518451 AACATACAACAGGCAGTTTTGGG - Intergenic
971183437 4:24351746-24351768 AACATACAGCATCCTGATTTGGG + Intergenic
972902141 4:43698464-43698486 AAGAGAGAACATGCAGTTTTTGG + Intergenic
974444619 4:61963496-61963518 AAGAGAGAGCATGCAGTGTTTGG + Intronic
975635424 4:76443444-76443466 AAGATCCAGCATGTCCTTTGAGG - Intronic
983953489 4:173670377-173670399 AAGATATTCCATGCCATTTTTGG - Intergenic
984464587 4:180081927-180081949 AAAATACAGCATGCAATTATGGG + Intergenic
985921178 5:2976677-2976699 AAGCTACAGCATGCCACTGTGGG + Intergenic
986840677 5:11693399-11693421 AAGATACTGCATTTCATTTTAGG + Intronic
988145742 5:27304458-27304480 AAAATACAGCATCCCATCTTGGG - Intergenic
992819860 5:80485680-80485702 AAGTAACAGCATGCAGTATTTGG - Intergenic
995921567 5:117320277-117320299 AAAATACAGCATTGTGTTTTAGG + Intergenic
996042258 5:118828308-118828330 AATAAACAGCATGCCTCTTTTGG - Intergenic
996093504 5:119374431-119374453 TAGATACAGCATGACTTTTCAGG + Intronic
998662329 5:144253635-144253657 AAGAAAAAGAATACCGTTTTGGG + Intronic
1003458189 6:6304254-6304276 AAAATTCAGCATCCAGTTTTAGG - Intronic
1005796682 6:29370171-29370193 AAGTTACAACATGCAGTATTTGG + Intronic
1005818979 6:29581254-29581276 AAGATACAGTGTGGCATTTTGGG - Intronic
1007018957 6:38499783-38499805 AAGGTGCAGCATGCTGTCTTAGG + Intronic
1009858186 6:69291480-69291502 AAGAAACAGCAAGGTGTTTTGGG - Intronic
1014766042 6:125407832-125407854 AAAATACAGCATGCCATGTGGGG - Intergenic
1016181189 6:141150033-141150055 AAGATACAGAATTCCCCTTTGGG + Intergenic
1016908369 6:149173298-149173320 AAGATGCAACATACCTTTTTGGG - Intergenic
1020399968 7:7764861-7764883 AAGAAACAGCAGGCCAGTTTTGG - Intronic
1026116522 7:67500364-67500386 AAGATAGAACATGCAGTATTTGG - Intergenic
1027945338 7:84738115-84738137 AAGAAACTGCAAGCCATTTTAGG + Intergenic
1031439536 7:121776510-121776532 AAGATACACCATGCAGTTGTTGG + Intergenic
1031553577 7:123144124-123144146 CAGATCAAGCATGCTGTTTTGGG + Intronic
1032233826 7:130102131-130102153 AAAATACAGCCTGCCAATTTTGG + Intronic
1033735406 7:144217070-144217092 AATAAACAGCATGCTGTTATTGG - Intergenic
1033747649 7:144333899-144333921 AATAAACAGCATGCTGTTATTGG + Intergenic
1036494094 8:9253651-9253673 AAGAAACACCTTGCCGTATTTGG + Intergenic
1037212229 8:16404339-16404361 AAGAAACAGAATGCCATTTTGGG - Intronic
1040878466 8:52177255-52177277 AAGATACAGGTTGCCGTTAAGGG - Intronic
1041542372 8:59000088-59000110 AAAATACATCATGTCTTTTTAGG + Intronic
1046145232 8:110149755-110149777 AAGTGACAACATGCAGTTTTTGG + Intergenic
1057234054 9:93345048-93345070 AAGTTACAGCATGCAGTATTTGG + Intronic
1058374902 9:104311250-104311272 AACATACACCATGGCGTGTTGGG + Intergenic
1059571976 9:115447711-115447733 AAGTTAGAACATGCCGTATTTGG - Intergenic
1059972159 9:119678962-119678984 AAGAGACAGCATGATGTCTTTGG + Intergenic
1187992793 X:24894150-24894172 AAAATACTGCACGCAGTTTTGGG - Intronic
1188377293 X:29447212-29447234 AAGATAAAGCATGTCTTTTGGGG - Intronic
1188928490 X:36075767-36075789 AAGAGAGAGCATGCGGTATTTGG + Intronic
1189912688 X:45827060-45827082 AAGATACTGCATCCCACTTTGGG + Intergenic
1193969369 X:88032895-88032917 AAGAAAGAGCATGCTGTATTTGG - Intergenic
1196813151 X:119644530-119644552 AAGAGACATCATGCAGTGTTGGG - Intronic
1197797191 X:130310617-130310639 AAAATACAAGATGCTGTTTTTGG - Intergenic
1201587750 Y:15580149-15580171 AAGTGACAGCATGCAGTATTTGG - Intergenic