ID: 1112628631

View in Genome Browser
Species Human (GRCh38)
Location 13:101136162-101136184
Sequence TGGTCCTCAAAAATGATTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112628629_1112628631 -1 Left 1112628629 13:101136140-101136162 CCAGCAAACTGTTTGCATATAAT 0: 1
1: 0
2: 1
3: 12
4: 179
Right 1112628631 13:101136162-101136184 TGGTCCTCAAAAATGATTGTTGG 0: 1
1: 0
2: 0
3: 12
4: 159
1112628628_1112628631 0 Left 1112628628 13:101136139-101136161 CCCAGCAAACTGTTTGCATATAA 0: 1
1: 0
2: 1
3: 18
4: 209
Right 1112628631 13:101136162-101136184 TGGTCCTCAAAAATGATTGTTGG 0: 1
1: 0
2: 0
3: 12
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112628631 Original CRISPR TGGTCCTCAAAAATGATTGT TGG Intronic
904114859 1:28154352-28154374 TGGTGCTCAGAAATATTTGTTGG - Intronic
904621363 1:31777257-31777279 TGGTCCTGAACAAGGATGGTGGG - Intergenic
905342083 1:37286225-37286247 TGGGCTTCAAAAATATTTGTTGG + Intergenic
906057359 1:42927627-42927649 TGGACCTCAAATTTCATTGTGGG - Exonic
906665918 1:47621894-47621916 TGGTGCTTACAAATGGTTGTAGG + Intergenic
909028178 1:70507124-70507146 TGCTCCCAAAAAATGATTCTTGG - Intergenic
910466382 1:87504757-87504779 AGGTGCTCAAAAATATTTGTTGG + Intergenic
910950622 1:92643572-92643594 TAGTTTTCAAAAATGATTGAAGG - Intronic
916625993 1:166555346-166555368 TGGGCATCAAAAATAATTTTAGG - Intergenic
916809012 1:168289181-168289203 TGGGCATCAGAAATGATTCTAGG - Intronic
916969540 1:169996935-169996957 TAGTCCTCAAAACTGCTTGGGGG - Intronic
918051215 1:180974099-180974121 TTGTCCTTAAAAATAAATGTAGG + Exonic
918396707 1:184120568-184120590 TGGACCTCTAAAAGCATTGTGGG - Intergenic
918652125 1:186978380-186978402 TGGTCCTAAAATATGGTTTTTGG - Intronic
923404113 1:233643607-233643629 TGGACCTCATAAATGGGTGTGGG + Intronic
1063714721 10:8515208-8515230 TGCTCCTCAAAAAAGATTTACGG - Intergenic
1065118388 10:22504432-22504454 TGCTCCTCAAAAATATTTTTAGG + Intergenic
1065127956 10:22592516-22592538 TAGTTCTCAAAAATGGTGGTAGG - Intronic
1066255881 10:33678409-33678431 TTGTCCTCAACAATGAGAGTGGG + Intergenic
1068499811 10:57830433-57830455 TGATCCACAAAAATAATTGTTGG - Intergenic
1069261700 10:66406200-66406222 TGGTCCTCAAAAGTGGAGGTGGG - Intronic
1072226540 10:93375293-93375315 TGGTTCTGTAAAATGATTCTAGG - Intronic
1074077161 10:110139501-110139523 TAGGCCTTAAAAATAATTGTGGG - Intergenic
1074438807 10:113456994-113457016 TAGTTCTCACCAATGATTGTGGG - Intergenic
1074666616 10:115734317-115734339 TCCTTGTCAAAAATGATTGTTGG + Intronic
1078130023 11:8605755-8605777 TAGTTCTCAAAAATAATTGCAGG - Intergenic
1078657618 11:13256355-13256377 AGATCCTCAACAATGATTTTTGG - Intergenic
1078956931 11:16209453-16209475 TGATCCTCAAAAATATTTCTGGG + Intronic
1079922188 11:26446907-26446929 TGATCATCAAAAGTGATTTTAGG + Intronic
1080021014 11:27560187-27560209 GGGTCATCAAATATTATTGTGGG + Intergenic
1081244218 11:40744621-40744643 TGACCCTCAAAAATGTTTCTGGG + Intronic
1084488719 11:69466005-69466027 GGGTCCTCAAAAAATAATGTGGG + Intergenic
1086263372 11:84968624-84968646 TAGTCTTCAAAAATCATTTTTGG - Intronic
1087578545 11:100022679-100022701 TGTTCCTCCAACATAATTGTAGG + Intronic
1093922996 12:24880697-24880719 TGGTCTTCAAATATTATTTTAGG + Intronic
1095203537 12:39412991-39413013 AGGTCCTCCAGAATGATTGAAGG - Intronic
1096335889 12:50755889-50755911 TAGTCTTCAAAAATGAAGGTGGG + Intergenic
1096808790 12:54156755-54156777 TGGGCCTAAAAAATGATTAGAGG + Intergenic
1099491139 12:83289821-83289843 TAGTGCTCAAAAATAATTGATGG + Intergenic
1100338648 12:93656833-93656855 TGGTCCTCACCAATGTTGGTGGG - Intergenic
1103807900 12:123588395-123588417 TGGCCCTGAAAAATGAGTGCAGG - Intronic
1110527346 13:76554439-76554461 TGGGCCTCAAAAATGTCTGATGG - Intergenic
1111697412 13:91642260-91642282 TGTAACTCAAAAATGATAGTTGG + Intronic
1111966426 13:94866547-94866569 TGGTCCTCAGTAATAATTTTTGG + Intergenic
1111966614 13:94867875-94867897 TGGTCCTCAGTAATAATTTTTGG - Intergenic
1112628631 13:101136162-101136184 TGGTCCTCAAAAATGATTGTTGG + Intronic
1113136481 13:107095905-107095927 TGGACCTCAGAGATTATTGTAGG + Intergenic
1113163383 13:107409519-107409541 TGGGGCTCAAAAATCAGTGTGGG + Intronic
1113402122 13:110003973-110003995 TGATCCTCAAAAATGTGGGTGGG + Intergenic
1116543664 14:46134914-46134936 TTGCCCTCTACAATGATTGTAGG - Intergenic
1118179808 14:63481038-63481060 TTGTCATCAAAAATAATTTTTGG + Intronic
1120914080 14:89694986-89695008 GCCTCCTTAAAAATGATTGTTGG - Intergenic
1124456574 15:29848308-29848330 TGATCCTCAACTATAATTGTGGG + Intronic
1128889214 15:71315941-71315963 TCATCCTCAAAAGTGAATGTAGG + Intronic
1130215684 15:81966634-81966656 TATTCCTCAAAAATCTTTGTAGG - Intergenic
1130435741 15:83897494-83897516 TCGTCTTCAAAAATTATTTTGGG + Intronic
1131638750 15:94266598-94266620 TGGTCTCCAAAATTGAGTGTTGG - Intronic
1132901603 16:2258201-2258223 TGGTTCTCAGAAATGATTAAAGG + Intronic
1134004071 16:10805820-10805842 AGGTCCTTGAAAATGTTTGTTGG + Intronic
1135792268 16:25407936-25407958 TGGTCCTCACAAATAATTCTAGG - Intergenic
1136914150 16:34165837-34165859 TGGTCCTAAAAACTAATTATGGG + Intergenic
1140697429 16:77548796-77548818 TGGTCTTTAAAAATTTTTGTAGG + Intergenic
1141938708 16:87259891-87259913 TGGGCCTCCAAAATAATTGGAGG + Intronic
1153757760 18:8301230-8301252 TGGTCCTTAAAACTGTTTATTGG + Intronic
1156800949 18:41113128-41113150 TGGTGCTCAAAAAAGACTGAAGG - Intergenic
1157478670 18:48039030-48039052 TTGTACTCAAAACTGATTGGCGG - Intronic
1160364546 18:78313097-78313119 TGGAATTCAATAATGATTGTGGG + Intergenic
1162288923 19:9763808-9763830 TGATCCTCAATCATGCTTGTTGG - Intronic
1166395522 19:42437399-42437421 TGGTTCCCAAAACTGATTTTAGG - Intronic
926445405 2:12935803-12935825 TGGTCCTCAGAACTGATGGTGGG - Intergenic
926561247 2:14419795-14419817 TGGTCCTCAAAAATTAGATTGGG - Intergenic
926877673 2:17501145-17501167 TGAACCTCAATAATGATTGCTGG - Intergenic
928915429 2:36465204-36465226 TGGCCCTGAAAAAGGATTCTTGG + Intronic
928995274 2:37283003-37283025 GGTTCCTCATAAATGTTTGTTGG - Intronic
929648949 2:43658582-43658604 TGGTTCACCAAAATGGTTGTTGG + Intronic
937575422 2:123414980-123415002 ATGTCCACAAAAATTATTGTCGG - Intergenic
938224940 2:129607408-129607430 TGGTCCCCAACAATTATTATGGG + Intergenic
939793583 2:146612626-146612648 TGTTCCTCTTAAATGTTTGTAGG + Intergenic
940452983 2:153864216-153864238 TGGTACTGAAATATCATTGTGGG + Intergenic
942535227 2:176956118-176956140 TAGTTCTCAAAAATAACTGTAGG - Intergenic
943189161 2:184653921-184653943 TGGTTCTCTAAAATGATCATTGG - Intronic
944291530 2:198012361-198012383 TAGTTCTCAAAAATAACTGTAGG - Intronic
945509568 2:210684048-210684070 TGATACTAAAAAATGATTGTAGG + Intergenic
946241351 2:218357799-218357821 TGGTCCTGAAAAAAGATTCTAGG - Intronic
947507314 2:230718151-230718173 TGGTCCTCAACAATTTTTGCTGG - Intronic
947663835 2:231890457-231890479 AGGACCTCAAAAATGACAGTAGG + Intergenic
1169360850 20:4947705-4947727 TTGTCTTCCAGAATGATTGTTGG - Intronic
1169410573 20:5366188-5366210 TGGCCCCCAAATATGACTGTAGG - Intergenic
1174840924 20:53900751-53900773 AAGTGCTCAAAACTGATTGTAGG + Intergenic
1175746583 20:61461101-61461123 TGAACCTCTAAAATGAATGTTGG + Intronic
1177051065 21:16234572-16234594 TGGTTTTCAAAAATGTTTGATGG - Intergenic
1180668811 22:17536675-17536697 TGGTCCTAAAAAAGGATTTGCGG + Intronic
1183814163 22:40285371-40285393 TGGTTCACAAAAAAGAATGTAGG + Intronic
1184673955 22:46030277-46030299 TGGTCCTCACATTTGATGGTTGG + Intergenic
949410381 3:3757033-3757055 TGGTTCTTAAAGATGATTCTGGG - Intronic
950252514 3:11478361-11478383 TGGTTCTCAATAATGATTACAGG - Intronic
952719965 3:36522424-36522446 TAGTCCTCAAAAAATATTGATGG + Intronic
955622073 3:60875241-60875263 TGGTACAGAAAAATGAATGTTGG - Intronic
957910331 3:86612907-86612929 TGGTCCTCAAAAAGGAACGGAGG + Intergenic
959310693 3:104732605-104732627 TGTCCCTCTAAAAGGATTGTGGG + Intergenic
960761030 3:121074109-121074131 GCTTCCTCAAAAATGATTGGGGG + Intronic
962806195 3:138929294-138929316 TGGTCCTCAAACTTGAGTGAGGG + Intergenic
964423487 3:156529388-156529410 TGCACCTTAAAAATGATGGTTGG + Intronic
965439292 3:168692745-168692767 TGGGCCTCTAAAAGTATTGTGGG + Intergenic
967468821 3:189839233-189839255 TGATTCTCAACAATTATTGTCGG + Intronic
972616616 4:40704555-40704577 TGTTCTTCAATAATGAATGTAGG - Intergenic
973150256 4:46878975-46878997 TCATGCTCAAAGATGATTGTAGG + Intronic
974387151 4:61216320-61216342 TGTTCCTAATAAATGATTTTAGG + Intronic
974884661 4:67803761-67803783 TGATCCCCAAAAATCATTCTAGG - Intergenic
975417655 4:74123818-74123840 TGGGCTTCTAAAATTATTGTGGG + Intronic
978148403 4:105405192-105405214 TGCTCCTGAAAAATCAATGTAGG + Intronic
978374926 4:108065184-108065206 TTGTCCTCAAAAATAATTTTAGG + Intronic
981487140 4:145299211-145299233 TCATACTCAAAAATGACTGTAGG + Intergenic
982996096 4:162347980-162348002 GAGTCCTGAACAATGATTGTTGG - Intergenic
984677086 4:182562385-182562407 AAGTCCTAAAAAATAATTGTGGG - Intronic
986476890 5:8143465-8143487 TGGTTCTCTAAAATGATAATTGG - Intergenic
986847143 5:11768722-11768744 TTGTCCTCACAAATGATTGCAGG - Intronic
987162747 5:15161093-15161115 TGGCTCTCAAAAATATTTGTTGG - Intergenic
987848207 5:23315521-23315543 GGCTCCTCACAAAGGATTGTTGG - Intergenic
989326138 5:40197641-40197663 TTGTTCTCAAAAATCATTGTTGG - Intergenic
989400487 5:41002923-41002945 TTGTCCTCAAAAATGCTTACTGG - Intronic
991571337 5:68056560-68056582 TGGTCCTATAAAATGAAAGTAGG - Intergenic
992297736 5:75343013-75343035 TAATAGTCAAAAATGATTGTGGG + Intronic
995374609 5:111459901-111459923 TGGGCATCAAAAATGATTTATGG - Intronic
995853474 5:116571288-116571310 GGCTCCTCAGAAATGATTTTCGG + Intronic
998674495 5:144391685-144391707 TGGTCCTTCAAATTCATTGTAGG - Intronic
1001419718 5:171577411-171577433 TGGTCAGCATAAATGTTTGTTGG + Intergenic
1001430860 5:171660852-171660874 TGAACCTCAAAGATGAGTGTTGG + Intergenic
1002611844 5:180424648-180424670 TGTCCCTCAAAAATGTATGTTGG - Intergenic
1003537789 6:6990806-6990828 TGGTCCTCAAAAATACATGGGGG - Intergenic
1004435447 6:15588564-15588586 TGGTCTTCAAAGAGGAATGTGGG - Intronic
1005455545 6:26016634-26016656 TGGTCCTAAGAAATGCTTCTGGG - Intergenic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1012630722 6:101463789-101463811 TGCTCCTCAAAATTGATCTTGGG - Intronic
1013012922 6:106135885-106135907 AGGTCATAAAAAATAATTGTCGG - Intergenic
1014399088 6:120964841-120964863 TGGACCACAAAAATGACTGGTGG + Intergenic
1015075661 6:129153672-129153694 TAATCCTCAAAAATGCTTTTAGG - Intronic
1015851421 6:137576968-137576990 TGGTCATCACAAATGATTCCTGG + Intergenic
1016478416 6:144453986-144454008 TGGTTTTCAAAAATGTTTTTAGG + Intronic
1016771421 6:147856585-147856607 AGACTCTCAAAAATGATTGTTGG + Intergenic
1021067952 7:16199560-16199582 TGGTAATAAAAAATGACTGTGGG - Intronic
1021569740 7:22052704-22052726 TGGATCTCAGAAATGACTGTTGG + Intergenic
1022119587 7:27295028-27295050 CTGTCCTCTGAAATGATTGTGGG + Intergenic
1025158296 7:56630267-56630289 AGGCCCGCAAAAGTGATTGTGGG + Intergenic
1028510766 7:91623925-91623947 TTGTCATCAAAACTGAATGTTGG + Intergenic
1033535127 7:142305183-142305205 TGTTGCTAAAAAATGACTGTGGG + Intergenic
1034653094 7:152707734-152707756 TGGTCCTCAGAAATGTTTCTGGG - Intergenic
1035911987 8:3577500-3577522 TGGTCATCTAAAATGAATATTGG + Intronic
1037126637 8:15359368-15359390 TGGCCTTTAAAAATGTTTGTTGG - Intergenic
1037350811 8:17953279-17953301 AGCTCCTCAAAAATATTTGTAGG + Intronic
1038104478 8:24416894-24416916 TAATCCTCAAAAATGACAGTAGG - Intergenic
1038163237 8:25060540-25060562 TGGTTCTCAAAAAGCATAGTAGG - Intergenic
1038901249 8:31846492-31846514 TAGTCCTTAAAAATATTTGTTGG - Intronic
1039227678 8:35406507-35406529 TGGTCCTGAAAAATTGTTGTAGG + Intronic
1041256198 8:55981374-55981396 AGATGCTCAAAAATGCTTGTTGG + Intronic
1041779278 8:61559839-61559861 TGGTCTTCAAACATGCTTGATGG - Intronic
1042430752 8:68703699-68703721 GGCTCCTCAAAAATTCTTGTGGG + Intronic
1045895224 8:107208353-107208375 TGCCCCTCAAAAATGATAATTGG + Intergenic
1046214799 8:111129827-111129849 TAGTGCTCAAAAATGATTTAGGG + Intergenic
1046354812 8:113068543-113068565 AGGTACACAAAGATGATTGTTGG - Intronic
1046466882 8:114616319-114616341 TAGTCATCAAAAATAATTATTGG - Intergenic
1048175221 8:132146129-132146151 TTCTCCTCAAAAATCTTTGTGGG - Intronic
1048314847 8:133354201-133354223 TGTGCCTCAAAAATGATGTTGGG - Intergenic
1051713654 9:19958883-19958905 AGGGCCTCAAAAATGATGGTTGG - Intergenic
1052246291 9:26339655-26339677 CTGTCCTCAATAAAGATTGTTGG - Intergenic
1059940617 9:119355792-119355814 TGGTCCTTAAGAATGATATTAGG - Intronic
1190885468 X:54527813-54527835 TTCTCCTTAAAAATTATTGTTGG + Intergenic
1193287181 X:79726351-79726373 TAGTCCTCAAAAATCATTGAAGG + Intergenic
1194270454 X:91807656-91807678 TGTTCCTCATAAATCATTCTAGG + Intronic
1199177661 X:144810760-144810782 TGGTACTTAAATATCATTGTTGG - Intergenic
1200363179 X:155633062-155633084 TGGTCCTCAACAATTTTTGATGG + Intronic
1200587688 Y:5029084-5029106 TGTTCCTCATAAATCATTCTAGG + Intronic