ID: 1112630148

View in Genome Browser
Species Human (GRCh38)
Location 13:101152082-101152104
Sequence GTATATCCAAGGTCAAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 117}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112630142_1112630148 6 Left 1112630142 13:101152053-101152075 CCGTTTTACAAAAATATTTAATA 0: 1
1: 1
2: 13
3: 174
4: 1756
Right 1112630148 13:101152082-101152104 GTATATCCAAGGTCAAAGTGGGG 0: 1
1: 0
2: 1
3: 17
4: 117
1112630141_1112630148 7 Left 1112630141 13:101152052-101152074 CCCGTTTTACAAAAATATTTAAT 0: 1
1: 0
2: 10
3: 135
4: 1259
Right 1112630148 13:101152082-101152104 GTATATCCAAGGTCAAAGTGGGG 0: 1
1: 0
2: 1
3: 17
4: 117
1112630140_1112630148 8 Left 1112630140 13:101152051-101152073 CCCCGTTTTACAAAAATATTTAA 0: 1
1: 0
2: 11
3: 93
4: 882
Right 1112630148 13:101152082-101152104 GTATATCCAAGGTCAAAGTGGGG 0: 1
1: 0
2: 1
3: 17
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112630148 Original CRISPR GTATATCCAAGGTCAAAGTG GGG Intronic
900493094 1:2962602-2962624 GGAAATCCAAGGTCAAGTTGTGG - Intergenic
903330955 1:22597143-22597165 GTATTTCCCAAGTGAAAGTGGGG - Intronic
906848952 1:49226894-49226916 GGAAGTCCAAGGTCAAAGTGAGG + Intronic
908801243 1:67883011-67883033 GCATATCCAAGGTCATATAGAGG + Intergenic
912711282 1:111951845-111951867 GAACATCCAAGGTGATAGTGTGG + Intronic
924883855 1:248190657-248190679 GGTTCTCCAAGGTCAAAATGAGG + Intergenic
1064197296 10:13255374-13255396 GCAAATCCAAGATCAACGTGTGG + Intergenic
1065103976 10:22361286-22361308 CTATATCCAATGTCAAAATTAGG - Intronic
1067372140 10:45694742-45694764 GTATCTCCAAGGTCACACTGTGG - Intergenic
1067387640 10:45831413-45831435 GTATCTCCAAGGTCACACTGTGG + Exonic
1067418488 10:46125858-46125880 GTATCTCCAAGGTCACACTGTGG - Intergenic
1067427483 10:46220888-46220910 GCAAGTCCAAGGTCAAGGTGTGG - Intergenic
1067446635 10:46353200-46353222 GTATCTCCAAGGTCACACTGTGG - Intergenic
1067503841 10:46832435-46832457 GTATCTCCAAGGTCACACTGTGG - Intergenic
1067582916 10:47456822-47456844 GCAAGTCCAAGGTCAAGGTGTGG - Intergenic
1067590748 10:47507567-47507589 GTATCTCCAAGGTCACACTGTGG + Exonic
1067637867 10:48015666-48015688 GTATCTCCAAGGTCACACTGTGG + Intergenic
1067875623 10:50004679-50004701 GTATCTCCAAGGTCACACTGTGG - Exonic
1067918562 10:50427800-50427822 ACATATCCCATGTCAAAGTGTGG - Intronic
1069099025 10:64295220-64295242 TTATATACAAGGTAAAAGTCTGG + Intergenic
1070134464 10:73680090-73680112 GTATCTCCAAGGTCACACTGTGG + Exonic
1071607258 10:87004319-87004341 GTATCTCCAAGGTCACACTGTGG - Intergenic
1072812137 10:98470314-98470336 AGATATCCAAGTGCAAAGTGTGG + Intronic
1077262660 11:1631137-1631159 GTAAATCCAAGCTCACAGTCTGG + Intergenic
1077829086 11:5844381-5844403 GAAAATACAAGGACAAAGTGAGG + Intronic
1082864346 11:57884943-57884965 TGATTTCCAAGGCCAAAGTGTGG - Intergenic
1084744023 11:71156120-71156142 GTTTGTCCAAGATCAAGGTGTGG - Intronic
1084779887 11:71401060-71401082 GGAAGTCCAAGGTCAAGGTGTGG - Intergenic
1085334992 11:75686571-75686593 GATTCTCCAAGGTCAAAATGAGG - Intergenic
1085484615 11:76851427-76851449 AAATCTCCAAGGTCAAAATGGGG - Intergenic
1086719746 11:90105168-90105190 ATAAATCCAAGGTCAAATTGGGG - Intergenic
1092159269 12:6307114-6307136 GTATAACTGAGGTCAAACTGCGG + Intergenic
1092521983 12:9284731-9284753 GGATGTCCAAGATCAATGTGGGG + Intergenic
1094054806 12:26257854-26257876 GATTCTCCAAGGTCAAAATGAGG + Intronic
1094095621 12:26700997-26701019 GCATATCCAAGATCAAAGGCAGG + Intronic
1094507651 12:31074925-31074947 GGATGTCCAAGATCAATGTGGGG + Intronic
1095880619 12:47132365-47132387 GTATATCCAAATTAAAAGTAAGG + Intronic
1099336902 12:81373103-81373125 GTCTATCAAAGGTTAATGTGGGG + Intronic
1104547761 12:129727577-129727599 ATATATCCCAGGTCAGAGAGAGG + Intronic
1104559750 12:129833054-129833076 GCATCTTCAAGGTCAAAGTCTGG - Intronic
1107392671 13:39983277-39983299 ATATATCCAAGGACAAAGGCAGG + Intergenic
1110959361 13:81601697-81601719 GGAAGTCCAAGGTCAAAGGGTGG - Intergenic
1112630148 13:101152082-101152104 GTATATCCAAGGTCAAAGTGGGG + Intronic
1119876516 14:78064379-78064401 GGAAATCCAAGATCAAGGTGAGG - Intergenic
1120520596 14:85523434-85523456 CCTTATCCAAGGTCACAGTGAGG - Intergenic
1120536993 14:85708756-85708778 ATTTATCCAAGGTCAAGGAGAGG + Intergenic
1120597217 14:86455922-86455944 GTATATCCATGGTCCTATTGTGG - Intergenic
1123708282 15:22966498-22966520 GGACATCCAAGATCACAGTGTGG - Intronic
1127390286 15:58499774-58499796 GTATAGCCCTGGTCTAAGTGAGG + Intronic
1130336532 15:82961577-82961599 GTATATCCAAGAACCAACTGAGG - Intronic
1130929054 15:88408612-88408634 AGATGTCCAAGGTCAAGGTGGGG + Intergenic
1135907714 16:26528483-26528505 GTACACCCAAGGTCATTGTGGGG + Intergenic
1137893079 16:52182557-52182579 CTAAATCCAAGGAAAAAGTGTGG - Intergenic
1141616479 16:85212598-85212620 GGAAGTCCAAGGTCAATGTGTGG - Intergenic
1142916277 17:3141778-3141800 GATTCTCCAAGGTCAAAATGAGG - Intergenic
1143626986 17:8116156-8116178 GGATATTCTAGGTCAAAGTGAGG - Intronic
1144752587 17:17659703-17659725 GGAAGTCCAAGATCAAAGTGTGG - Intergenic
1147854389 17:43467880-43467902 GTGTATCCCAGGTCACAGGGTGG - Intergenic
1152291379 17:79441949-79441971 GGATTTCCAAGGTCAAGGCGGGG - Intronic
1152507039 17:80756292-80756314 GGAGGTCCAAGGTCAAAGAGTGG - Intronic
1156114925 18:33776245-33776267 GTTTTAGCAAGGTCAAAGTGAGG - Intergenic
1160458554 18:79019923-79019945 GGAAGTCCAAGATCAAAGTGTGG - Intergenic
1167598862 19:50442065-50442087 GGCTCTCCAAGGTCAAAGTGAGG - Intronic
925678175 2:6388397-6388419 CTATCTCCAAGGTCCAGGTGTGG + Intergenic
934623064 2:95827675-95827697 GGTTTTCCAAGGTCAAAATGAGG - Intergenic
936282207 2:111152059-111152081 GTGTATTCAGGATCAAAGTGGGG + Intronic
939032293 2:137091562-137091584 GTATATCCAAGATCAAGGTGGGG + Intronic
946160491 2:217832795-217832817 GGACATCCAAGGACAGAGTGAGG - Intronic
1170707864 20:18761727-18761749 GTTTCTCAAAGGTCAATGTGGGG + Intronic
1170890453 20:20370933-20370955 ATATTTTCAAAGTCAAAGTGTGG + Exonic
1175587514 20:60155289-60155311 GAAAATCAAAGGTCAAAGTTTGG - Intergenic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
949594857 3:5532681-5532703 GTATTTCCCAGGGCAATGTGAGG + Intergenic
950078554 3:10205183-10205205 GTATGTCCAAGGGCAGAGAGAGG - Intronic
952596421 3:35024150-35024172 GTAAATCAGAGGTTAAAGTGTGG - Intergenic
952995973 3:38882713-38882735 TTATATGCATGGTCAAAGTGTGG - Intronic
956055037 3:65289767-65289789 CTATATCCAAGGTCTATGTTGGG - Intergenic
960587050 3:119329672-119329694 CTGTATCCAAGGTTACAGTGGGG + Intronic
962035375 3:131645912-131645934 CTTTCTCCAAGGTCAAGGTGAGG - Intronic
962068288 3:132006753-132006775 GGATTTCCAAGGTCACAATGGGG + Intronic
964822805 3:160792149-160792171 GTAGATTAAAAGTCAAAGTGAGG + Intronic
970233466 4:13934254-13934276 GTGTATCCAAGGGCAAAGCTTGG + Intergenic
970233632 4:13936279-13936301 GTGTATCCAAGGGCAAAGCTTGG + Intergenic
971674503 4:29608140-29608162 GTATATACAAGGTTAATTTGAGG - Intergenic
973606581 4:52593254-52593276 ATAAATCCCAGGACAAAGTGAGG + Exonic
974734207 4:65908352-65908374 GTCTCTCCATGGTCAAATTGAGG - Intergenic
975471923 4:74779616-74779638 GATTATCCAAGTGCAAAGTGAGG + Intronic
975787315 4:77905606-77905628 GAATATACAAGGTCAAAGGAAGG + Intronic
977798121 4:101192828-101192850 GAATATCCAAGGTCTAGGTAAGG - Intronic
980980548 4:139651028-139651050 GTAAGTCCAAGATCAAGGTGTGG - Intergenic
982541416 4:156676518-156676540 TTCTATGCAAGGTCAAAGTTAGG - Intergenic
987414425 5:17648117-17648139 ATATAGCAAAAGTCAAAGTGTGG + Intergenic
988214274 5:28250929-28250951 GCATATGCAATGCCAAAGTGAGG + Intergenic
989139395 5:38188493-38188515 GCATTTCCAAGGGCAAAATGTGG - Intergenic
991151091 5:63371304-63371326 GTATATGTAAGGTCAAATTTGGG + Intergenic
991247708 5:64525495-64525517 GAATATCCACAGTCATAGTGGGG - Intronic
997145944 5:131433343-131433365 GGAGGTCCAAGGTCAAGGTGGGG + Intronic
998657935 5:144203411-144203433 GAATATCTAAGGTTAAAATGAGG + Intronic
998820134 5:146050550-146050572 AAATATCCAAGGGCAAACTGAGG + Intronic
999445799 5:151638251-151638273 GCAGAGCCAAGGTCAAAGGGTGG - Intergenic
999893873 5:156007720-156007742 GTAAACCCAAAGTCTAAGTGGGG + Intronic
1004136603 6:12973216-12973238 TTATGTTCAAGGTCAAAATGTGG - Intronic
1009627372 6:66152703-66152725 ATCTATCTAAGGTGAAAGTGGGG - Intergenic
1011031956 6:82933001-82933023 GTGTATCCAGGGTCAAATTCAGG + Intronic
1012493038 6:99803685-99803707 GTATATTTAAGGGCAAAGTCTGG + Intergenic
1016059144 6:139610403-139610425 GTGGATCCAAGGTCAAAGGAGGG + Intergenic
1017678731 6:156842006-156842028 GAATATTCAATGTCAAAATGAGG - Intronic
1021104953 7:16627319-16627341 GTTTATGGAAGATCAAAGTGTGG - Intronic
1023317218 7:38951774-38951796 GGAAATCCAAGATCAAAATGTGG - Intergenic
1026815785 7:73510468-73510490 GTACTTACAAGGTCAAAGTATGG + Intronic
1028049085 7:86159845-86159867 GATTCTCCAAGGTCAAAATGCGG + Intergenic
1029989509 7:104950193-104950215 TGATGTCCAAGGTCAAGGTGTGG + Intergenic
1031109454 7:117588855-117588877 GTATTTCCAAGATCAAAGCATGG - Intronic
1031867025 7:127048692-127048714 GTCCATCCAAGGTCAAAGGTTGG + Intronic
1032270385 7:130399488-130399510 GTATATCTCAGGTAAAATTGAGG - Intronic
1036787052 8:11694979-11695001 GTATATACAAGTCCAGAGTGTGG + Intronic
1039194270 8:35013606-35013628 GCAAATCCAAAGTCAAAATGTGG - Intergenic
1039224660 8:35375337-35375359 GTATAGCAAAGATCAACGTGTGG - Intronic
1039415180 8:37387115-37387137 GGATGTCCAAGATCAAGGTGTGG - Intergenic
1039814696 8:41082790-41082812 TTATATCCAAATTCCAAGTGAGG + Intergenic
1042356559 8:67834914-67834936 GGAAGTCCAAGATCAAAGTGTGG + Intergenic
1043708312 8:83380522-83380544 GCAGCTCCAAGGTCAGAGTGGGG - Intergenic
1043718936 8:83519533-83519555 GTATATCCTAGAGCAAAGTTAGG + Intergenic
1045719632 8:105093083-105093105 GGAAGTCCAAGGTCAAGGTGTGG - Intronic
1047450269 8:124959119-124959141 GGAAATCTAAGGTCAAGGTGTGG + Intergenic
1048193167 8:132308769-132308791 GTATCTCCATTGTTAAAGTGGGG - Intronic
1051894289 9:21971603-21971625 GTATATCCAAGCGCAGAATGTGG + Intronic
1052262124 9:26529209-26529231 GTATATCCTTGGGCATAGTGGGG - Intergenic
1052829508 9:33203334-33203356 ATGTATCCAAGGAGAAAGTGAGG + Intergenic
1052901811 9:33799902-33799924 TTCTATCCCAGGTCAGAGTGGGG - Intergenic
1055530599 9:77178771-77178793 GAATTTCCCAGGCCAAAGTGAGG + Intronic
1059923303 9:119181393-119181415 AAATATCCAAGGTCAAATAGGGG - Intronic
1185822316 X:3217537-3217559 GAACGTCCAAGATCAAAGTGTGG + Intergenic
1187770536 X:22690899-22690921 GCACCTCCAAGGTCAAAGTCTGG + Intergenic
1189368929 X:40412454-40412476 TTATCTTCAAGGTCAAAGTGAGG + Intergenic
1200731843 Y:6751349-6751371 GATTCTCCAAGGTCAAAATGAGG - Intergenic