ID: 1112630151

View in Genome Browser
Species Human (GRCh38)
Location 13:101152129-101152151
Sequence CTGAAGCCACAGATAGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 344}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112630149_1112630151 18 Left 1112630149 13:101152088-101152110 CCAAGGTCAAAGTGGGGTTTTCA 0: 1
1: 0
2: 1
3: 15
4: 135
Right 1112630151 13:101152129-101152151 CTGAAGCCACAGATAGAAATTGG 0: 1
1: 0
2: 1
3: 33
4: 344
1112630144_1112630151 28 Left 1112630144 13:101152078-101152100 CCCAGTATATCCAAGGTCAAAGT 0: 1
1: 0
2: 0
3: 13
4: 119
Right 1112630151 13:101152129-101152151 CTGAAGCCACAGATAGAAATTGG 0: 1
1: 0
2: 1
3: 33
4: 344
1112630145_1112630151 27 Left 1112630145 13:101152079-101152101 CCAGTATATCCAAGGTCAAAGTG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1112630151 13:101152129-101152151 CTGAAGCCACAGATAGAAATTGG 0: 1
1: 0
2: 1
3: 33
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112630151 Original CRISPR CTGAAGCCACAGATAGAAAT TGG Intronic
901433570 1:9233193-9233215 AGGAAGGCACAGATAGAAGTGGG - Intergenic
901832423 1:11900748-11900770 CAGATGCCACAGGTAGAAATAGG - Intergenic
903016890 1:20367093-20367115 AGAAAGCCACAGAAAGAAATAGG + Intergenic
903713839 1:25347766-25347788 CAGAAGCCACTGATAGCAAAGGG + Intronic
905695415 1:39969961-39969983 CTGAGGACACAGACAGAAACAGG - Exonic
905903823 1:41602551-41602573 CTGATGCCACAGAAATAAAAAGG - Intronic
907782085 1:57576476-57576498 GTGAAGGAAGAGATAGAAATTGG + Intronic
907912914 1:58842296-58842318 ATGAAGACAGAGATAGACATTGG - Intergenic
908392560 1:63696873-63696895 CAGATTCCACAGATAGATATGGG - Intergenic
908574467 1:65444384-65444406 TTTAAGCTACAGAAAGAAATAGG - Intronic
908769960 1:67586984-67587006 CTGAAGTTAGAGAGAGAAATGGG - Intergenic
908954320 1:69603084-69603106 GTGAAGACAGAGCTAGAAATTGG - Intronic
909233477 1:73121042-73121064 CTGAATCAACAGAAAAAAATGGG + Intergenic
909603933 1:77489838-77489860 CTGGAGCCAAAGATTGACATGGG - Intronic
912774756 1:112498684-112498706 ATGAGGCCTCAGATGGAAATGGG - Intronic
914001502 1:143698619-143698641 CTGGCGCCAGAGATAGAAAGAGG + Intergenic
918150849 1:181797110-181797132 CAGAAACCAGAGATATAAATAGG + Intronic
919637142 1:200013899-200013921 CGGCAGCGACAGAAAGAAATAGG + Intergenic
920072329 1:203311377-203311399 CAGAAGCTACAAATAAAAATGGG - Intergenic
920097140 1:203493689-203493711 CAGAATCCAAAGATAAAAATAGG - Intergenic
920350608 1:205335682-205335704 CTGAAGTAACAGATAGAAACAGG - Intergenic
920591909 1:207228309-207228331 CTGAAACCAGAGACAGAAAATGG + Intergenic
920706103 1:208251717-208251739 CTGCAGCCCCAGAGAGAAAGAGG - Intergenic
922403560 1:225286915-225286937 CTCAAGCCACAAAAAGACATGGG + Intronic
924444066 1:244112295-244112317 CTGAAGCCACAGTGAGAAAACGG + Intergenic
924597462 1:245459916-245459938 CTGCAGCCTAAGATAGAATTAGG + Intronic
924664373 1:246055519-246055541 CTGAAAGCACAGATTCAAATAGG + Intronic
1063982579 10:11466855-11466877 GTGAATCTAAAGATAGAAATGGG + Intronic
1065130779 10:22617833-22617855 CTCAAGACACAGATTGAAAAAGG + Intronic
1065447714 10:25820619-25820641 CTAAAACCACATATTGAAATTGG - Intergenic
1067719840 10:48719988-48720010 CTGAAGCAACAGATGGGACTTGG - Intronic
1068210686 10:53915996-53916018 CTGAAGTCCCTGATAGAAAATGG + Intronic
1068838495 10:61583075-61583097 ATGAAGCTACTGGTAGAAATAGG - Intergenic
1071182309 10:83001389-83001411 CTGAAGCCACGAATAGACTTGGG + Intergenic
1072058260 10:91782473-91782495 GTGAAGTCCCAGATATAAATGGG - Intergenic
1074478231 10:113792789-113792811 CTAAAGACGCAGAAAGAAATGGG + Intergenic
1075267579 10:121016460-121016482 TTGAATCCACAGATAAAACTGGG - Intergenic
1077063627 11:628134-628156 CTGAATCCACAGACAGAAAGTGG - Intergenic
1078105028 11:8353064-8353086 CTGATGCCACAGGTAGATCTAGG - Intergenic
1078504709 11:11926492-11926514 CTGAAGCCACAAAAATAAAAAGG - Intronic
1079120470 11:17680485-17680507 CTGAAGGCACAGACTGAGATTGG - Intergenic
1079326555 11:19497720-19497742 CTAAAGCCACAGACAGAAAATGG + Intronic
1079837766 11:25355605-25355627 CAGAAGCCAAATTTAGAAATGGG + Intergenic
1080328905 11:31112656-31112678 CTGAAGAAACATGTAGAAATAGG + Intronic
1080799802 11:35599649-35599671 CAGAACCCACAGATAGAGAGGGG - Intergenic
1081280895 11:41208530-41208552 CTGAAGACAGAAATAGCAATGGG + Intronic
1081539645 11:44022709-44022731 ATGAAGCAACAAATAAAAATAGG - Intergenic
1083067280 11:59938359-59938381 CTGAAGCCACACATAGGTGTGGG - Intergenic
1083557589 11:63643893-63643915 CTAAAGACACATATAGAACTTGG + Intronic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1086238499 11:84660832-84660854 AGGAAGTCACAGAAAGAAATAGG - Intronic
1087482787 11:98722261-98722283 CTGAAGCCACATATAACAAATGG + Intergenic
1088363484 11:109016009-109016031 CTGAAGAGACAAAGAGAAATGGG - Intergenic
1089192407 11:116662490-116662512 CTGAATCCACAGCTAGCAACAGG + Intergenic
1091091022 11:132771462-132771484 CTGAAGGCACAAAAAGGAATAGG + Intronic
1091865042 12:3826158-3826180 CTGAAAGCACTGATAGAAAAGGG + Exonic
1092593270 12:9971388-9971410 CTGAAGCCACAGATGAGATTTGG + Intronic
1094075233 12:26465158-26465180 CAGAAGCCAGAGAAAGAAATAGG + Intronic
1094527826 12:31244312-31244334 CTGAAGGCAAAGAAAGAACTAGG + Intergenic
1095377228 12:41544921-41544943 AAGAAGCCACAGAGAGAACTTGG - Intronic
1095856876 12:46869928-46869950 ATGAAGACAGAGATAGAGATTGG - Intergenic
1096439781 12:51631198-51631220 CAGATGGCACAGATAGAAAAGGG - Intronic
1096449092 12:51722087-51722109 CTGAAGAGAGAAATAGAAATAGG - Intronic
1097761567 12:63471964-63471986 CTGAACCTACATTTAGAAATTGG + Intergenic
1098320764 12:69240387-69240409 TTGGAGCCACAGATAAAAGTCGG + Intronic
1098624558 12:72647601-72647623 CTGATGCCACAGACATAAAGAGG + Intronic
1099751750 12:86782794-86782816 GTGAAGACACAGTCAGAAATTGG + Intronic
1100502575 12:95188266-95188288 CTGAAGGCACAGAAAAAAAATGG + Intronic
1101041146 12:100757106-100757128 CAGAAGGGACAGATAAAAATTGG + Intronic
1101742006 12:107507883-107507905 CTGATGGCACAAACAGAAATTGG - Intronic
1104173839 12:126309702-126309724 CTGAAGCCAGAGATGGTAAGTGG - Intergenic
1104181892 12:126389844-126389866 CAGAAGCAACAGACAGGAATTGG - Intergenic
1104404272 12:128504599-128504621 GTGAAGACACAGAGAGAAAGTGG - Intronic
1104510116 12:129369770-129369792 CTGAAGCTACAAATAGGAAAAGG + Intronic
1105318443 13:19291019-19291041 CTGAAGTCTCACAGAGAAATGGG + Intergenic
1105698415 13:22914518-22914540 CTTCAGCCATAGAAAGAAATGGG + Intergenic
1105850075 13:24326757-24326779 CTTCAGCCATAGAAAGAAATGGG + Intergenic
1105941163 13:25149257-25149279 CTGAAGCTACACAAAGAAAAGGG - Intergenic
1106011070 13:25823946-25823968 CTGAAACCACACGTAGAGATAGG - Intronic
1106656656 13:31753901-31753923 TGGAAGCCACAGAGAGAAAAGGG + Intronic
1108103016 13:46978243-46978265 CTGATGCCACAGAAACAAAAAGG + Intergenic
1108381130 13:49855481-49855503 GTAAAGACAGAGATAGAAATTGG + Intergenic
1109456639 13:62601220-62601242 CTGATGCCACAGAAATAAAAAGG - Intergenic
1110189849 13:72717695-72717717 GTGAAGACCCAGATGGAAATGGG - Intronic
1110312751 13:74070051-74070073 TTGAAGCCGCAGAAATAAATGGG + Intronic
1110597735 13:77337692-77337714 CTGAAGACTCACATAGATATGGG + Intergenic
1110785690 13:79523028-79523050 CTGAAGCCATTTATTGAAATAGG - Intronic
1110817202 13:79875280-79875302 CTGAGGGCACAGATAGACTTGGG - Intergenic
1111625941 13:90786977-90786999 ATGAAGCCTCATGTAGAAATGGG + Intergenic
1112630151 13:101152129-101152151 CTGAAGCCACAGATAGAAATTGG + Intronic
1113812480 13:113151005-113151027 CCGAAGCCCCATCTAGAAATAGG + Intergenic
1114708190 14:24749073-24749095 CGGAAGGCAAAGATAGAAAAAGG + Intergenic
1115076037 14:29391704-29391726 CTGAAGACACACTTAGTAATTGG - Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1117268719 14:54118271-54118293 CTAAAGTCACAGGTAGAAAAAGG + Intergenic
1117361800 14:54982591-54982613 GTGAAGCCACAGATAAGAAAAGG - Intronic
1117676824 14:58163795-58163817 GTGAAGTCACAGAGAGAAAGTGG + Intronic
1117810821 14:59544862-59544884 GTGAAGACACAGAGAGAAAGCGG + Intronic
1117825204 14:59694833-59694855 GAGAAGCCACAGAAAGAAAAAGG + Intronic
1118165002 14:63327589-63327611 CAGGAGCCACAGGCAGAAATGGG - Intergenic
1118637999 14:67765795-67765817 CTGAAGTCACAGTTTGAATTTGG + Intronic
1119267522 14:73272252-73272274 CTGAGGCCACAAATAATAATGGG + Intronic
1119751567 14:77082038-77082060 CAAAAGACAAAGATAGAAATGGG - Intergenic
1120081296 14:80219373-80219395 CTGGGGCTACAGATAGAAAACGG - Intronic
1120498905 14:85269676-85269698 GTGAAGACACAGCAAGAAATTGG - Intergenic
1120537465 14:85714542-85714564 CTGGAGAGACAGATAGATATTGG + Intergenic
1121365317 14:93303787-93303809 TTGAAGCAACAGATGGAAAATGG + Intronic
1122840022 14:104454731-104454753 CTTCAGCCATAGAAAGAAATGGG + Intergenic
1123114656 14:105889276-105889298 CAGAAGGCACTGAAAGAAATCGG - Intergenic
1123116817 14:105898677-105898699 CAGAAGGCACTGAAAGAAATCGG - Intergenic
1123118872 14:105907951-105907973 CAGAAGGCACTGAAAGAAATCGG - Intergenic
1123121101 14:105917546-105917568 CAGAAGGCACTGAAAGAAATCGG - Intergenic
1123959576 15:25382775-25382797 CTGCTGCCACAGAAATAAATAGG + Intronic
1125830278 15:42710842-42710864 GTGAAGACAGAGATAGAAATGGG - Intronic
1126153224 15:45541702-45541724 TTGAAGCCACTTTTAGAAATTGG + Intergenic
1126195126 15:45922847-45922869 CTGCAGCCACAGAAAAAGATTGG - Intergenic
1128752518 15:70159461-70159483 CTCATGCCTCAGATGGAAATGGG + Intergenic
1128875281 15:71196532-71196554 CTAAAGCCACAGCTACAAAGTGG - Intronic
1129157645 15:73728739-73728761 CTGAAGCCAGAGTTAGGATTAGG + Intergenic
1129267570 15:74402232-74402254 GTCAAGCCAGAGAGAGAAATAGG + Intergenic
1129356573 15:74995900-74995922 CGGGAGCCACAGATGGGAATGGG - Intronic
1129815524 15:78549561-78549583 ATGAAGCCACAGATAGCCAAGGG - Exonic
1130045652 15:80442636-80442658 ATGAAGCCAGAGCTAGAAGTAGG + Intronic
1130087118 15:80787070-80787092 CAGAAGCCACAGCTAAAAATTGG - Intronic
1130317136 15:82806149-82806171 CTGCAGCCACAAATAGCAACAGG + Intergenic
1131187259 15:90285518-90285540 CTGAACCCACAGAAAGATGTGGG - Intronic
1131726314 15:95229475-95229497 ATGAACCCACAGAGAAAAATAGG - Intergenic
1132371767 15:101304546-101304568 CTGAAGACACAGACAGAACACGG + Exonic
1132845148 16:1997592-1997614 CTGAAGCCAAATTTAGAAACAGG - Intergenic
1133866210 16:9645985-9646007 TTGAAACCACACATATAAATAGG - Intergenic
1134781772 16:16904513-16904535 ATGAAACCACTAATAGAAATTGG - Intergenic
1135948297 16:26885779-26885801 CTGCAGCTAGAGATAGAAATAGG + Intergenic
1136090662 16:27917561-27917583 CTGAAGCCAGAGACAGCAACTGG + Intronic
1137225225 16:46498525-46498547 CTGAAGTCTCAGAAAGAAATGGG + Intergenic
1137512617 16:49114862-49114884 CATGAGTCACAGATAGAAATGGG - Intergenic
1137857321 16:51807765-51807787 CAGAAGCCAGAAATAGAAAAGGG - Intergenic
1138903423 16:61302021-61302043 CAGAAGCCAGAAATAGACATGGG + Intergenic
1139174665 16:64672385-64672407 CTGAAGGCACAATTAGAAATGGG - Intergenic
1139616062 16:68093085-68093107 CTGAAGTAACAGATATAAAATGG - Intronic
1140724450 16:77799381-77799403 CTTAAGCCAGAGAGAGAAAGAGG - Intronic
1141538294 16:84699219-84699241 CTGAAATCACAGCTAGAAAAGGG + Intergenic
1142793427 17:2288002-2288024 CTGAAGCTACACTTAAAAATGGG + Intronic
1144397925 17:14863277-14863299 ATCACACCACAGATAGAAATTGG + Intergenic
1144410133 17:14992820-14992842 ATAAAGCCAAAGAAAGAAATGGG - Intergenic
1146629748 17:34461222-34461244 AGGAAGCAAAAGATAGAAATGGG + Intergenic
1147219523 17:38920219-38920241 CTGTAGCCCCAGACAGAGATGGG - Exonic
1148330851 17:46813126-46813148 ATGGAGCCACAGAAAGAAACGGG + Intronic
1148650913 17:49249493-49249515 CTGCTGTCACAGATAGCAATTGG + Intergenic
1148801003 17:50225794-50225816 CTGAAGCCACAGCTATACCTTGG + Intergenic
1148956058 17:51354715-51354737 CTGAATCCAGAGGTAGAAAATGG - Intergenic
1150883409 17:69057730-69057752 CAGAACCCACAAATACAAATGGG - Intronic
1151920942 17:77155105-77155127 GTGAAGCCACAGGTTTAAATGGG - Intronic
1156647573 18:39184797-39184819 CTGGTGCCACAGATAGCACTGGG - Intergenic
1157598898 18:48880724-48880746 CTGTAGCCAGAAGTAGAAATTGG - Intergenic
1157659881 18:49431755-49431777 CTGAAGCCACGGTCAGAATTTGG + Intronic
1158529023 18:58241465-58241487 CTGAAGGCACACATAGAACCGGG - Intronic
1158545537 18:58393146-58393168 CTGAAGTCACAGAGAAACATGGG - Intronic
1158634048 18:59140390-59140412 CTGAAGCCCCACAGAGAAATCGG - Intronic
1158765905 18:60449112-60449134 CTGAAGTCTCAGATGGAAATTGG - Intergenic
1159226938 18:65551901-65551923 GTGAAGCCACAGCTGGAAATAGG - Intergenic
1159312406 18:66726209-66726231 CTGCAGCCAGAAAGAGAAATAGG + Intergenic
1160391862 18:78540118-78540140 AGGAAGCCACAGAGAGCAATTGG + Intergenic
1161242503 19:3230172-3230194 CTGAGGCCAGAGCTAGACATTGG + Intronic
1161966571 19:7552235-7552257 CTGAAGCCACAGGCTGAAACAGG - Intronic
1164014039 19:21236159-21236181 CTGGACACACAGATAGAAAAGGG + Intronic
1164812457 19:31168489-31168511 CTGGAGCCAAAGCTAGAAATTGG + Intergenic
1166032396 19:40142088-40142110 CCAAAGACACAGACAGAAATAGG + Intergenic
1166374519 19:42320161-42320183 CAGAAGCCAGAGACTGAAATGGG - Intronic
1166792821 19:45408116-45408138 TTGAAGCTACAGAGAGAAACAGG - Exonic
1166914786 19:46187984-46188006 CTGTAACCTCAGATACAAATGGG - Intergenic
926464768 2:13174877-13174899 CTGATGCCACAGATATTAAGAGG - Intergenic
926609497 2:14931686-14931708 CTGAAGCCACTGGAAGAAAGTGG - Intergenic
926759688 2:16267199-16267221 CTCAAGTCCCAGATAGAAAGTGG - Intergenic
927098251 2:19764444-19764466 CTGGAGCCCCAGATGGACATGGG + Intergenic
928983633 2:37159393-37159415 GTGAAGGCACAGGTAGAGATAGG - Intergenic
930068099 2:47343181-47343203 CTCAGGACACAGATAGAATTTGG + Intergenic
931175194 2:59847367-59847389 CTGATTCCACAGCTGGAAATTGG - Intergenic
932894449 2:75625512-75625534 TTGAAGCCAAAGATAGGAATAGG + Intergenic
933476457 2:82798141-82798163 TTGAGGCCACAGAAAGAATTGGG + Intergenic
933478378 2:82821253-82821275 CTTAAGACACATATTGAAATGGG + Intergenic
937535142 2:122877046-122877068 CTGAAGGAACAGATAGATGTGGG + Intergenic
937648776 2:124297047-124297069 CTGATGCCAGAGAAAGTAATAGG - Intronic
937921075 2:127131316-127131338 GTGAAGGCACAGAGAGAAAACGG + Intergenic
938316764 2:130334974-130334996 CAGAAGCCAGAAATAGAGATGGG + Intergenic
938677161 2:133649064-133649086 CTGATGCCACAGAAATAAAAAGG + Intergenic
939314370 2:140528841-140528863 TTGAAGCAACAGAGAGAAAGAGG - Intronic
940277254 2:151952310-151952332 TTGAAGAGACAGCTAGAAATAGG + Intronic
941974511 2:171388113-171388135 CTTAAGTAACTGATAGAAATAGG - Intronic
945646329 2:212499869-212499891 CTGAAGACACAGAAAAGAATAGG + Intronic
946345554 2:219107638-219107660 CTGAAGACAGAGAGAGAAGTGGG - Intronic
946520047 2:220454569-220454591 TTCATGACACAGATAGAAATGGG + Intergenic
947986982 2:234456682-234456704 TTTAAGCTACAGAAAGAAATGGG + Intergenic
948074882 2:235158289-235158311 CTGAAGCAAGAGACAGAGATGGG - Intergenic
948182386 2:235992464-235992486 CTGAATCCTCAGAAAGGAATGGG - Intronic
948314009 2:237013176-237013198 CAGAAGGCAGAGACAGAAATGGG + Intergenic
1169469457 20:5871679-5871701 CTGAAACCACAGACAGGCATAGG + Intergenic
1170508063 20:17049041-17049063 AGGCATCCACAGATAGAAATTGG + Intergenic
1172053837 20:32140419-32140441 CTGAAGACACAGAGATAAATAGG + Intronic
1173008778 20:39161839-39161861 CTGATGCCACAGACATAAAAAGG - Intergenic
1173220887 20:41132179-41132201 TTGGAGCCACAGATAGATTTGGG + Intergenic
1174991411 20:55514635-55514657 CTGAAACCACAAAGTGAAATAGG + Intergenic
1175474418 20:59260783-59260805 CTGTGGCCACAGACAGAACTGGG - Intergenic
1179171085 21:38973300-38973322 CAGTAGACACAGAAAGAAATGGG + Intergenic
1179340262 21:40501417-40501439 CTCAAGACACAGATTGAAAAGGG - Intronic
1179501353 21:41811078-41811100 CTGAAAACACAGACAGAAAGTGG + Intronic
1180878289 22:19185636-19185658 ACAAAGCCACAGATAGAAAGTGG - Intronic
1181737713 22:24894710-24894732 CAGATGCCACAGAGAGAAAGCGG + Intronic
1182589677 22:31369334-31369356 CTGAAGCCCCAGAAAAAACTGGG + Intergenic
1182600387 22:31458696-31458718 CTGAAGCCACAGAGGGACACTGG - Intronic
1182862988 22:33576978-33577000 CAGAACCCACAGATATAGATAGG + Intronic
950086965 3:10265892-10265914 GTGAAGCCGCAGATGAAAATAGG - Intronic
951318061 3:21210747-21210769 CTGATGCCACAGAAATAAAAAGG - Intergenic
952299061 3:32087831-32087853 CTGAACAGACAGATAGAAAAGGG - Intergenic
952901340 3:38113763-38113785 GTGAAGACCCAGATATAAATGGG - Intronic
954153375 3:48670967-48670989 CTGAAGCTGCAGCTAGGAATGGG - Intergenic
955531434 3:59876872-59876894 CCTAAGCCACTGATAGGAATAGG + Intronic
957165259 3:76664110-76664132 CTGAGGACACAGCTAGAATTAGG + Intronic
957401338 3:79718660-79718682 GTGCAGCCACAAATAGAAAATGG + Intronic
958191207 3:90187242-90187264 CTTAAGCCACAGATATAAAGTGG + Intergenic
958413402 3:93846362-93846384 CTTAAGCCACACATATAAAGTGG + Intergenic
958648116 3:96899267-96899289 ATGAAGACACAGATATACATAGG - Intronic
959027882 3:101262213-101262235 CTGAAGCTAAATATATAAATTGG + Intronic
959765038 3:110016255-110016277 CTGCAGCCACCAATAGAAAATGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960134978 3:114095664-114095686 CTGAGACCACAAATAGAAAGAGG - Intergenic
961341128 3:126220530-126220552 CTGATGCCACAGAAATAAAAAGG + Intergenic
962185537 3:133255278-133255300 CTGAAACAAAAGATGGAAATAGG + Intronic
963361148 3:144273502-144273524 CAAAAGCAACAGACAGAAATTGG - Intergenic
963568988 3:146968305-146968327 CAGAAGCCAAAAATAGAGATGGG + Intergenic
966470472 3:180283296-180283318 TAGAAGCCAGAGATAGAGATGGG - Intergenic
966998041 3:185303635-185303657 CTGATGCCACAGAAATAAAAAGG - Intronic
967863245 3:194169366-194169388 CTGAACCCACAGAAAGAGAATGG - Intergenic
968285117 3:197504049-197504071 CTAGAGGCACAGACAGAAATGGG - Intergenic
969831399 4:9800451-9800473 GTGAAGCCACAGAAAGAAAGTGG + Intronic
970172847 4:13306450-13306472 CTCAAGCCACAGAAAGAAGGTGG + Intergenic
971421387 4:26476880-26476902 GTGAAGCCACCGATAGAAGAGGG - Intergenic
971836088 4:31764507-31764529 TTGAAGCAACAGATAGAATGTGG + Intergenic
972444951 4:39135219-39135241 CTGAAGGCACAGAAAGCAGTAGG + Intergenic
973043761 4:45509021-45509043 CTGATACCACAGATATAAAAAGG - Intergenic
973578115 4:52313184-52313206 CTGAAGCCAGAGTGAGAACTTGG + Intergenic
973750344 4:54011729-54011751 CAGAAGCCACACATAGAGACTGG + Intronic
973858589 4:55038269-55038291 CTGAAACAAGAGCTAGAAATGGG - Intergenic
974235076 4:59170348-59170370 CTGAAGAGACAGAGAGAAACAGG + Intergenic
974442159 4:61933232-61933254 CTGAAGCCAAACAGAGAACTTGG - Intronic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
974663920 4:64933408-64933430 CTGATGCCACAGAAATAAAAAGG + Intergenic
974734563 4:65912768-65912790 TTGAGGTCTCAGATAGAAATGGG - Intergenic
975249123 4:72156893-72156915 CAGAAGCCAAAAATGGAAATGGG + Intergenic
975365948 4:73527756-73527778 CTGACATCACAGACAGAAATTGG - Intergenic
975794830 4:77996235-77996257 CTGAAGCCACAGGTACCACTTGG - Intergenic
977360092 4:95991968-95991990 CTGATGCCACAGAAATAAAAAGG + Intergenic
977579424 4:98708265-98708287 TTAAATCCAAAGATAGAAATAGG - Intergenic
978433143 4:108654317-108654339 CAGAAAGCAAAGATAGAAATAGG + Intronic
979010232 4:115357646-115357668 CTGAAGACTCAGACAGAGATTGG + Intergenic
979113708 4:116793770-116793792 CTGAAGACACAGGAAGTAATTGG - Intergenic
980705451 4:136487235-136487257 CTGAAGCAACAGAGACAAATGGG + Intergenic
984215268 4:176904664-176904686 CAGAGGCTACAGATAGACATTGG - Intergenic
984478936 4:180274400-180274422 CTGAAGCTACAAAGATAAATGGG + Intergenic
984878036 4:184386738-184386760 CTGCAGCCACACATGGAGATAGG + Intergenic
985722813 5:1499421-1499443 GAGAAGCCACAGCTAGAAAGTGG - Intronic
988724489 5:33912560-33912582 CTGAAGGCAGAGACAGAAATTGG + Intergenic
989001958 5:36770609-36770631 GTGAAGGCACAGAGAGAAAATGG - Intergenic
989007925 5:36835776-36835798 CTGAACCAACATTTAGAAATTGG - Intergenic
989538890 5:42596052-42596074 CTGGTGCTACATATAGAAATAGG + Intronic
990834387 5:60000020-60000042 ATGAAGCCAGAGATACAAAGAGG + Intronic
991259766 5:64654016-64654038 CTGAAACCACATAGAGAAAGAGG + Intergenic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992537925 5:77730297-77730319 ATGAAGACAGAGATAGAGATTGG + Intronic
992663392 5:78983667-78983689 CTGTAGCCAAGGTTAGAAATGGG - Intronic
992810561 5:80383644-80383666 CTCAGGTCACAGAGAGAAATAGG - Intergenic
994542183 5:101113316-101113338 CAGAAGCCAGGAATAGAAATGGG - Intergenic
995288461 5:110419882-110419904 CTGAAGACATTCATAGAAATAGG - Intronic
995766885 5:115628205-115628227 CTGAAGACAAAGATACAGATTGG + Intronic
996308092 5:122073963-122073985 CTCAAGCCTCAGAGAGAAACGGG - Intronic
996993976 5:129672126-129672148 GTGAAGACACAGCTAGAAGTCGG - Intronic
997912049 5:137885038-137885060 CTGAAGCCATTGGTACAAATAGG - Intronic
998340438 5:141413091-141413113 CTGAAGCCACAGAAAGACAAAGG + Intronic
998432890 5:142081774-142081796 CTGCAACCACAGAGAGGAATGGG - Intergenic
999074753 5:148783717-148783739 TTGAAGCCACAGATATTTATAGG - Intergenic
1001283448 5:170405169-170405191 CTCCAGCCACAGAGAGAAAAGGG + Intronic
1002556870 5:180048746-180048768 CTGAAGCTACAGATGGCAAAGGG - Intronic
1002833345 6:844222-844244 GTGAAGCCAGAGCTAGAAGTTGG - Intergenic
1003559743 6:7170723-7170745 ATAAAGCCAGAGTTAGAAATGGG + Intronic
1003850547 6:10218099-10218121 CAGAAGCCACAGAAAGAACTGGG - Intergenic
1005008979 6:21317855-21317877 GTGAAGCCAGAGGTAGTAATCGG - Intergenic
1005126327 6:22450673-22450695 CCAAAACCACAGATAGAGATAGG - Intergenic
1005431079 6:25757646-25757668 CAGAAGCCACAGCTAGCAAGAGG - Intronic
1005486153 6:26301839-26301861 GTGAAACCTCAGATAGAAAGGGG + Intergenic
1006330385 6:33386163-33386185 CTAAAGGTAGAGATAGAAATAGG - Intergenic
1008629099 6:53347439-53347461 CAGAATCTACAGATAGAAACAGG - Intronic
1009528177 6:64774548-64774570 CTTAAGCCACAGATCCACATAGG - Intronic
1009552081 6:65110607-65110629 AAAAAGCCACAGAGAGAAATAGG - Intronic
1010064805 6:71669825-71669847 CTGAAGAAACAGAGAGAGATGGG - Intergenic
1010147823 6:72692616-72692638 CTGTAGGCACAGCTAGGAATGGG + Intronic
1010835157 6:80577594-80577616 CTGAAGGCAAAAATAGAGATTGG - Intergenic
1011489949 6:87881266-87881288 CTGAAGCCACAGATTCAGAGTGG + Intergenic
1011635237 6:89366215-89366237 AAGAAGCCACAGAGAGAAGTGGG + Exonic
1012466479 6:99521717-99521739 CTGCATCCACAGATAAAAGTTGG - Intronic
1013162007 6:107553981-107554003 CTTAAGCCAGAGATAGAAGATGG + Intronic
1014568434 6:122979245-122979267 ATGAACCCACAGAGAAAAATAGG - Intergenic
1014741039 6:125147769-125147791 CTGAAGCCACATGAAGAAAAGGG - Intronic
1015718902 6:136220252-136220274 CTGAAGTCACAGGTAGAAGTTGG - Intergenic
1015741303 6:136457119-136457141 CTGATGCCACAGAAATAAAAAGG + Intronic
1017274863 6:152554321-152554343 CTGTAGTCCCAAATAGAAATAGG - Intronic
1018053034 6:160028217-160028239 GTGAAGACACAGAAAGAAAACGG - Intronic
1018096441 6:160390987-160391009 ATGAAGCCAGAGACAGAGATTGG - Intronic
1019120072 6:169795058-169795080 CTGAAGCCACAGCTACGACTTGG - Intergenic
1020740264 7:12007124-12007146 CTGAACCTACAGATAGAAGGTGG + Intergenic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1021013080 7:15495766-15495788 ATGAAGCCCCAGAGAGAAAGTGG - Intronic
1021021931 7:15610928-15610950 ATGAAGCCACAGATAAAAGTAGG - Intergenic
1024160098 7:46664946-46664968 CCAGAGCCACAGATAGAAAGTGG + Intergenic
1024355593 7:48410711-48410733 CTTATGCCACAGACAGAAATGGG - Intronic
1024453194 7:49573046-49573068 CTGATGCTGCAGATATAAATAGG + Intergenic
1026351329 7:69517971-69517993 CTCATGCCACCAATAGAAATAGG - Intergenic
1026593065 7:71712846-71712868 AGGAAGCCAGAGACAGAAATAGG + Exonic
1027918131 7:84353028-84353050 CTCAAGTCACAGATATAAAATGG + Intronic
1028456352 7:91042109-91042131 CTGAAGCTACAAATAGAGGTAGG + Intronic
1028489786 7:91398557-91398579 CAGGAGCCACAGATAGGCATGGG + Intergenic
1029000657 7:97151311-97151333 CTGTAGCTGCAGAAAGAAATAGG + Intronic
1029309753 7:99651873-99651895 CTGCAGCCACAGATAGGACCAGG + Intronic
1031133234 7:117857840-117857862 CTAATGCCCCAGAAAGAAATTGG - Intronic
1031464117 7:122087292-122087314 ATGAAGCCCCAGAAAGAAAAGGG + Intronic
1033823444 7:145161202-145161224 CAGAAGCCAGAAACAGAAATAGG - Intergenic
1034129957 7:148706580-148706602 CTGAAGACACATACTGAAATTGG + Intronic
1034695596 7:153050355-153050377 CTGAAGAAACAGATATAAATTGG + Intergenic
1035028993 7:155845074-155845096 CTGTGACCACAGATAGAAATCGG - Intergenic
1035839108 8:2791358-2791380 CTGAAGCCCTTGATAGAAAGAGG - Intergenic
1039092400 8:33846175-33846197 CTGAAGCCACAGAGAAAAAAGGG + Intergenic
1039254801 8:35707240-35707262 CTGAAGCAACATAAGGAAATAGG - Intronic
1039596200 8:38792045-38792067 TTGAAGCCACATATAGAAGCAGG + Intronic
1040456195 8:47600395-47600417 CTGATGCCAGAGAGAGAAACAGG + Intronic
1040774040 8:51017292-51017314 CTGATGCCACTGATGGATATGGG - Intergenic
1041294673 8:56342880-56342902 CTGATGCCACAGATATACAAAGG + Intergenic
1041424417 8:57703964-57703986 CTGGAGCCACAGAGAGGGATGGG - Intergenic
1041468368 8:58180651-58180673 CTGAGGCCACAGATAGAGCTAGG - Intronic
1042025804 8:64422447-64422469 CTCAACCCACAGAAAGAAACAGG - Intergenic
1042106242 8:65329463-65329485 CTGAAGACAGAGAAAGAAAGAGG + Intergenic
1042579263 8:70258327-70258349 CTGAAGCTACAAATGAAAATTGG - Intronic
1042657749 8:71118901-71118923 CTTGAGCTACAGAAAGAAATAGG - Intergenic
1044280270 8:90346562-90346584 ATCAAGCCACAGAAAGACATAGG - Intergenic
1045378231 8:101597323-101597345 CTGGAGCCACAGTTAGAAATAGG + Intronic
1045507274 8:102787705-102787727 CTGAAGACAGAGACAGAGATTGG - Intergenic
1045932618 8:107644679-107644701 GTGAAGCCACAGAAAATAATAGG - Intergenic
1045974521 8:108116270-108116292 CTGCAACCACAGAAAGAACTAGG + Intergenic
1046290808 8:112158030-112158052 CTGAAGCCACAGCAAGAATGTGG - Intergenic
1046586582 8:116155617-116155639 CCAAAACCACAGACAGAAATAGG - Intergenic
1047902184 8:129435329-129435351 CAGAAGCCAAAAATAGAGATTGG + Intergenic
1048842809 8:138580094-138580116 CTGAAGGCAAAGAAAGAAACTGG - Intergenic
1050243448 9:3661634-3661656 CAAAAGCCAGAGAAAGAAATGGG - Intergenic
1051195947 9:14563119-14563141 CTGAAAACACAGGTAGAAATGGG + Intergenic
1052031607 9:23635680-23635702 CTGCAGCCACAGATATCAAAAGG + Intergenic
1052978695 9:34431111-34431133 CTGCAGCCATAGAGAGAGATTGG - Intronic
1056790527 9:89622515-89622537 CTGAAGGCAAATAAAGAAATAGG - Intergenic
1057935425 9:99234592-99234614 TTGTAGCCCCAGATAGGAATAGG - Intergenic
1058578280 9:106426442-106426464 GAGAAGCCACAGAGAAAAATGGG - Intergenic
1059370094 9:113823599-113823621 CAGATGCCAAAAATAGAAATGGG + Intergenic
1059625835 9:116065026-116065048 CTGAAGGCACAGGTTCAAATGGG + Intergenic
1062585894 9:137249853-137249875 CTGGAGCCACTCATAGAACTAGG - Intergenic
1186847546 X:13545398-13545420 CTGAAGCCAAAAATATAAATGGG - Intergenic
1187729200 X:22235515-22235537 GTGAGGACACAGAGAGAAATTGG - Intronic
1187792083 X:22962035-22962057 CTGAAGTTACAGATATAAGTAGG - Intergenic
1187992780 X:24893946-24893968 CTGAAGGCAGAGACAGAAAAAGG - Intronic
1188649713 X:32617058-32617080 CTGAATCCACAGACAGAGAAAGG + Intronic
1190928716 X:54930805-54930827 CTGAAGCCAACAATAGAACTGGG - Exonic
1194071905 X:89335397-89335419 CTGATGCCACAGAAATAAAAAGG + Intergenic
1194322868 X:92474082-92474104 ATTGAGCCACAGATAGAGATAGG - Intronic
1194642294 X:96416924-96416946 CTGAGGCCAGAGGTTGAAATTGG - Intergenic
1194733996 X:97490230-97490252 CTGATGCCACAGAAATAAACAGG - Intronic
1195286611 X:103391447-103391469 CTGAAGCCACAGAAATAAAAAGG + Intergenic
1195617326 X:106922593-106922615 CTGAAAGCTCAGATACAAATAGG + Intronic
1195674024 X:107493209-107493231 CCGAAGCAACATTTAGAAATTGG + Intergenic
1196462103 X:115942326-115942348 CTGGATGCACAGAGAGAAATGGG + Intergenic
1197290081 X:124645112-124645134 CTGAAGCAATAGATTAAAATGGG + Intronic
1198022031 X:132668458-132668480 CTGAAGCCAAAGGGAGAGATCGG + Intronic
1200631021 Y:5587561-5587583 ATTGAGCCACAGATAGAGATAGG - Intronic
1200726149 Y:6671126-6671148 CTGATGCCACAGAAATAAAAAGG + Intergenic
1202023876 Y:20499183-20499205 TTACAGCCACAGAGAGAAATAGG - Intergenic
1202113726 Y:21450499-21450521 CTAAATCAACAGATAGTAATGGG - Intergenic