ID: 1112643700

View in Genome Browser
Species Human (GRCh38)
Location 13:101306021-101306043
Sequence GTGAAGAGCCACAATTATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112643700 Original CRISPR GTGAAGAGCCACAATTATAG AGG Intronic
901401437 1:9017604-9017626 GTGAAGAGCCAGAGATAGAGGGG - Intronic
903933038 1:26875004-26875026 GTGAAGAGGCCCAATTATCCCGG - Intergenic
905261490 1:36722250-36722272 AGGAAGAGCCACAATCCTAGAGG - Intergenic
908492185 1:64656596-64656618 GTAAAGAGCCTCAATGTTAGTGG + Intronic
915340008 1:155172143-155172165 GTGAAGAGCCTAAATACTAGAGG - Intronic
921913686 1:220580748-220580770 TTGATAAGCAACAATTATAGGGG - Intronic
1063861660 10:10315486-10315508 ATGAAAAGACACAATTATAAAGG + Intergenic
1067922493 10:50474360-50474382 GTGAAGAACCAGAATTCCAGAGG - Intronic
1080857529 11:36125145-36125167 GTGCAGACCCACAATCATAAAGG - Intronic
1085126331 11:74005055-74005077 GTGAAGAGCCCCAACTTAAGAGG + Intronic
1087784367 11:102338459-102338481 ATGAAGATCCAAAATTACAGGGG + Intronic
1097585328 12:61508547-61508569 GTGAATTGTCACCATTATAGAGG + Intergenic
1101146448 12:101845120-101845142 GTGAAGTCTCACATTTATAGAGG - Intergenic
1103266903 12:119638407-119638429 GTACAGTGGCACAATTATAGCGG - Intronic
1104615620 12:130265798-130265820 GTGAAGAGCCATATTCATGGTGG + Intergenic
1107056087 13:36105222-36105244 GTGAAAAGCCACATTTACAAAGG + Intronic
1108144436 13:47462262-47462284 GTGAACAACCAAAATCATAGAGG - Intergenic
1108516611 13:51209267-51209289 TTGGAGAGGCACAATTAGAGTGG + Intergenic
1112643700 13:101306021-101306043 GTGAAGAGCCACAATTATAGAGG + Intronic
1113649239 13:112023763-112023785 GTGAAGACTCACAATCATGGTGG + Intergenic
1114260149 14:21030755-21030777 GTGAGGAGCCAAAAATATGGAGG + Intronic
1115919703 14:38359115-38359137 GTCAAGACCCAAGATTATAGAGG + Intergenic
1118569818 14:67183145-67183167 AAGAAGAACAACAATTATAGGGG + Intergenic
1120055828 14:79923170-79923192 CTGAAGTGCTAGAATTATAGGGG - Intergenic
1122379797 14:101294719-101294741 GTGAGGCCCCACAATTATGGTGG + Intergenic
1128391213 15:67183984-67184006 GTGAAGAGACCAAATAATAGTGG + Intronic
1129545533 15:76391094-76391116 GTGAAGAGCCAGAAAGAAAGTGG - Intronic
1134500836 16:14768009-14768031 GTGCAGTGGCACAATCATAGTGG - Intronic
1134527362 16:14954548-14954570 GTGCAGTGGCACAATCATAGTGG - Intergenic
1134545027 16:15101723-15101745 GTGCAGTGGCACAATCATAGTGG + Intronic
1134579746 16:15361040-15361062 GTGCAGTGGCACAATCATAGTGG + Intergenic
1134714963 16:16353158-16353180 GTGCAGTGGCACAATCATAGTGG - Intergenic
1134722839 16:16396519-16396541 GTGCAGTGGCACAATCATAGTGG - Intergenic
1134944589 16:18315352-18315374 GTGCAGTGGCACAATCATAGTGG + Intergenic
1134951852 16:18355501-18355523 GTGCAGTGGCACAATCATAGTGG + Intergenic
1135470600 16:22726436-22726458 GTGCAGTGACACAATTATAGAGG + Intergenic
1135886559 16:26314973-26314995 GTTAATATCCAGAATTATAGGGG + Intergenic
1136149782 16:28339903-28339925 GTGCAGTGGCACAATCATAGTGG + Intergenic
1136166018 16:28453707-28453729 GTGCAGTGGCACAATCATAGTGG + Intergenic
1136196953 16:28661313-28661335 GTGCAGTGGCACAATCATAGTGG - Intergenic
1136213292 16:28775436-28775458 GTGCAGTGGCACAATCATAGTGG - Intergenic
1136258026 16:29055353-29055375 GTGCAGTGGCACAATCATAGTGG - Intergenic
1136320467 16:29480956-29480978 GTGCAGTGGCACAATCATAGTGG + Intergenic
1136435040 16:30220296-30220318 GTGCAGTGGCACAATCATAGTGG + Intergenic
1138695188 16:58806547-58806569 GTGAAGACTCACAATTATGGTGG + Intergenic
1139475286 16:67199814-67199836 ATGAAGAGCCAGAGTTATCGGGG - Intronic
1139855072 16:69973685-69973707 GTGCAGTGGCACAATCATAGTGG + Intergenic
1139884789 16:70200818-70200840 GTGCAGTGGCACAATCATAGTGG + Intergenic
1140195815 16:72854507-72854529 GTGAAGAGCCAGAATGGGAGTGG - Intronic
1140367730 16:74394707-74394729 GTGCAGTGGCACAATCATAGTGG - Intergenic
1143590123 17:7880317-7880339 GTGGAGAGACACAAAGATAGAGG + Intronic
1150475014 17:65468278-65468300 GTGATGAGCCACACTTACATAGG - Intergenic
1150767457 17:68013505-68013527 GTGTAGTGGCACAATTGTAGTGG - Intergenic
1151029021 17:70713544-70713566 ATGAGGAGCCAAAATTATTGGGG - Intergenic
1151895569 17:76978304-76978326 GGGAAGACTCACAATCATAGTGG - Intergenic
1155584107 18:27345037-27345059 GCGAAGAGCCAGACTTAGAGTGG - Intergenic
1156648348 18:39194836-39194858 GTTAAGAGTCACACTTACAGGGG + Intergenic
1158086351 18:53656223-53656245 GTTAAGAACCACTACTATAGAGG - Intergenic
1158827165 18:61235692-61235714 TTGAAGAACCTAAATTATAGAGG - Intergenic
1159799771 18:72883668-72883690 GGGAAGCCTCACAATTATAGTGG + Intergenic
1167063443 19:47166221-47166243 GTGCAGAGCCACCAGTATTGTGG + Intronic
926613208 2:14968561-14968583 TTGAATAGCTGCAATTATAGGGG + Intergenic
928033098 2:27798022-27798044 GTGAAGAGTCACCAGAATAGAGG + Intronic
930375675 2:50563573-50563595 GAAAAGAGCCACCATTAAAGTGG - Intronic
930609791 2:53528981-53529003 GTGCAGACCCAAAATTCTAGGGG + Intergenic
933687868 2:85157755-85157777 GTGAAGAGCAAGAATGATGGTGG + Intronic
940714858 2:157209889-157209911 GTACAAATCCACAATTATAGTGG - Intergenic
940930005 2:159416890-159416912 TTGAAGAGCCAAAATAATTGTGG + Intronic
946308155 2:218867840-218867862 GTCAAAAGCCAAAGTTATAGGGG + Intronic
948166799 2:235869261-235869283 GTAATGAGCCCAAATTATAGTGG + Intronic
1170020958 20:11836406-11836428 GTGGAGACCCACCATTACAGGGG + Intergenic
1175425292 20:58861096-58861118 TTGAAGAGCCACAATTTTGCTGG - Intronic
1179569729 21:42271360-42271382 GTGGAGAGCCACACTCAGAGAGG + Intronic
1182077279 22:27503659-27503681 GGGAAGAGCAATAATTATAGAGG + Intergenic
949910410 3:8900709-8900731 CTAAAGAGCAACAATTATATTGG + Intronic
952209937 3:31220110-31220132 GTTGAGAAACACAATTATAGTGG + Intergenic
956014673 3:64869238-64869260 ATGAAGAACCAAAATAATAGTGG + Intergenic
956800649 3:72755026-72755048 GAGAAGAGCCAGGATTCTAGGGG - Intronic
957264332 3:77942165-77942187 GAGAGGAGTCACAATCATAGTGG - Intergenic
957587010 3:82145926-82145948 GGGAAGAGCCACCCTTATATGGG + Intergenic
960003213 3:112754413-112754435 GGGAAGAGTCACAATTATTAGGG - Intronic
961693630 3:128688667-128688689 CTGAAGACCCACAATCAGAGAGG - Intergenic
966515120 3:180811436-180811458 GTGAAGAGCTACAATAATGTAGG - Intronic
970156661 4:13149136-13149158 GAGAAGAAGCACAGTTATAGGGG - Intergenic
972112381 4:35580424-35580446 GTTCAGAGGGACAATTATAGGGG - Intergenic
976420508 4:84838158-84838180 CTGACGAGCCACAATAATAATGG + Intronic
987273092 5:16333293-16333315 GTGAAAACCCACAAATATAGAGG + Intergenic
989584419 5:43063643-43063665 TTTAGGAGCCACATTTATAGGGG - Intergenic
992880190 5:81100658-81100680 GTTAATAGCCATAATTACAGTGG - Intronic
995490010 5:112680895-112680917 GTGAAGAGAGATAATTCTAGGGG - Intergenic
1003459833 6:6319679-6319701 GTGAAGAGTCCCCATTATAGAGG + Intronic
1003952295 6:11127554-11127576 GGGAAGACTCACAATTATGGTGG + Intronic
1005237012 6:23775933-23775955 ATGAAGAGACACTTTTATAGGGG - Intergenic
1010634337 6:78239240-78239262 CTGAAAAACCACATTTATAGGGG + Intergenic
1011385185 6:86788805-86788827 GAGAACAGCCAAAATTATAGGGG + Intergenic
1012627396 6:101420864-101420886 GTTTAGAGGCACAATTAGAGGGG + Intronic
1012860854 6:104557329-104557351 GTGAACAGCCATAATTGTAAAGG - Intergenic
1015264234 6:131274643-131274665 CTGAAGAGGGACAAATATAGAGG - Intronic
1021399589 7:20194478-20194500 GTGAAGAGCCTCACTTAAGGAGG + Intronic
1026220241 7:68390008-68390030 GGGAGGCCCCACAATTATAGTGG + Intergenic
1027651939 7:80879062-80879084 GTGAAGAACCCCAATTGTAGAGG + Intronic
1027769733 7:82391949-82391971 GTGAAGAGTGACACTGATAGTGG + Intronic
1032814753 7:135461704-135461726 CTGAATAGCCATAATTATAGGGG - Intronic
1033543148 7:142375800-142375822 GAGAGGAGCCAGAATTATACAGG - Intergenic
1040880124 8:52195868-52195890 GTGAAATGCCACAATAATGGGGG + Intronic
1042714426 8:71756901-71756923 ATCAAAAGGCACAATTATAGAGG + Intergenic
1043752871 8:83962336-83962358 TTGAAGAGCCAAAATTACTGTGG + Intergenic
1044058396 8:87601365-87601387 CTGAAAAGCCACATTTTTAGAGG + Intronic
1050276974 9:4010173-4010195 ATGGAGAGCCACAGGTATAGAGG + Intronic
1050835093 9:10067310-10067332 GTAAATAGCTACAATTATAATGG + Intronic
1054747411 9:68868804-68868826 GTGAAGAGACTGAAATATAGGGG - Intronic
1059309756 9:113380104-113380126 ATGAAGAGCCACAGATACAGAGG - Intergenic
1059312321 9:113396952-113396974 GGGAAGAGCCACAAAAATGGGGG + Intronic
1059601571 9:115784298-115784320 GGGAAGCTTCACAATTATAGTGG - Intergenic
1186311190 X:8321105-8321127 GTGATGAGCCATCATGATAGAGG + Intergenic
1187766254 X:22645689-22645711 ATGAAGTGACACAATTATATGGG + Intergenic
1187995741 X:24924655-24924677 GTGAACAGACAGAATTATGGAGG + Intronic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1193439927 X:81527690-81527712 TTAAAGAACCACAATAATAGTGG - Intergenic
1194104064 X:89746083-89746105 GTGAATAGAAACAATTATAAAGG - Intergenic
1197237445 X:124083757-124083779 GTCAAAAGCCAAAATTATACTGG - Intronic
1199931175 X:152524026-152524048 CTGAATAGCCAGAATAATAGGGG + Intergenic
1200456018 Y:3393889-3393911 GTGAATAGAAACAATTATAAAGG - Intergenic