ID: 1112646657

View in Genome Browser
Species Human (GRCh38)
Location 13:101340433-101340455
Sequence CTGTGTTATTTGAGGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 1, 2: 2, 3: 33, 4: 343}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112646657 Original CRISPR CTGTGTTATTTGAGGGAAAA TGG (reversed) Intronic
900235820 1:1589912-1589934 TTGTGGTATTTTAGAGAAAAAGG + Intergenic
900785327 1:4646041-4646063 TTGTTTTATTTGATGGAACATGG - Intergenic
901817382 1:11802619-11802641 CTGTATTCTTTGAGGGAACTTGG - Intronic
903928441 1:26848594-26848616 CTGTGTTGTCTGAGGGAAGGAGG - Exonic
905128673 1:35734932-35734954 TTGTGGTAGTTCAGGGAAAATGG + Intronic
907878190 1:58516129-58516151 ATGTTTAATGTGAGGGAAAAGGG - Intronic
909781718 1:79557210-79557232 TTCTGTTATGTGAGGAAAAAAGG - Intergenic
911710972 1:101072708-101072730 TTGTGTTCGTTGAGAGAAAATGG + Intergenic
911759085 1:101596325-101596347 CTGTTGTGTTTCAGGGAAAAGGG + Intergenic
912124869 1:106523341-106523363 CTGAGTTATTTCATGGTAAAGGG - Intergenic
913469742 1:119176188-119176210 CTCTGGTATTTGAGGGAGCAGGG - Intergenic
913566846 1:120080868-120080890 CTGGGTAATTTAAGGGGAAAAGG - Intergenic
913631283 1:120712681-120712703 CTGGGTAATTTAAGGGGAAAAGG + Intergenic
914287603 1:146241575-146241597 CTGGGTAATTTAAGGGGAAAAGG - Intergenic
914548634 1:148692318-148692340 CTGGGTAATTTAAGGGGAAAAGG - Intergenic
914618046 1:149379393-149379415 CTGGGTAATTTAAGGGGAAAAGG + Intergenic
915405740 1:155658449-155658471 ATGGGTAATTTCAGGGAAAAAGG + Intergenic
918311650 1:183289557-183289579 CTGTTTTATTAGTGGGTAAAAGG - Intronic
918412011 1:184269432-184269454 CTCTCTTATTTGAGAGAAGAGGG + Intergenic
918428272 1:184432840-184432862 CTGTCTTTATTGAAGGAAAAGGG + Intronic
919394902 1:197033865-197033887 CTGAGGTATTTGAGAGAATAAGG + Intergenic
919612811 1:199767108-199767130 CTGTTTTGTTTCAGGGAATAGGG - Intergenic
921808167 1:219479681-219479703 CTGTGTTATTTAGAGGAAATAGG - Intergenic
922626154 1:227045781-227045803 CTGTTTTTGTTGAAGGAAAAAGG - Intronic
1063225179 10:4008847-4008869 CTGTGTTAGTTAAAGGAAGATGG - Intergenic
1063697080 10:8347301-8347323 CTGTGTTATTTGCAGCTAAAAGG - Intergenic
1064513413 10:16120140-16120162 CTGTGTTATTTTTGGCAATAAGG - Intergenic
1064968886 10:21043115-21043137 ATGTGCTATATGAGGGAAAAAGG - Intronic
1066056644 10:31687752-31687774 CTGAGATATATGAGGCAAAAAGG - Intergenic
1066327065 10:34371754-34371776 CTATGTTGTTTGATGTAAAAAGG + Intronic
1067565535 10:47333614-47333636 CTGTGTTGTTTGAGGCAAAGAGG - Intergenic
1068703422 10:60045658-60045680 TTGTTTTGTTTTAGGGAAAATGG + Intronic
1070029999 10:72667840-72667862 CTGAGTTATTAAAGAGAAAATGG + Intergenic
1074289476 10:112127712-112127734 CTGGGCTATTTCAGGGGAAAGGG - Intergenic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1079021742 11:16914814-16914836 CTGTGTGATTTGAGGCAAGTTGG - Intronic
1080046516 11:27814292-27814314 ATGTGTTAGTTGAGGGGAAGTGG + Intergenic
1080217500 11:29861996-29862018 CTGTGGGGTTTGAGGGAAACAGG + Intergenic
1081176654 11:39935402-39935424 TTGTTTTATTTCAGGGAATAGGG - Intergenic
1081224480 11:40503123-40503145 CTGTGTGTTTAGAGGGAGAAAGG - Intronic
1081320485 11:41686394-41686416 CTGTGTTATATGATGGAAAAAGG - Intergenic
1082775643 11:57242472-57242494 TGGTGTTATCTGAGGGAAAGGGG + Intergenic
1083100529 11:60300834-60300856 CTCTGTTCTTTCTGGGAAAAGGG + Intronic
1085181294 11:74539025-74539047 CTATTTTATTTGAGAGAAACAGG - Intronic
1086203132 11:84227328-84227350 CTGTGTGATCAGAGGGAATAAGG + Intronic
1086988506 11:93276587-93276609 CTGTCTTATTTGACAGTAAAAGG + Intergenic
1087830458 11:102814145-102814167 CTGTGTTAGTCTATGGAAAATGG + Intergenic
1088474583 11:110222027-110222049 ATGTCTTATTTCATGGAAAAGGG + Intronic
1090316613 11:125796449-125796471 CTGAATTATTTGATGTAAAAAGG - Intergenic
1091162968 11:133442763-133442785 GTGTCTTTTTTGAGGGAAGAAGG + Intronic
1091511131 12:1127345-1127367 CAGTATTATTTGTGGGAAGAAGG + Intronic
1091573676 12:1713244-1713266 CTTTGGTATTTGAGAGAACAGGG + Intronic
1093093644 12:14948331-14948353 ATGTTTTATTTGAGGGGTAAGGG - Intronic
1096162057 12:49387040-49387062 TTGTGTTTTTTTAGGGAATAAGG + Exonic
1097802295 12:63927805-63927827 ATTTGTTATTTGAGGGAACTGGG + Intronic
1097897797 12:64842981-64843003 CTGAGTTATTTGATGGCAAAAGG + Intronic
1098912878 12:76228049-76228071 CTGTATTATTTTAGGTAGAATGG + Intergenic
1099650318 12:85418561-85418583 CTCAGTTATTTGTGGGAGAAAGG + Intergenic
1100144181 12:91657110-91657132 CCATGTTACTTGAGGAAAAACGG + Intergenic
1100651152 12:96590344-96590366 CTTTGTTCTTTTAAGGAAAATGG - Intronic
1100693306 12:97063123-97063145 CTTTGTTATTTGAGAGATTAGGG + Intergenic
1100955501 12:99903455-99903477 CTCTGTAATTGGAGGGAATAAGG + Intronic
1104583705 12:130030300-130030322 CTTAGTTATTTTAGGGAGAAAGG + Intergenic
1105204713 13:18211309-18211331 TTATGTTCTATGAGGGAAAATGG + Intergenic
1106256306 13:28025316-28025338 CTGTATTATGTGAGGGAAAGTGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1110968345 13:81729560-81729582 CTGTGTTAGTTTACTGAAAATGG + Intergenic
1111306148 13:86415085-86415107 TTGTTTTATTTCATGGAAAAAGG - Intergenic
1111618182 13:90689054-90689076 TTGTGTGATTTGAGAGAAAATGG + Intergenic
1112245008 13:97725309-97725331 CAGTGTTATTAAAGGGAAGAAGG + Intergenic
1112267255 13:97936039-97936061 CTGTGTTATTTGAGGTAAAAGGG + Intergenic
1112282860 13:98077850-98077872 GTGTGTTATTTAAGGAAATAGGG - Intergenic
1112646657 13:101340433-101340455 CTGTGTTATTTGAGGGAAAATGG - Intronic
1113024440 13:105924816-105924838 GTGTATTATTTTAGGGATAAGGG - Intergenic
1113120098 13:106916836-106916858 CTGTGTTTTTTGAGAGGGAAGGG + Intergenic
1113878860 13:113611416-113611438 CTGTGCTGTTTGAGGAAAGATGG + Intronic
1114946605 14:27689425-27689447 ATGTGTTAATTAAGGGAAACCGG + Intergenic
1115433216 14:33345131-33345153 CTGTGTTCTTTTTGGAAAAATGG - Intronic
1115466846 14:33724459-33724481 TTGTGTTTTTTGAGGAAACAGGG - Intronic
1116929412 14:50674866-50674888 GTGTGCTATTTGAGGGATCAGGG - Intergenic
1117945699 14:61017437-61017459 ATATGTTACTTGAGGGTAAAAGG + Intronic
1117974285 14:61281710-61281732 CTCTGTTATTTGCGGGGAAAAGG + Exonic
1118018737 14:61689053-61689075 CTGGATTATTTTATGGAAAAGGG - Intergenic
1118952366 14:70446440-70446462 CTGTGTTAATTGCTGAAAAATGG + Intergenic
1119451347 14:74713377-74713399 CTGGGTTATTTGAGGCAAGAAGG + Intronic
1121745725 14:96289488-96289510 CTGTGTGAGGTGATGGAAAAGGG - Intronic
1122090400 14:99334663-99334685 CTGTGTGATTTAGGGGAAAGCGG + Intergenic
1122317107 14:100832489-100832511 CTGTGTTCATTAAGGGAAAAGGG - Intergenic
1123216771 14:106815470-106815492 TTGTAGTATTTGAGGTAAAAAGG + Intergenic
1123791834 15:23729032-23729054 TTCAGTTATTTGAGGGAAATGGG + Intergenic
1124073034 15:26413409-26413431 CGGTATTATGTGAGGGAGAAAGG - Intergenic
1124811292 15:32941491-32941513 TTGTATTGTTTGAGAGAAAATGG - Intronic
1126262930 15:46715394-46715416 CTGTCTTATTTCAGGGGAAGTGG - Intergenic
1127027855 15:54827878-54827900 CTGGTTTATTTTTGGGAAAAGGG + Intergenic
1127131341 15:55867742-55867764 CTCTGTGATTTGAAGAAAAAAGG + Intronic
1127612915 15:60654585-60654607 ATATGTTATTTTAGGCAAAAGGG + Intronic
1128917175 15:71573553-71573575 AGGTGGCATTTGAGGGAAAAAGG - Intronic
1128932337 15:71716741-71716763 CTGCTTGGTTTGAGGGAAAAAGG - Intronic
1129590220 15:76908196-76908218 CTGAGAGAATTGAGGGAAAATGG - Intergenic
1131141559 15:89980645-89980667 CTGTTTCATTTGCTGGAAAAGGG - Intergenic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1131729028 15:95259673-95259695 CTGTGTAAATTGAGAGGAAAAGG - Intergenic
1131869205 15:96744190-96744212 CCCTGTTATTTGAGAGACAATGG - Intergenic
1131970455 15:97887305-97887327 TTCTTTTATTTGGGGGAAAAAGG + Intergenic
1134534081 16:15011285-15011307 CTGAGTAATTCGAGGGAGAAAGG + Intronic
1136415158 16:30098386-30098408 CAGTGGTACTTAAGGGAAAAGGG - Intergenic
1137227518 16:46528881-46528903 CTGTACTATTTTAAGGAAAAGGG - Intergenic
1137592980 16:49705079-49705101 CTGTCTTCTTTCTGGGAAAAAGG + Intronic
1138445771 16:57062337-57062359 CTGTCTTATCTGGGGGACAATGG - Intronic
1138482924 16:57316050-57316072 CTGTGTGATGTAAGGGAAGAAGG - Intergenic
1138726464 16:59145784-59145806 CTGTCTTGTTTGAGAGAAAGTGG - Intergenic
1138740098 16:59298069-59298091 CAGTGTTATTTTAAGGATAAAGG + Intergenic
1138777618 16:59743241-59743263 CTATACTATTGGAGGGAAAATGG - Intronic
1138975591 16:62203381-62203403 CTGTATTATTTGAAATAAAATGG + Intergenic
1139861955 16:70029442-70029464 CTGAGTAATTCGAGGGAGAAAGG - Intergenic
1141096713 16:81168159-81168181 CTGTGTCATTCAAGGGACAAGGG + Intergenic
1141588098 16:85048529-85048551 CTTTGTTTTTTGAGAAAAAAAGG - Intronic
1141751838 16:85963441-85963463 CTGTCTCATTTGAAGGTAAATGG + Intergenic
1142947652 17:3446381-3446403 CTGTTTTATTTGGAAGAAAAAGG + Intronic
1145256690 17:21328276-21328298 ATGAGATATTTGAGGGAAAATGG - Intergenic
1145319921 17:21759672-21759694 ATGAGATATTTGAGGGAAAATGG + Intergenic
1146019165 17:29261073-29261095 CTGTGTATTTTGTGGGAAAAGGG + Exonic
1146473513 17:33143466-33143488 CTGGGTTATTTGAAGGATTAGGG - Intronic
1146526166 17:33568618-33568640 CTGTGTTATATGAGGCTATAGGG + Intronic
1146584360 17:34069482-34069504 CTGAGTTAGTTCAGGGAAAGAGG + Intronic
1149481215 17:57004748-57004770 CTGAGTTATTAGAGAGCAAAGGG + Intronic
1149490740 17:57083669-57083691 CTTTGTTTTTTGGGGGAATAGGG - Intergenic
1152115351 17:78383193-78383215 CTGAGTTATAAGAGGGAAACAGG + Intronic
1153536727 18:6109854-6109876 CTCTTTTATTTAAGGGAAAAAGG - Intronic
1153616865 18:6943316-6943338 CTGTGCTCTGTGATGGAAAATGG - Exonic
1156650216 18:39216865-39216887 CTGTGTGATTTCAGGGACACTGG + Intergenic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1157948668 18:52009889-52009911 CTGGTTTATTTGAGGCAAAATGG - Intergenic
1158010107 18:52718984-52719006 CTGAGTTTTCAGAGGGAAAATGG - Intronic
1160065820 18:75573455-75573477 CTCTGTTATTTGAGAGAGATGGG + Intergenic
1161965891 19:7548590-7548612 CTGTATTATTTAGGGAAAAACGG + Intronic
1162184019 19:8890751-8890773 CATTTTTATTTGAGTGAAAATGG + Intronic
1163371453 19:16903491-16903513 CTGTGTGATTGGAGGGAATGGGG + Intronic
1164908032 19:31983611-31983633 CTATGTGATGGGAGGGAAAAAGG + Intergenic
1165847305 19:38826586-38826608 CTCTGTTATTTGAGAGAGCAGGG - Intronic
1167865257 19:52320477-52320499 CTGTGTTCTTTTAGAGACAAGGG - Intronic
925811365 2:7703972-7703994 CTGTGTAATTTGAGTATAAATGG - Intergenic
926309075 2:11661567-11661589 CAGTGTTGTAGGAGGGAAAATGG + Intronic
926835571 2:17015832-17015854 CAGTGTTATTTGAGTGGGAAGGG + Intergenic
927736937 2:25532675-25532697 CAGTGTTATTTTAGGGGAATTGG - Intronic
928791399 2:34959810-34959832 CTGGATTATTTGTGGGAAAAGGG - Intergenic
929197558 2:39201714-39201736 CTGAGTTATTTCAGGAATAATGG - Intronic
929849481 2:45571012-45571034 ATGAGATATTTGAGGGAAAAGGG + Intronic
930153747 2:48084088-48084110 CTGTGCTATATGAAGAAAAAAGG + Intergenic
930629273 2:53734454-53734476 ATGAGTGATTTGTGGGAAAATGG - Intronic
930947285 2:57090715-57090737 TTGTCTTACTTGAGGAAAAATGG - Intergenic
931877644 2:66530986-66531008 CCATGTGATTTGAGAGAAAAGGG + Intronic
932136658 2:69237012-69237034 CTGTGTAATCAGATGGAAAAAGG + Intronic
933169826 2:79112913-79112935 CTGTGTTATCTCATGGTAAAAGG + Intergenic
936472188 2:112809009-112809031 GTGTGTAATGTGAGGGAGAAGGG + Intergenic
939349102 2:141009943-141009965 CTGTGTTTCTTGAGGGCCAATGG + Intronic
939568043 2:143807965-143807987 CAGTGTCATTTGAGGGGAATAGG + Intergenic
940971568 2:159902330-159902352 CAGTGGTGTTTGAGAGAAAATGG + Intronic
941426903 2:165358438-165358460 CTGCTTCATTTTAGGGAAAATGG + Intronic
943016875 2:182523245-182523267 GTGTGTTTTTTGAAGGAAAAGGG + Intergenic
944641056 2:201726257-201726279 CTGTGTAATTTGAGGTCACACGG + Intronic
944691129 2:202159517-202159539 CTGTTTTATTAAAGAGAAAATGG - Intronic
944821341 2:203435192-203435214 TTGTTTTATTTGAGGGATAAAGG + Exonic
945780259 2:214162064-214162086 CTTTGTTATTGCAGGAAAAATGG - Intronic
945781558 2:214180382-214180404 CTGTGATATTTCAGTGCAAAAGG + Intronic
946081899 2:217127781-217127803 CTGTGTTTGCTCAGGGAAAATGG + Intergenic
946623039 2:221579357-221579379 ATGTGTTATTTGAAGTAAGAAGG + Intergenic
946859244 2:223984721-223984743 CTGTTTTCTTTGAGGGGAAGGGG + Intronic
946973552 2:225122371-225122393 CTTTTTTAATTGAGGGAGAATGG - Intergenic
947168756 2:227289842-227289864 CCCTCTTATTTGAAGGAAAAAGG + Intronic
947345083 2:229182298-229182320 CTGTGTGTTTTGAAGGAAAGAGG + Intronic
1170237368 20:14121771-14121793 CTTTATTATTTGACGTAAAAAGG - Intronic
1170695676 20:18656143-18656165 CTGTTTTCTTTGTAGGAAAATGG + Intronic
1170940936 20:20847381-20847403 CTGTGTTATTCAAGGGTCAATGG + Intergenic
1173647602 20:44643147-44643169 CTGTCTCCTTTCAGGGAAAAGGG + Intronic
1173878802 20:46395028-46395050 TTGTGTCCTTTGAGGGGAAAGGG - Intronic
1174981344 20:55398877-55398899 CTGGGATATATGAGGCAAAAAGG - Intergenic
1175141465 20:56863782-56863804 ATGTGTTATTTGGTTGAAAATGG - Intergenic
1175290450 20:57871711-57871733 CTGGAATATTTGTGGGAAAAAGG - Intergenic
1176713266 21:10326778-10326800 TTATGTTCTTTGAGGGAAAATGG - Intergenic
1176944775 21:14966158-14966180 TTGTTTTATTTGAGAGCAAAGGG + Exonic
1177551935 21:22634448-22634470 CTGTGTTTTCACAGGGAAAAGGG + Intergenic
1178619598 21:34161989-34162011 CTGGGGTACTTGAGGGAGAAGGG + Intergenic
1180056810 21:45363136-45363158 CTGTGTTCTTGCTGGGAAAAAGG - Intergenic
1181333386 22:22111835-22111857 CTGCATTATCTCAGGGAAAAAGG - Intergenic
1181333477 22:22112638-22112660 CTGCATTATCTCAGGGAAAAAGG + Intergenic
1181471426 22:23142636-23142658 CTATGTAATTTGGGGGAAACTGG - Intronic
1181525967 22:23487610-23487632 TTATGTTCTTTGCGGGAAAATGG - Intergenic
1183004658 22:34891086-34891108 CTGGGTAATTTAAGGGAAAGAGG - Intergenic
1184203596 22:42986099-42986121 CTGTGTTAATTCTGGGGAAAGGG - Intronic
1184252248 22:43267553-43267575 CTGTGTTAAGTGAGGGGGAAGGG - Intronic
949847849 3:8390100-8390122 CTCTGTTAACTGAGGGAACAGGG + Intergenic
952804016 3:37329176-37329198 ATGTGTTTTTTGAACGAAAAGGG + Intronic
953192239 3:40698906-40698928 CAGTGTTGTTTTAGGGAGAAGGG - Intergenic
953193988 3:40714868-40714890 CTGAGTCAGATGAGGGAAAAAGG + Intergenic
953206621 3:40836531-40836553 CTTAGTTATTTCAGGGAAACTGG + Intergenic
953520732 3:43640197-43640219 TTGTGTGCTTTGAGGGAACAGGG + Intronic
956497577 3:69844930-69844952 CTGTTCTATTTTAAGGAAAATGG - Intronic
956792221 3:72688927-72688949 CTGTCACATTTAAGGGAAAAGGG - Intergenic
957381154 3:79431451-79431473 TAGTGTTATTTTAGGGGAAAGGG - Intronic
958847673 3:99284852-99284874 CTGTTTATTTTGAAGGAAAAGGG + Intergenic
960203393 3:114865737-114865759 CAGTATAATTTGAAGGAAAAAGG + Intronic
960394434 3:117118958-117118980 CTCTGATTTTTGAGGAAAAAGGG + Intronic
962360769 3:134741000-134741022 CTCTGTTATTTAAGGAAGAATGG + Intronic
962779321 3:138696628-138696650 ATGGGTTATTGGGGGGAAAAGGG + Intronic
963237407 3:142969191-142969213 CTGTGTTTTTTGTCTGAAAATGG - Intronic
963335317 3:143968780-143968802 CTGTGTTGTTCAAGGGACAACGG + Intergenic
963992083 3:151667068-151667090 CTCTGGTATTTGAGAGAGAAGGG + Intergenic
964970332 3:162552449-162552471 CTGTGTTCTTTGATGGAGAGAGG - Intergenic
967494982 3:190133079-190133101 CTGTGTGGTTGCAGGGAAAAAGG - Intergenic
967804809 3:193706034-193706056 CTGTGTTTTTTTTGGAAAAAAGG - Intergenic
967878649 3:194283497-194283519 CTGGTTTATTTGTGGGAAATGGG + Intergenic
969309095 4:6341983-6342005 CTGTGTTGTGTGAGGGTCAAGGG - Intronic
969887144 4:10225143-10225165 CTGCCTTATTTGAGGAAGAAGGG - Intergenic
970498405 4:16651744-16651766 CTGTCTTCTTTGTTGGAAAAGGG + Intronic
970686970 4:18579436-18579458 CTCTGTTATTTGTGGAAAGATGG - Intergenic
971680045 4:29686879-29686901 CAGCCTTAATTGAGGGAAAATGG + Intergenic
972718647 4:41674351-41674373 CTTTGTCTTTTGAGGGAAAAGGG - Intronic
973684571 4:53356314-53356336 CTATGCTATTTTAGGGAGAAGGG + Intronic
974576946 4:63738160-63738182 CAGTGTAATTTGAGTGATAATGG + Intergenic
975185970 4:71403178-71403200 GTGTATTATTTTAGGAAAAAAGG + Intronic
975281144 4:72564369-72564391 CTGAGTTAATTGTGGGAAACTGG - Intronic
976682079 4:87768472-87768494 CTGTCTGATGTGAGGGGAAAGGG - Intergenic
977181305 4:93878547-93878569 ATTTGTAATTTGAGGGAAGAGGG - Intergenic
978194076 4:105950295-105950317 CTATGTTATTTTAGTTAAAATGG - Intronic
978214966 4:106188968-106188990 CTGCATTATTTTATGGAAAAGGG - Intronic
979799876 4:124895038-124895060 CTGTATTAGTGGAGGCAAAATGG + Intergenic
979988877 4:127350409-127350431 CTGTGTCTTTTGTGGGAACATGG + Intergenic
980617223 4:135244849-135244871 CTGTGTTCTTAGAGGGACAAGGG - Intergenic
982701329 4:158661858-158661880 CTCTGTTATTTGAGAGAGCAAGG - Intergenic
983478994 4:168250490-168250512 CTGTCTTATTTAATTGAAAAGGG - Intronic
983809872 4:172048462-172048484 CTGTGGTGACTGAGGGAAAATGG - Intronic
984176807 4:176429127-176429149 CTGTGTTGTTTCAGGATAAAGGG + Intergenic
984264974 4:177487543-177487565 ATGTGTCATTTGAGGGAAAAGGG - Intergenic
985132054 4:186748562-186748584 CTGTGTTAGTTTAAGGACAATGG + Intergenic
987079650 5:14415142-14415164 CTTTGTTCTTTAGGGGAAAATGG + Intronic
987248072 5:16069813-16069835 TTGTTTTATCTGATGGAAAAAGG - Intronic
989361829 5:40610348-40610370 CTCTCTTATTGGAGGGAGAATGG + Intergenic
990275490 5:54191629-54191651 ATGTGTGGTTTGAGAGAAAAAGG - Intronic
990446041 5:55895525-55895547 CTGTGTTGTTTACTGGAAAAAGG + Intronic
990822917 5:59862853-59862875 CTGTGTTATTGGAATTAAAAGGG + Intronic
991153541 5:63400867-63400889 CTGTAGTGTTTGAGGGCAAAGGG + Intergenic
991592683 5:68270549-68270571 CTGTGTAATTTATGAGAAAAGGG + Intronic
992143638 5:73823327-73823349 CTGTGTAATTTTATGCAAAATGG - Intronic
992488023 5:77214378-77214400 CTGTATGAATGGAGGGAAAACGG - Intronic
992917316 5:81470818-81470840 CTGTGTTTCTTGAGAGATAATGG - Intronic
993209012 5:84923131-84923153 CTGTGTTATTTGTAGCAACACGG + Intergenic
993788849 5:92180911-92180933 CTGTGATATTTGAATCAAAATGG - Intergenic
996266873 5:121551896-121551918 CTGATATATTTCAGGGAAAAGGG + Intergenic
996638634 5:125726309-125726331 CTGTCTTATTTTAGAGAGAAAGG + Intergenic
996813938 5:127552977-127552999 ATATATTATTTGAGGGGAAAAGG - Intronic
996897280 5:128500378-128500400 CTATATCATTTGAGGGAAGAGGG - Intronic
997231288 5:132245220-132245242 CATTGTTACTTGAGGGAATAGGG - Intronic
998667927 5:144319769-144319791 CTGTGTTGCTTGAGTAAAAATGG + Intronic
999516333 5:152305534-152305556 CTGTGTCATCTCATGGAAAAAGG + Intergenic
999794058 5:154971446-154971468 CTTGGTTCTTTGGGGGAAAAAGG + Intergenic
1000027469 5:157372327-157372349 CTGAGTCATTTGAGAGTAAATGG - Intronic
1000271528 5:159688757-159688779 ATGTGCTATTTTAGGGTAAAAGG - Intergenic
1001514405 5:172345286-172345308 CTGTGTTCTTTAAAGGAAAGAGG + Intronic
1001667788 5:173447581-173447603 CAGGGTTATTTGAGGCAAGAAGG + Intergenic
1002351125 5:178584546-178584568 CATTGCTATTTGAGGGTAAAAGG + Intronic
1003932647 6:10940913-10940935 CCGTGTTATTTGAGGCCAGATGG + Intronic
1004291006 6:14367288-14367310 TTGTTTTCTTTGAGGGAAGAGGG - Intergenic
1004475351 6:15966374-15966396 CTGTCTTTTTTCAGGGAAACTGG - Intergenic
1004923462 6:20398271-20398293 TTGTGATATTTGTGGGGAAAGGG - Intergenic
1005526442 6:26655823-26655845 CTGTGTCATTTCATGGCAAAAGG - Intronic
1006583120 6:35088005-35088027 CTCTGTTCTGTGAGGGAAGAAGG - Intronic
1007504216 6:42322488-42322510 CTGTGTTATTTTCTTGAAAAGGG - Intronic
1007521489 6:42453820-42453842 TTGTGTTTTTTGAGGGGTAACGG + Intergenic
1007803355 6:44417168-44417190 CTGTGTGATTTGATGGATAGGGG + Intronic
1008118682 6:47584967-47584989 CTGACTGATTTTAGGGAAAAGGG - Intronic
1008498660 6:52157736-52157758 CTGTGTTCTTTGGGGGAAGTAGG - Intergenic
1009502076 6:64426361-64426383 CTGTGTCAGTTGTGGGAACATGG + Intronic
1009508185 6:64512606-64512628 CTGTGTTATTTGAGGAAAGTGGG + Intronic
1010547594 6:77176921-77176943 CTATTTTCTTTGAGTGAAAAAGG + Intergenic
1010784030 6:79979030-79979052 CTGTGCTAGATGAGGGAAGATGG - Intergenic
1012558213 6:100543254-100543276 CTGTGTTGTTTGGGGAATAATGG + Intronic
1012623271 6:101375574-101375596 CTTTGTGATTGGAGGCAAAATGG + Intergenic
1012836793 6:104279765-104279787 ATGTGAGATGTGAGGGAAAAAGG - Intergenic
1013894687 6:115071944-115071966 CAGTGTCCTTTGAGGGACAAAGG - Intergenic
1014193592 6:118526332-118526354 CTGTGTTATTTGTTGGATCATGG - Intronic
1014808998 6:125864413-125864435 CTCTCTGATTGGAGGGAAAATGG + Intronic
1015053076 6:128865419-128865441 ATGTATCAATTGAGGGAAAAAGG - Intergenic
1015118167 6:129671965-129671987 CTGTGTTCTCAGAGGCAAAATGG - Intronic
1021526020 7:21588912-21588934 CAGTGTTATTTATTGGAAAAAGG - Intronic
1021756534 7:23858223-23858245 CTCTGGTATTTGAGAGAGAAAGG + Intergenic
1022800115 7:33768931-33768953 GTGTGTTTTTTAAGGGAGAATGG - Intergenic
1025904519 7:65773336-65773358 CAGAGTTATTTGAGGGCAAGGGG + Intergenic
1028357920 7:89931838-89931860 CAGTGGTATTGGAAGGAAAATGG - Intergenic
1028621197 7:92831533-92831555 TTGTGATATTGGAGGGAAAAGGG - Intronic
1029023161 7:97386450-97386472 CTGAGTTATTTGAGGTAATATGG - Intergenic
1030969657 7:116039964-116039986 CTGTCTTACTTGAGGAACAAGGG - Intronic
1031262640 7:119541366-119541388 GTGTGTGATTTGATGAAAAAAGG - Intergenic
1031379780 7:121071385-121071407 TTCTGTTTTGTGAGGGAAAATGG - Intronic
1032733091 7:134663903-134663925 CTGTTCTTTTTGAGGGAAATCGG + Intronic
1033425070 7:141236534-141236556 CTGCAATATTTGAGGGAAGATGG - Intronic
1033500993 7:141949404-141949426 GTGTGTTTTGTGGGGGAAAATGG + Intronic
1033514665 7:142094243-142094265 CTGCGTGATTGGAGGGAACACGG - Intronic
1033762800 7:144454588-144454610 AGGTGTTGTTTGAAGGAAAAGGG - Intronic
1033851579 7:145502593-145502615 CTGGGATATGTGAGGCAAAAGGG + Intergenic
1036400968 8:8407988-8408010 CTGTGTTCTTACTGGGAAAATGG + Intergenic
1037205361 8:16311623-16311645 CTCTTTTATTTGAGAGATAAAGG - Intronic
1037328538 8:17719898-17719920 CTGTCTTATTGCAGTGAAAAGGG + Intronic
1037453807 8:19043739-19043761 CTGTGTCATCTGTGGCAAAAGGG - Intronic
1037643291 8:20768329-20768351 CTGTGTTATCTGAGTCAATAGGG - Intergenic
1037682164 8:21106552-21106574 CTATGTTATTAGAGGCAACATGG - Intergenic
1038180406 8:25222085-25222107 CTGTTTTCTGTGAAGGAAAAAGG + Intronic
1040649145 8:49430206-49430228 CTCTGGTATTTGAGGGAGCAGGG - Intergenic
1040796644 8:51295395-51295417 CTCTGGTATTTGAGAGAGAAGGG + Intergenic
1040956928 8:52989121-52989143 CTTTGTTATCTTAGGGAGAAAGG + Intergenic
1041564916 8:59265805-59265827 TTCTCTTATTAGAGGGAAAAAGG - Intergenic
1041990590 8:63985863-63985885 ATGTGAGATATGAGGGAAAAAGG - Intergenic
1042374561 8:68034925-68034947 CTTTGTTATTTGAGGATAAGTGG + Intronic
1043509788 8:80938575-80938597 CTATGTTATATGAGAGAAAGGGG - Intergenic
1043850179 8:85207097-85207119 CAGTGTTATTTGAGGCTAAATGG + Intronic
1043878419 8:85512932-85512954 CTGGGTTTTTTGAGGGGTAAGGG - Intergenic
1044540406 8:93402736-93402758 CTCTGTTATTTAAAGGAAGAGGG + Intergenic
1044566352 8:93664918-93664940 CTGTGATATTAGAAGGAATATGG - Intergenic
1044823774 8:96177521-96177543 CTGTGTCACTAGAGAGAAAAAGG - Intergenic
1045718811 8:105081413-105081435 TTGTGTTATTTGCGGCAACATGG + Intronic
1046667113 8:117016166-117016188 CTGGGATATTGAAGGGAAAAAGG + Intronic
1046737958 8:117797363-117797385 ATGTGTTATGTGAAGAAAAATGG - Exonic
1048611488 8:136027797-136027819 GTGTGTTACTTCTGGGAAAAAGG + Intergenic
1050858450 9:10392569-10392591 GTGTATTATTTGAAGGAATAAGG - Intronic
1051605887 9:18917534-18917556 CTGTGTGCTTTGAGGGAGAAGGG - Intergenic
1051915224 9:22199765-22199787 GTGTGTTTTTGGAGGTAAAAAGG + Intergenic
1054812347 9:69444927-69444949 GTGTGTGATTAGAGAGAAAAGGG - Intronic
1055001738 9:71458402-71458424 CTATTTTATTTGAGGCAGAAGGG + Intergenic
1056540208 9:87564544-87564566 CTGTGTTATTTCATGGCAGAAGG + Intronic
1058130746 9:101250190-101250212 CAGTGTTCTTTGAGGCAGAATGG - Intronic
1058783113 9:108359219-108359241 CTGTTTTATATGGGAGAAAATGG - Intergenic
1059114316 9:111587118-111587140 CTGTGTTAATAGAGTGGAAAAGG - Intronic
1059217203 9:112575148-112575170 CTGTGTTAACTGAGGGAGAAAGG - Exonic
1060716635 9:125936611-125936633 CATTGTTATTTGAGGGAATAGGG + Intronic
1061471470 9:130829653-130829675 TTGAAGTATTTGAGGGAAAATGG + Intronic
1061679770 9:132237255-132237277 CTGTGTGATTTGAGGCCAGAGGG + Intronic
1185552868 X:997949-997971 CTGTGTTACTGGCGGGAGAAGGG - Intergenic
1185805063 X:3049652-3049674 CTGTCTTATTTAGGAGAAAATGG + Intronic
1186383536 X:9086316-9086338 CTGTGTGATTTCAGGGAATTAGG - Intronic
1186600260 X:11029160-11029182 CTGAGCTATATGAGGGAAGATGG + Intergenic
1186605924 X:11091095-11091117 TTGTGTTATTTCAGGTAAGAGGG + Intergenic
1186924835 X:14322191-14322213 CTGTGTTCTTTGAGGCAACCTGG - Intergenic
1187226434 X:17377912-17377934 CTGTGTGGTTTGGGGTAAAAAGG - Intronic
1187677829 X:21735532-21735554 CTGTGTGATTACAGGGAACAAGG - Intronic
1188097710 X:26043996-26044018 CTCTGGTATTTGAGAGAACAGGG - Intergenic
1188799739 X:34513842-34513864 TTGTCTAATTTGAGGTAAAATGG + Intergenic
1189395569 X:40619526-40619548 CTGGATTATTTGAAGGGAAAAGG + Intergenic
1189586279 X:42465365-42465387 CTGTGTGAGTTAAGGCAAAATGG + Intergenic
1189922558 X:45916719-45916741 CTGTGTTCTGTGAGGGATAAAGG + Intergenic
1190945472 X:55089194-55089216 CTGTGGCTTCTGAGGGAAAAGGG + Intronic
1193411111 X:81164146-81164168 CTCTGTTATTTGAGGGGACTGGG - Intronic
1194431274 X:93809743-93809765 CTCTGTTATTAGAGAGTAAAAGG - Intergenic
1195307938 X:103604000-103604022 CTGTGTTCTTTAAGAGAAAAGGG - Intergenic
1196430964 X:115624913-115624935 CTGTGTAATGTTAGGCAAAAAGG - Intronic
1196964959 X:121045516-121045538 CTCTGTTATTTGCAGGAACATGG + Intergenic
1197674919 X:129318944-129318966 CAGTTTTCTTTGAGGGAATATGG - Intergenic
1198232575 X:134706008-134706030 CTGGGATATATGAGGCAAAAAGG - Intronic
1198319419 X:135504946-135504968 CTGGGATATATGAGGCAAAAAGG + Intergenic
1198471784 X:136953730-136953752 CTATGTCAGTTGAAGGAAAATGG - Intergenic
1198749542 X:139924798-139924820 CTGTGTGATTTCAGTGAAAGAGG + Intronic
1198891906 X:141405962-141405984 CTGTGTTTTCTGCTGGAAAAAGG - Intergenic
1199217695 X:145279860-145279882 GTGTGTTTTTTGTGGGAAACGGG + Intergenic
1199365881 X:146982174-146982196 CTGTATTATTTGAAGGTAGATGG - Intergenic
1199746459 X:150774828-150774850 ATTTTTGATTTGAGGGAAAAGGG + Intronic
1200371800 X:155734290-155734312 CTGTTGTATTTTAGGGAATAGGG + Intergenic
1200463305 Y:3484274-3484296 ATGAGTTATTTGAAGGAACATGG + Intergenic
1200685005 Y:6250257-6250279 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1200821792 Y:7591831-7591853 CTGTGTTATTTCAGGCACAAAGG + Intergenic
1200876844 Y:8165252-8165274 CTGTGTTATTTCAGGCACAAAGG + Intergenic
1200990535 Y:9341527-9341549 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1200993197 Y:9361844-9361866 CTATGTTGTTTCAGGGAAGAGGG + Intronic
1200995851 Y:9382115-9382137 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1200998515 Y:9402467-9402489 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1201001025 Y:9470997-9471019 CTATGTTGTTTCAGGGAAGAGGG + Intronic
1201003692 Y:9491325-9491347 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1201006348 Y:9511606-9511628 CTATGTTGTTTCAGGGAAGAGGG + Intergenic
1201056874 Y:10002727-10002749 CTGTGTTATTTCAGGCACAAAGG - Intergenic
1201276197 Y:12300960-12300982 CTGTCTTATTTAGGAGAAAATGG - Intergenic
1202103817 Y:21340086-21340108 CTGTGTTACTTCAGGCACAAAGG + Intergenic
1202238512 Y:22740923-22740945 CTGTGTTATTTCAGGCACAAAGG - Intergenic