ID: 1112651034

View in Genome Browser
Species Human (GRCh38)
Location 13:101398778-101398800
Sequence CAGGGTGCACAGCGTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 421
Summary {0: 1, 1: 0, 2: 6, 3: 39, 4: 375}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112651025_1112651034 19 Left 1112651025 13:101398736-101398758 CCTAAGAAGTGGTATCATCTCTA 0: 1
1: 0
2: 1
3: 16
4: 145
Right 1112651034 13:101398778-101398800 CAGGGTGCACAGCGTGGGGAGGG 0: 1
1: 0
2: 6
3: 39
4: 375
1112651029_1112651034 -6 Left 1112651029 13:101398761-101398783 CCATGTGACTCTGAGGACAGGGT 0: 1
1: 0
2: 2
3: 22
4: 240
Right 1112651034 13:101398778-101398800 CAGGGTGCACAGCGTGGGGAGGG 0: 1
1: 0
2: 6
3: 39
4: 375

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112651034 Original CRISPR CAGGGTGCACAGCGTGGGGA GGG Intronic
900392276 1:2438857-2438879 CAGGGGGCGCAGCGTGTGCAGGG + Intronic
900475098 1:2872374-2872396 CAGGGGTGACAGCGTGTGGAGGG + Intergenic
900824233 1:4913486-4913508 CTGGGGGCCCAGGGTGGGGAAGG - Intergenic
901015283 1:6225836-6225858 AAGTGGGCACAGCGTGGGGAGGG - Intronic
901480353 1:9520739-9520761 CAGGAAGCACAGGGAGGGGAAGG - Intergenic
901669900 1:10850001-10850023 CAGGGAGCACAGGGATGGGAGGG + Intergenic
901825695 1:11859419-11859441 CAGGGTGCACAGCGGCGAGCAGG - Intergenic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902037492 1:13468236-13468258 CAGGGTGGACAGTTTGAGGAAGG + Intergenic
902409084 1:16202338-16202360 CGGGGTGCCCATCATGGGGACGG + Intronic
902513088 1:16976640-16976662 CAGGGTTGACAGGGTGGGGAGGG + Intronic
902917358 1:19646648-19646670 CTGGGTGCAGAGGGTGTGGAGGG - Intronic
903233494 1:21935877-21935899 GAGGCTGCCCAGAGTGGGGATGG + Intronic
903647187 1:24902596-24902618 GAGGGTTGGCAGCGTGGGGAAGG + Exonic
904566542 1:31431805-31431827 CAGGGTGGACAGGGTGGATAGGG + Intronic
904566566 1:31431877-31431899 CAGGGTGGACAGGGTGGATAGGG + Intronic
904566614 1:31432021-31432043 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566617 1:31432030-31432052 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566620 1:31432039-31432061 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566623 1:31432048-31432070 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566626 1:31432057-31432079 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566629 1:31432066-31432088 CAGGGTGGACAGGGTGGTTAGGG + Intronic
904566638 1:31432093-31432115 CAGGGTGGACAGGGTGGATAGGG + Intronic
904566653 1:31432138-31432160 CAGGGTGGACAGGGTGGACAGGG + Intronic
904566656 1:31432147-31432169 CAGGGTGGACAGGGTGGATAGGG + Intronic
904657917 1:32063152-32063174 CAGGGGGTGCATCGTGGGGAAGG - Intergenic
905937864 1:41839172-41839194 CAGGGTCCACAGAGGAGGGAAGG + Intronic
906210835 1:44011411-44011433 CTGGGGGCACAGAGTGGGCAGGG + Intronic
908783557 1:67713479-67713501 CAGGGAGAGCAGGGTGGGGATGG + Intronic
912699824 1:111869068-111869090 CAGGATGGGCAGCGTGTGGAAGG - Intronic
913111781 1:115663750-115663772 CATGGAGGACAGCGTGGGGCTGG + Exonic
913496499 1:119432771-119432793 GTGGGTCCAGAGCGTGGGGAAGG + Intergenic
914340547 1:146756226-146756248 CAGGGTGTATGGGGTGGGGAGGG - Intergenic
915471270 1:156127015-156127037 CAGGGAGGACAGGGTGGGGCAGG - Intronic
915514114 1:156402682-156402704 CAGGGTCCTCAGCGTGGTGGGGG - Intergenic
915978967 1:160408472-160408494 CAGGGTGCACCGCAGGGGAAGGG - Intronic
916060740 1:161097084-161097106 CAGAGAACACAGCATGGGGATGG - Intergenic
916085913 1:161269238-161269260 CAGGGTGCTGAGGGTGGGGAAGG + Intronic
916552210 1:165859893-165859915 CAGGGTGGACAAGGTGGGCAGGG - Intronic
917176559 1:172242292-172242314 CAGGGTGAACAGCAAGGGGTGGG - Intronic
917708636 1:177660489-177660511 CAGGGTGCACAGCTTGGGAATGG + Intergenic
919571360 1:199253018-199253040 CAGTGTACACTGCTTGGGGAGGG - Intergenic
920308543 1:205034287-205034309 CAGGGCACACAGCATGGAGAGGG - Intergenic
920854652 1:209652711-209652733 CAGAATTCACAGGGTGGGGAAGG + Intergenic
921657272 1:217754802-217754824 TAGAGTGCACAGAGTAGGGAGGG - Intronic
922977019 1:229793599-229793621 CAAGGTTCACAGGCTGGGGAAGG + Intergenic
1063238369 10:4142523-4142545 CAGACTGCACAGGGTGGGTAAGG - Intergenic
1063568892 10:7196397-7196419 CTGATTGCACAGCGTGGGCATGG - Intronic
1064026920 10:11856314-11856336 CTGGGTGCACGGCGAGGGCACGG + Intronic
1064029518 10:11875046-11875068 CATGGTGAAAAGCGTGGGGTGGG - Intergenic
1066464382 10:35640236-35640258 CACGGTGCACAGCGCGGGGCCGG + Exonic
1068062471 10:52086183-52086205 CAGGGTGGAAAGGATGGGGAGGG - Intronic
1069743488 10:70700264-70700286 CAGGAAGGACAGTGTGGGGAGGG - Intronic
1070789278 10:79180042-79180064 CAGGGTGCCGAGGGTGGAGACGG + Intronic
1070824976 10:79385715-79385737 CTGGGTCCATAGCGTGGGGAGGG + Exonic
1070964628 10:80522083-80522105 CAGGGAGCCCAGCTTGGAGAAGG + Exonic
1071339078 10:84626066-84626088 CAGGATGCACAGCCTGAAGAAGG + Intergenic
1072442371 10:95468387-95468409 AAGGGGGCACTGCTTGGGGAAGG - Intronic
1073328448 10:102656161-102656183 CCGGGGGCACATCCTGGGGAGGG + Intronic
1073510110 10:104037607-104037629 CCAGGTGCAGGGCGTGGGGAAGG + Intronic
1074773178 10:116746328-116746350 CATGATGCACAGCATGGGTAGGG + Intergenic
1075258035 10:120940600-120940622 GATGGTGCACAGCTTGGGGAGGG - Intergenic
1075544376 10:123343340-123343362 CAGAGTGCACACCGTGGACAAGG + Intergenic
1075713399 10:124542649-124542671 CAGGGTGCACAGGGCTGGGATGG - Intronic
1075777206 10:124996700-124996722 CAGGCTGCAGAGCCTGGGGGTGG - Intronic
1075953345 10:126501217-126501239 CAGCCTGCACAACGTGTGGAGGG - Intronic
1076638157 10:131896421-131896443 GAGGGTGCACAGGGTGAGCAGGG + Intergenic
1076644515 10:131943468-131943490 CAGGGTGCACAGCAGGGTGCTGG - Intronic
1076851653 10:133096223-133096245 AGGGGTGCACAGGCTGGGGAGGG - Intronic
1076874140 10:133207764-133207786 CAGTGTGCACACCGAGTGGAGGG - Intronic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1077516726 11:3006711-3006733 CAGGCTGGCCAGCGTGGGAATGG + Intronic
1081702224 11:45159133-45159155 CAGGGTGCTCAGGGAGGGCAGGG - Intronic
1083287217 11:61667856-61667878 CAGGTTGCACAGCATGGTGGGGG - Intergenic
1083476756 11:62920408-62920430 CAGACTGCACAACATGGGGATGG - Intronic
1084114304 11:67032958-67032980 CAGGGTGCTCAGTGCTGGGAGGG + Intronic
1084363945 11:68685689-68685711 CAGGGTTCAAAGCGAGGGGCAGG - Intronic
1084365175 11:68693021-68693043 CAGGCTGCACACCGTGGGGCTGG - Intergenic
1084486216 11:69449786-69449808 CCGGGTCCACTGCCTGGGGATGG + Intergenic
1084697005 11:70761738-70761760 CATGGAGCACAGCATGGGCATGG - Intronic
1084972709 11:72780533-72780555 CAGGGTGCAGAAAGCGGGGAAGG + Intronic
1085337359 11:75706388-75706410 CTTGGTGCCCAGCGTGGGGCGGG - Intergenic
1086037869 11:82438719-82438741 GAGGCTGCACAAGGTGGGGAGGG + Intergenic
1086514384 11:87594965-87594987 CAGGGTGAAGAGTGAGGGGAGGG + Intergenic
1086929052 11:92672315-92672337 CAGGCTGCAGAGCATGTGGATGG - Intronic
1088318878 11:108534513-108534535 CAAGGTGCAGAGAGTGGAGAAGG - Intronic
1088884017 11:113993140-113993162 CAGGGTGCACAGTGTGGCCCGGG - Intergenic
1089353467 11:117834687-117834709 CAGGTTACACAGCTGGGGGATGG - Intronic
1089504964 11:118956778-118956800 CAGGGTTCACAGAGTGGAAAGGG + Intronic
1090000215 11:122949734-122949756 CAGATTCCACAGCGTGGGCACGG - Intronic
1090188478 11:124753042-124753064 CTGGGTACACAGCTTGGGAAGGG + Intronic
1091002086 11:131918198-131918220 GAGGGCTCACAGCCTGGGGATGG - Intronic
1091820191 12:3470462-3470484 CATGGTAGACAGCCTGGGGAAGG - Intronic
1093064876 12:14646846-14646868 TAGGGTGCACAGTCTGGTGAAGG + Intronic
1093757166 12:22865722-22865744 CAGGGGCCACAGCGTGAGCAGGG - Intergenic
1093769644 12:23003665-23003687 AAAGGTGGACAGCCTGGGGAGGG - Intergenic
1094850279 12:34379297-34379319 CAGGATGCACAGGGTGACGAGGG + Intergenic
1096072246 12:48781891-48781913 CCTGGTGCCCAGCATGGGGAAGG + Intronic
1097063030 12:56300141-56300163 CAAGGTGAGCAGCGAGGGGAGGG - Exonic
1097680795 12:62647259-62647281 CAGGGAGCACAGCATGAGAATGG + Exonic
1098431299 12:70422881-70422903 CTGGGAGCACAGAGTGGCGACGG + Intronic
1098981223 12:76958396-76958418 TAGGGTCCACAGAGTGAGGAAGG - Intergenic
1100760068 12:97797472-97797494 TGGGGTGCACAGGGTGGGGTTGG + Intergenic
1101339124 12:103825877-103825899 CCCGGTGCACAGCATGTGGATGG - Intronic
1102028198 12:109725440-109725462 CAGGGTGCAGACCTAGGGGAGGG - Intronic
1102029542 12:109731979-109732001 CAGGGTGCACAGCAGTGAGAAGG - Intronic
1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG + Intergenic
1104566884 12:129893395-129893417 CAGGGTGGGTAGGGTGGGGAGGG - Intronic
1104744086 12:131200051-131200073 CAGGGTTCACATCCTGGGGCTGG - Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1107634756 13:42381001-42381023 CAGGGTGCACAGAGGGGAGGGGG + Intergenic
1107747340 13:43524484-43524506 CAGGGTGGAGGGCGTGAGGAGGG - Intronic
1107963617 13:45579868-45579890 CAGAGTGCCCTGGGTGGGGAAGG - Intronic
1109747585 13:66647246-66647268 CAAGCTGTACAGCCTGGGGATGG - Intronic
1110195280 13:72781710-72781732 CCGGGTGCGCAGCGTGTGGAGGG - Exonic
1110440280 13:75518953-75518975 CAGGGGGCACGGCCCGGGGAGGG + Intergenic
1112333932 13:98498714-98498736 CAGGGTGTACAGTGGGGAGACGG - Intronic
1112488352 13:99840064-99840086 CAGAGTTCCCAGCGTGGGGTGGG - Intronic
1112651034 13:101398778-101398800 CAGGGTGCACAGCGTGGGGAGGG + Intronic
1113037040 13:106062007-106062029 CAGGGAGCACAGCCTGAGGCAGG - Intergenic
1113555795 13:111232973-111232995 CTGGGAGAACAGGGTGGGGATGG + Intronic
1113652115 13:112041137-112041159 CAGGCAGCACAGCTTGGTGAGGG - Intergenic
1113659912 13:112099264-112099286 TAGGGTCCTCAGTGTGGGGAGGG + Intergenic
1113796623 13:113061951-113061973 CAGAGTGGACTGCGTGGGGGTGG - Intronic
1114613680 14:24057464-24057486 CAGGGTGCACAGCTGGGGAAGGG - Intronic
1116034061 14:39606987-39607009 CAGAGAGCACTGCATGGGGAAGG - Intergenic
1116330572 14:43592438-43592460 CAGTGTGCACTGCTTGGTGATGG - Intergenic
1119318491 14:73714790-73714812 CAGGGTGCACAGTGTGGTCAGGG - Intergenic
1119804805 14:77475675-77475697 GAGGGAGCACAGCGTGGAGGCGG + Exonic
1121523130 14:94599867-94599889 CAGGGCCCCCAGCGTGGGGCTGG - Intronic
1122373602 14:101243285-101243307 GAGGGTGCACAGCGTGGGCGAGG - Intergenic
1122789112 14:104176928-104176950 CCGGGTTCACAGCATGCGGAGGG - Exonic
1122796765 14:104210015-104210037 CAGGTTGCTCTGTGTGGGGAAGG + Intergenic
1122859992 14:104578214-104578236 CAGGGAGCACAGAGAGGGGGCGG + Intronic
1122886398 14:104712327-104712349 CAGGGTGCACAGTGGGGTGCCGG + Intronic
1124159161 15:27253416-27253438 CTGAGTGGACAGCTTGGGGAGGG - Intronic
1124911138 15:33921925-33921947 CAGGGAGCGGAGGGTGGGGAGGG + Intronic
1125588599 15:40840076-40840098 CACGGTGCCCAGCCAGGGGAAGG + Intergenic
1126482099 15:49136176-49136198 CATGGTGGCAAGCGTGGGGAGGG + Intronic
1126534092 15:49741971-49741993 CAAGCTACACAGCCTGGGGATGG - Intergenic
1126919314 15:53503146-53503168 CAGGGTGCGGGGCATGGGGAGGG + Intergenic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129298704 15:74613508-74613530 CAGGCTGCAAAGTGTGGAGAGGG + Intronic
1131391312 15:92051173-92051195 CAGGGTCCACAGTGAGGTGAAGG + Intronic
1132253443 15:100352057-100352079 CAGGGTGGACACAGTGGGAAGGG - Intergenic
1132558545 16:583339-583361 CTGGGTACACAGGGTGGGCATGG - Exonic
1132702222 16:1226752-1226774 CAGGGTTCCCACCGAGGGGACGG - Intergenic
1132734435 16:1378558-1378580 CAGAGTGCGCAGCATGTGGAGGG + Intronic
1134083404 16:11340069-11340091 AAGGGTTCCCAGGGTGGGGATGG + Intronic
1136100053 16:27987467-27987489 CAGGGGGCACAGCAGGGGCAGGG - Intronic
1136241530 16:28947589-28947611 CAGGGTGCCGAGCGAGGTGATGG + Intergenic
1137406793 16:48195399-48195421 CATGGTGGACGGGGTGGGGACGG + Intronic
1137593119 16:49706051-49706073 CAGAGAGAACAGCGTGGGCAAGG + Intronic
1138398959 16:56730288-56730310 CGGGGTTCCGAGCGTGGGGACGG - Intronic
1139646980 16:68338568-68338590 GAGGAAGCACAGCCTGGGGAAGG + Intronic
1139923516 16:70473652-70473674 GTGGGTGCAGAGCGTGGCGAGGG + Intronic
1139993738 16:70961180-70961202 CAGGGTGTATGGGGTGGGGAGGG + Intronic
1140307993 16:73821571-73821593 CAAAGTGCACAGCGTGGTGCTGG + Intergenic
1141497515 16:84420165-84420187 CAGGGTGTACAGAGCAGGGAGGG - Intronic
1141819057 16:86432518-86432540 CAGGGTGCACGGTGTGGCGGAGG - Intergenic
1141940270 16:87271441-87271463 CGGAGTGCACAGCGTGGGTTTGG - Intronic
1142133546 16:88441651-88441673 GAAGGGGCCCAGCGTGGGGAGGG + Intergenic
1142145203 16:88489986-88490008 GAGGAGGGACAGCGTGGGGAGGG + Intronic
1142810845 17:2394931-2394953 CAGGGTCCCCAGCGTGGGTGGGG + Exonic
1142847958 17:2691144-2691166 CAGGATGGGAAGCGTGGGGAGGG + Intronic
1143513457 17:7408047-7408069 GAGGGGGCACGGGGTGGGGAAGG - Intronic
1143619881 17:8074689-8074711 CAGGCTGCACAGCCTGGTTAAGG - Intronic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143784649 17:9247393-9247415 CAGGCCACACAGGGTGGGGACGG - Intergenic
1144664343 17:17091715-17091737 GAGGGTGCAAAGAATGGGGAGGG + Intronic
1145211207 17:21014651-21014673 CCGGGTGCACAGCCTTGAGACGG + Intronic
1145998401 17:29117438-29117460 CAGGATGCCCACCGTGGGGTGGG - Intronic
1146183283 17:30710077-30710099 CAGGGTGCCTGGCGGGGGGAGGG + Intergenic
1146399467 17:32491906-32491928 CAGGGTGCAGGGCCTGGGGAGGG - Intergenic
1146499751 17:33354315-33354337 CAGGGGGCTCATAGTGGGGATGG - Intronic
1146824884 17:36013551-36013573 CAGGGGGAAAAGGGTGGGGAAGG - Intronic
1147159719 17:38562952-38562974 CATTGTGCACAGCTGGGGGATGG - Intronic
1147371580 17:39996477-39996499 CAGGGGGCCCAGAATGGGGAGGG + Intronic
1147604625 17:41767529-41767551 CAGGTTGTGCAGCGTGGTGATGG + Exonic
1148114919 17:45169907-45169929 CAGGGCGCACAGGGTGTTGACGG - Exonic
1148438466 17:47699541-47699563 CAGTCTGCACACAGTGGGGAAGG - Intronic
1148805037 17:50259700-50259722 CTGGGGCCACAGAGTGGGGAGGG - Intergenic
1150136381 17:62697540-62697562 CAGGTTTCACAGCTGGGGGAGGG + Intergenic
1150289252 17:63972213-63972235 CATGCTGAACAGCGTGGGGCAGG + Exonic
1150630620 17:66877782-66877804 CTGGGAGCAGAGTGTGGGGAAGG - Intronic
1151685512 17:75643889-75643911 CAGAGGGCACAGCTTGGGGTGGG - Intronic
1152686209 17:81695017-81695039 CCGGCTGCACAGCCTGGGGAAGG + Exonic
1152691973 17:81722436-81722458 CAGGGTGCAGAGGGTGGGGTGGG + Intergenic
1152725143 17:81941451-81941473 CAGGGTGGCCAGCATGGCGAAGG + Exonic
1152907611 17:82977409-82977431 CCGGGTGCTCAGTGTTGGGAGGG + Intronic
1153330375 18:3867459-3867481 GAGGGTTCACGGGGTGGGGAAGG + Intronic
1154241310 18:12657117-12657139 CCGGGTTCACGGGGTGGGGAGGG - Intronic
1154353125 18:13603740-13603762 CAGCGTGCTCAGCGTGGAGTGGG - Intronic
1155294346 18:24371632-24371654 CAGGGAGCACAGAGTAGGGAGGG - Intronic
1156309959 18:35912570-35912592 AAGGGTGGACAGTGTGGTGAAGG - Intergenic
1156578862 18:38351790-38351812 CTGGCTGCCCAGAGTGGGGATGG + Intergenic
1157546323 18:48549146-48549168 CAGGGTGCACATAGGGGTGATGG + Intronic
1157783863 18:50464712-50464734 CCAGCTGCACAGGGTGGGGAAGG + Intergenic
1157807915 18:50672147-50672169 CAGGGTGCAGGGAGTGGAGAAGG + Intronic
1158420907 18:57293074-57293096 CAGGGTGTACTGCGTGTGTAGGG - Intergenic
1160145442 18:76360040-76360062 CAGGGTGCACAGAGTGCAGGAGG - Exonic
1161021693 19:2014237-2014259 AAGGGTGCAGGGCCTGGGGATGG + Intronic
1161031659 19:2060567-2060589 CAGGGTGCACATCCTGGGAAGGG + Intergenic
1161219301 19:3110697-3110719 TAGGCTGCTCAGCCTGGGGAAGG - Intronic
1161284106 19:3459961-3459983 CAGGGTGGACTGTGAGGGGAGGG - Intronic
1162033134 19:7925858-7925880 CCGGGCGCGCGGCGTGGGGACGG + Intronic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1162975509 19:14205697-14205719 CAGGGTGCCTGGCGGGGGGAGGG - Intronic
1163062607 19:14771318-14771340 CAGAGTACACAGAGTGGGAAGGG - Intronic
1163612540 19:18308836-18308858 TAGGGTGCACAGCCTGGTGGGGG + Intronic
1163725840 19:18922594-18922616 CACGGTGCTCACCCTGGGGATGG - Exonic
1164451833 19:28372723-28372745 CAGGTTCCACAGGGTGAGGAGGG - Intergenic
1164711344 19:30359270-30359292 CAGTGTGCATGGTGTGGGGAGGG + Intronic
1165396520 19:35567178-35567200 CAGGGTGGACATGGTGGGGAGGG + Intergenic
1165906615 19:39198133-39198155 CAGGTTGCTGAGGGTGGGGAGGG + Intronic
1166582393 19:43913829-43913851 CAGTGTGCAGAGTGTGGGAAGGG - Exonic
1167103523 19:47418292-47418314 CAGGGTGCCCAGCCAGGCGAGGG - Intronic
1167216854 19:48170734-48170756 AAGGGTGCACATCTTGGGGAGGG + Intronic
1167418475 19:49389535-49389557 CAGGGTGCAAAGGGGGGCGATGG - Intronic
1167576665 19:50320956-50320978 CAGGGGGCACAGCTGGGAGAGGG + Intronic
1167826685 19:51979673-51979695 CTGGGTCCACAGAGTGGGGTAGG - Intronic
925138275 2:1534410-1534432 GAGGCTGCACAGGGTGGGGGCGG - Intronic
925154156 2:1637388-1637410 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154165 2:1637462-1637484 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154187 2:1637610-1637632 CAGAGTGGACAGCGTGCGGCAGG - Intronic
925154201 2:1637684-1637706 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154217 2:1637759-1637781 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925926847 2:8677002-8677024 GAGGGTGCACAGCGGATGGAGGG + Intergenic
926127898 2:10283147-10283169 AAGGGTTCCCAGCATGGGGATGG + Intergenic
926541109 2:14182594-14182616 CAGGGTCCAGAGCGAGGGGCTGG + Intergenic
927714389 2:25342403-25342425 CGGGGCGCCCAGCGTGGGGAGGG - Intronic
927954770 2:27200732-27200754 CAGGGAGCACAGGGTGGGCTGGG + Intronic
929502854 2:42504971-42504993 CAAGGTCCACAGAGTGGTGATGG - Intronic
929691286 2:44076089-44076111 CAGGGTGAGCAGGCTGGGGAGGG + Intergenic
934992280 2:98930286-98930308 CACGGTACAGAGGGTGGGGACGG - Intronic
934992295 2:98930324-98930346 CACGGTACAGAGGGTGGGGATGG - Intronic
934992310 2:98930362-98930384 CACGGTACAGAGGGTGGGGACGG - Intronic
934992325 2:98930400-98930422 CACGGTACAGAGGGTGGGGACGG - Intronic
934992340 2:98930438-98930460 CACGGTACAGAGGGTGGGGACGG - Intronic
935310506 2:101778459-101778481 CAGGGTGGACAGCATGCAGAAGG + Intronic
937295570 2:120807902-120807924 CTGGGTGGGCAGGGTGGGGAGGG + Intronic
937656758 2:124385784-124385806 CAGGGGGCACTTCTTGGGGATGG - Intronic
937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG + Intronic
938113784 2:128589888-128589910 GAGTGGGCACAGCCTGGGGAGGG + Intergenic
938743933 2:134259494-134259516 CAGGGTTAACAACGTGTGGATGG - Intronic
938802643 2:134777118-134777140 TAGGATGCACTGGGTGGGGAGGG + Intergenic
945430205 2:209755098-209755120 GAGGGTGCAGACCCTGGGGAAGG + Intergenic
947430612 2:230024517-230024539 CAGGCTGCACAGGTAGGGGAAGG - Intergenic
947475921 2:230447650-230447672 CATAGGGCAAAGCGTGGGGAAGG + Intronic
947531381 2:230910675-230910697 CAGGGTGCACAGGGACGGGAAGG + Exonic
947722939 2:232380341-232380363 CAGGGGGCACAGCAGGGGGAGGG + Intronic
947727661 2:232410002-232410024 CAGGGTGCACCGGGAGGGGAAGG - Exonic
947750341 2:232528798-232528820 CTGGGGCCACAGAGTGGGGAAGG - Intronic
947801029 2:232928489-232928511 GGGGGTGCCCAGCGTGGGCAAGG - Intronic
1168895433 20:1320439-1320461 CAGAGTGCAGAGGGTGGGGAAGG + Intronic
1170061695 20:12265817-12265839 CAGGGTGCCCAGTGAGGGCAGGG + Intergenic
1170073073 20:12389961-12389983 CAAGGTACATAGGGTGGGGAAGG + Intergenic
1170789300 20:19494646-19494668 CAGGGTGCACAGCCTGGACTAGG + Intronic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1172031497 20:31985181-31985203 CAGAGTGAACAGGGTGGGGCTGG - Intronic
1172045882 20:32079888-32079910 CAGGGAGGACAAGGTGGGGAGGG - Intronic
1172636093 20:36410925-36410947 CAGGAAGTACAGTGTGGGGATGG - Intronic
1172868631 20:38120524-38120546 CAGGGCGCTCAGCTTGGGCAGGG + Intronic
1173257384 20:41404627-41404649 CATGGGGCACAGGCTGGGGAGGG - Exonic
1175516874 20:59575688-59575710 CTGGGTCCACAGAGTGGGGAAGG + Intergenic
1175890222 20:62312699-62312721 CACGGTGTACAGCGTGGAGCAGG - Exonic
1176624609 21:9082775-9082797 CAGGGTGCACAGCGTCGGGCAGG - Intergenic
1178422232 21:32451996-32452018 CAGGGTGCCCTGCGTAGAGAAGG - Intronic
1179427150 21:41290596-41290618 CGGGGCGGAGAGCGTGGGGAGGG - Intergenic
1180130072 21:45821482-45821504 CAGGGCCCACAGCGTGGTGCAGG - Intronic
1180631483 22:17233175-17233197 GGTGGTGCACAGAGTGGGGAGGG - Intergenic
1180696501 22:17754410-17754432 CAGGGTGCCCAGGGAGGGCAGGG + Intronic
1183086966 22:35492303-35492325 CAGGGAGCACACCTGGGGGAGGG - Intergenic
1183252875 22:36742838-36742860 CAGGGGGAACAGCCTGGGCAAGG + Intergenic
1183620408 22:38968708-38968730 TAGGGTGCACAGAGCGGGGCTGG + Intronic
1183669004 22:39261208-39261230 CAGGCTGCACAGAGTGGAGCAGG + Intergenic
1183742269 22:39675380-39675402 CAGGGGTCAGAGCATGGGGAAGG - Intronic
1183829172 22:40408923-40408945 CAGACTGCACAGCCTGGGAACGG - Exonic
1183953841 22:41367732-41367754 CAGGGTGCAGAGTGCGGAGAGGG + Intronic
1184095290 22:42313050-42313072 CAGGGTCCACAGTATGGTGATGG - Intronic
1184639689 22:45863819-45863841 GAGGGGGCACAGAGTGGGGAAGG - Intergenic
1184672948 22:46025158-46025180 CAGGGTGCACTGCAGGGAGAGGG - Intergenic
1184672975 22:46025297-46025319 CAGGGTGCACTGCAGGGAGAGGG - Intergenic
1184673040 22:46025625-46025647 CAGGGTGCACTGCAGGGAGAGGG - Intergenic
1184760760 22:46542774-46542796 CAGAGTGCACAGCGTGGAGATGG + Intergenic
1185085423 22:48738186-48738208 CGGGGAGCCCAGCATGGGGAGGG + Intronic
1185206416 22:49541546-49541568 CTGGCTGCCCAGCGAGGGGAGGG + Intronic
1185265533 22:49900704-49900726 CAGGGTCCTCAGGGTGGAGATGG + Exonic
1185270923 22:49929084-49929106 GACGGTGCACAGCCTGGGAAGGG - Intergenic
1185319507 22:50194002-50194024 CAGGGGGCTCAGCTAGGGGAGGG - Intronic
950483736 3:13260754-13260776 CAGGGTGCACGGGGCGTGGAAGG + Intergenic
950881010 3:16322624-16322646 CAGGCTGCTCAGGGTGGGGTGGG + Intronic
951266751 3:20577230-20577252 CAGGCAGCACAGTGTGGAGAAGG + Intergenic
951510922 3:23501153-23501175 AAGGATGCACAGAGTGAGGAAGG + Intronic
951678883 3:25273947-25273969 CAGGGTGCACAGTGCAGGGGTGG - Intronic
953694332 3:45146097-45146119 CAGGGTGCGGAGGGTGCGGAGGG - Intronic
954248050 3:49347211-49347233 CAGGGTTCACAGTGTGGTTAGGG + Intergenic
954287613 3:49629979-49630001 CAGGGTGGGCGGCGTGGAGAAGG + Intronic
954329958 3:49884571-49884593 CAGGGAGAACAGGGTAGGGAGGG - Intergenic
954581711 3:51706738-51706760 CACGGGGCACGGGGTGGGGAAGG - Intergenic
954626640 3:52025475-52025497 CAGGGTGGACTCCGTGGGTAGGG + Intergenic
954888624 3:53901771-53901793 GAGAGTGCAAAGCGTGAGGATGG - Intergenic
956788302 3:72660969-72660991 CAGGGTACACACAGTGGGGTGGG + Intergenic
958729638 3:97948022-97948044 CAGGGTCATCTGCGTGGGGAAGG + Intronic
961097783 3:124172728-124172750 CAGGGAGCACAGCATTGAGAGGG - Intronic
961986152 3:131137324-131137346 CAGGGTGGACAGGGAAGGGATGG + Intronic
962078767 3:132114834-132114856 CAAGCTGCACAGCCTGGGGTTGG + Intronic
964484813 3:157176287-157176309 GAGGGAGCACAGCGTGTGTAAGG + Intergenic
965984528 3:174735921-174735943 AAGGGTGAACAGAGTGGTGAGGG + Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967884119 3:194321840-194321862 TGGGGTGTACAGCGGGGGGAGGG + Intergenic
968107135 3:196009268-196009290 CAGGGGGCAGGGTGTGGGGAGGG - Intergenic
968442080 4:629224-629246 CGGGGTGCACAGCGGGGGATGGG - Intronic
968541822 4:1171886-1171908 CAGGGGGTACTGCTTGGGGAAGG + Exonic
968651319 4:1761380-1761402 CAGGGTGCACGGGGTGGGTGGGG - Intergenic
969095630 4:4730243-4730265 CATGGGGCTCAGGGTGGGGATGG + Intergenic
969110126 4:4839311-4839333 CAGGCTGCACAGCCAGGGGCGGG - Intergenic
969183411 4:5458743-5458765 CTGGGTGCACAGCTTTCGGAGGG + Intronic
971905681 4:32722275-32722297 CTAGGTGCCCAGCTTGGGGAAGG + Intergenic
972397775 4:38672455-38672477 CTGGCTGCACAGAGTGGGGAGGG + Intronic
975170507 4:71227266-71227288 CAGGGTGTATGGCATGGGGATGG + Intronic
976068348 4:81215083-81215105 CACGGTGCGCAGCGTGGGCCCGG + Exonic
976206887 4:82631217-82631239 GAGGGGGCAGAGGGTGGGGAAGG - Exonic
976449747 4:85174543-85174565 AAGGGAGCACATCATGGGGAAGG - Intergenic
979354798 4:119690738-119690760 CAGGGAGCAAAGGATGGGGAAGG + Intergenic
983135005 4:164068736-164068758 GAGGGCGCACAGCGTGGGACTGG + Intronic
985010154 4:185573857-185573879 CAGCGTGCACAGAGTGGTGAGGG + Intergenic
985584625 5:723878-723900 GAGGCTGCACAGCGAGGGGGAGG - Intronic
985598132 5:808208-808230 GAGGCTGCACAGCGAGGGGGAGG - Intronic
986024492 5:3837898-3837920 CAGGCTGCCCAGACTGGGGAAGG + Intergenic
986041871 5:4001376-4001398 CAGGGAGTACAGCTGGGGGAAGG + Intergenic
986471528 5:8081298-8081320 CAGAGTGCACAGAGTGTGCAGGG + Intergenic
987121950 5:14776088-14776110 CAGGGAGCAGAGTGTGGGCAGGG + Intronic
988197725 5:28027457-28027479 CACGCTTCACAGCTTGGGGATGG - Intergenic
989563054 5:42873113-42873135 CAGGGTGCAAAGGGTGGAGAAGG - Intronic
992614550 5:78535759-78535781 CAGGGGGAACACCTTGGGGAAGG + Intronic
994033032 5:95167057-95167079 TAGGGTGCAGGGAGTGGGGAAGG - Intronic
996738442 5:126777652-126777674 CAAGGTGCGCAGCCTGGAGACGG + Exonic
996779493 5:127170661-127170683 CAGGGTGATCAGCCTGGTGAGGG - Intergenic
997844693 5:137275983-137276005 CAGTGTGAACAGCCTGGGCAGGG - Intronic
998849489 5:146339745-146339767 CCTGGTGCACGGCGTGGTGAGGG - Exonic
999687943 5:154118969-154118991 CTGGCTGCACAGCCTAGGGAAGG - Intronic
1000367118 5:160502023-160502045 CAGGGTACACTGCTTGGTGATGG - Intergenic
1001193960 5:169654927-169654949 CAGGGCTCCCAGCTTGGGGAGGG - Intronic
1002400516 5:178989230-178989252 CAGGGTGGTGAGGGTGGGGAGGG - Intronic
1002640974 5:180630476-180630498 CAGGGTCCACAGGCTGGGGGCGG + Intronic
1002836496 6:869273-869295 CAGAGTGCCCAGCGTGGAGCAGG + Intergenic
1002906345 6:1452263-1452285 CAGGGTGCACAGGCTGGGCTGGG + Intergenic
1002908893 6:1473212-1473234 CAGGATGCACAGCGTGGGAAGGG - Intergenic
1003011008 6:2427577-2427599 CAGCCTCCACAGAGTGGGGAGGG + Intergenic
1003778724 6:9398849-9398871 CAGGGTGCCCAGCGAGCGCAGGG + Intergenic
1006303972 6:33208148-33208170 CAGGGTACGCAGAGTGGGGGAGG + Intergenic
1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG + Intronic
1006844935 6:37055679-37055701 AGGGGTGCACAGTTTGGGGAGGG - Intergenic
1007696529 6:43737407-43737429 CAGGCTGCCTGGCGTGGGGAAGG + Intergenic
1007744624 6:44035868-44035890 GAGGGTGCACGGCCTGAGGAAGG + Intergenic
1007838212 6:44693900-44693922 CTGGGTGCACAGTGCGAGGAAGG - Intergenic
1014050946 6:116953668-116953690 TCAGGTCCACAGCGTGGGGATGG + Intergenic
1014069282 6:117162279-117162301 CAGAGTGGGCAGCGTGGAGACGG - Intergenic
1014214963 6:118744630-118744652 CAGCCTGCACAGTGCGGGGAGGG - Intergenic
1014609148 6:123519365-123519387 CACAGAGCACAGCTTGGGGAGGG - Intronic
1017018284 6:150118711-150118733 CTGCGGGCACAGCCTGGGGAAGG + Intergenic
1017858056 6:158368712-158368734 CAGGGTATACAGCCTGGGGATGG + Intronic
1019419582 7:944835-944857 CAGGGTGGGTAGAGTGGGGATGG - Intronic
1019682927 7:2362669-2362691 CAGCATCCACAGCGTGGGCAGGG - Exonic
1019912157 7:4107111-4107133 CAGGGTGGGGAGGGTGGGGAGGG + Intronic
1022792693 7:33704635-33704657 GTGTGTGCACAGCGAGGGGAGGG - Intergenic
1023664891 7:42512885-42512907 CTGGGTGCACATTGTGGGGTTGG - Intergenic
1023985105 7:45089395-45089417 GAGGGTGCAGGGCCTGGGGAGGG + Intergenic
1024572203 7:50732596-50732618 AAGGGTGCCCAGAGTGGTGAGGG + Intronic
1025283007 7:57641845-57641867 GAAGGTCCACAGGGTGGGGAAGG - Intergenic
1026998600 7:74635947-74635969 CAAGGTGCACAGGGTGCAGAGGG - Intergenic
1028593996 7:92528555-92528577 CAGGATGCGCAGCGGGGAGAGGG - Intergenic
1029043192 7:97599124-97599146 CAGAGTGTACAGCTTTGGGAGGG + Intergenic
1029597717 7:101546562-101546584 CACTGTGCCCAGCCTGGGGAAGG + Intronic
1029686992 7:102155851-102155873 CTGGGTGCAGGGAGTGGGGAAGG - Intronic
1033039917 7:137908554-137908576 CAAGGTGCAGAGCGTGGATATGG + Intronic
1033155230 7:138951025-138951047 GAGGGTGCAAAGGATGGGGAGGG - Intronic
1034431488 7:151043417-151043439 GAGGGTGCACAGTGCGGGGTGGG + Intronic
1034431550 7:151043689-151043711 GAGGGTGCACAGTGCGGGGTGGG + Intronic
1034431563 7:151043728-151043750 GAGGGTGCACAGTGCGGGGTGGG + Intronic
1034431576 7:151043766-151043788 GAGGGTGCACGGTGTGGGGTGGG + Intronic
1034490938 7:151392698-151392720 CAGGGTGCACAGCCTGTGACAGG - Intronic
1034590107 7:152131488-152131510 CAGGCTGCAGAGCGTGAGGATGG + Intergenic
1036911318 8:12759558-12759580 CAGGGTGCACAAAGTGCGCAAGG + Intergenic
1037823641 8:22147868-22147890 CAGGGGGCAGAGCATGGGAAAGG + Exonic
1040874931 8:52141495-52141517 CAGAGGGCACAAAGTGGGGACGG - Intronic
1041624534 8:60010468-60010490 CAGAGTGCACAGTGTGGGGATGG + Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047761378 8:127957157-127957179 CAGGTTGCACAGCTTGGGGATGG + Intergenic
1049360977 8:142212530-142212552 GATGGTGCTGAGCGTGGGGATGG - Intronic
1049502404 8:142974499-142974521 GAGGCAGCACAGCGAGGGGAGGG - Intergenic
1049796552 8:144499779-144499801 CAGGGAGCACAGGGTGGCGGGGG - Intronic
1050019394 9:1268047-1268069 CAGGCTGCACGGCCTGGGGCAGG - Intergenic
1051606143 9:18919125-18919147 GGGGCTGCACAGGGTGGGGAAGG + Intergenic
1052824289 9:33163935-33163957 CAGGGTGCCCGGTGTGGGGGCGG + Intronic
1053023981 9:34715482-34715504 CTGGATGCAGAGCTTGGGGAAGG + Intergenic
1053274227 9:36771146-36771168 CAGGGGGCACATGGTGGGGAAGG - Intergenic
1054356232 9:64066482-64066504 CAGGGCGCACAGCCTCGGGCAGG - Intergenic
1055341026 9:75283350-75283372 CAGGGTGCACGGTGAGAGGAGGG - Intergenic
1057037853 9:91824780-91824802 CTGGTTCCAGAGCGTGGGGACGG - Intronic
1057874639 9:98744440-98744462 GAGGGTGCACAGTCTAGGGAGGG - Intronic
1060027791 9:120187584-120187606 CAGGATTCCCAGCCTGGGGAAGG + Intergenic
1060367503 9:123033454-123033476 CAGACTGCACAGTGTGGGAATGG - Intronic
1060406204 9:123374257-123374279 CCGGGAGCCCAGCGTGTGGAAGG + Intronic
1060774995 9:126366713-126366735 CAGGGTGCACAGTGAGGGAGAGG - Intronic
1061519121 9:131107191-131107213 CAGGGTGCACAGCTAGTGCAGGG + Intronic
1061777908 9:132978083-132978105 CAGGGTGCTGAACTTGGGGAGGG + Intronic
1062557045 9:137117817-137117839 GACGGTGCACAGCGTTGTGAAGG - Intergenic
1203561956 Un_KI270744v1:64773-64795 CAGGGCGCACAGCCTCGGGCAGG + Intergenic
1187276597 X:17821406-17821428 CAGGGAGCAGGGTGTGGGGAAGG + Intronic
1192318231 X:70067863-70067885 CAGGGGGCACAGGCTGGGGAGGG + Intergenic
1192545100 X:72006548-72006570 GAGGGTGCACAGAGGTGGGAAGG - Intergenic
1194114614 X:89880579-89880601 CAGCATGCACAGGGTTGGGAGGG - Intergenic
1196270462 X:113704552-113704574 CAGGGTGAACAGTTTGGGGTTGG + Intergenic
1197721058 X:129744957-129744979 CAGTGTGAACAGTGTGGGGGCGG + Intronic
1200048128 X:153413383-153413405 CAGGGTGCTCCACGCGGGGAGGG - Intergenic
1200099984 X:153685508-153685530 CAGGGTGGCCGACGTGGGGAGGG + Intronic
1200213263 X:154356296-154356318 CAGGGAGCCCGGGGTGGGGAAGG - Intronic
1200467354 Y:3535977-3535999 CAGCATGCACAGGGTTGGGAGGG - Intergenic
1201591216 Y:15616883-15616905 CAGGGTGCAGGGAGTGGGGAGGG + Intergenic