ID: 1112652609

View in Genome Browser
Species Human (GRCh38)
Location 13:101416019-101416041
Sequence TTCCTGCGCGTGGGTGTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112652609_1112652622 19 Left 1112652609 13:101416019-101416041 CCCCCGACACCCACGCGCAGGAA 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1112652622 13:101416061-101416083 CTCCCGCGCCCCGGCCAGGCCGG 0: 1
1: 0
2: 2
3: 33
4: 360
1112652609_1112652619 -4 Left 1112652609 13:101416019-101416041 CCCCCGACACCCACGCGCAGGAA 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1112652619 13:101416038-101416060 GGAATAGGGAGGGCGCATCGCGG 0: 1
1: 0
2: 0
3: 5
4: 73
1112652609_1112652625 24 Left 1112652609 13:101416019-101416041 CCCCCGACACCCACGCGCAGGAA 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1112652625 13:101416066-101416088 GCGCCCCGGCCAGGCCGGCAAGG 0: 1
1: 0
2: 0
3: 25
4: 234
1112652609_1112652620 10 Left 1112652609 13:101416019-101416041 CCCCCGACACCCACGCGCAGGAA 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1112652620 13:101416052-101416074 GCATCGCGGCTCCCGCGCCCCGG 0: 1
1: 0
2: 1
3: 18
4: 145
1112652609_1112652621 15 Left 1112652609 13:101416019-101416041 CCCCCGACACCCACGCGCAGGAA 0: 1
1: 0
2: 0
3: 5
4: 91
Right 1112652621 13:101416057-101416079 GCGGCTCCCGCGCCCCGGCCAGG 0: 2
1: 1
2: 11
3: 65
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112652609 Original CRISPR TTCCTGCGCGTGGGTGTCGG GGG (reversed) Intronic
903998317 1:27322237-27322259 ATCCTGGGCGGGGGTGGCGGCGG - Exonic
903998375 1:27322461-27322483 TTGCTGCGCGTTGGGGCCGGAGG - Intronic
904231764 1:29079910-29079932 TTGCTCCGCCTGGGTGGCGGAGG + Intronic
904870896 1:33617470-33617492 TTCCTGCTCTAGGGTGTCAGGGG + Intronic
923055792 1:230425566-230425588 TGCCCGCGGGTGGATGTCGGGGG - Intronic
1068517797 10:58045629-58045651 TTTCTGAGCCTGGGTGTTGGGGG - Intergenic
1069070336 10:63985518-63985540 TTCCTGCGAGTGGGGTTGGGGGG - Intergenic
1074137720 10:110643097-110643119 TTCCTCCGCGTGGTTGCGGGAGG + Intergenic
1076916019 10:133423473-133423495 TCCCTGCGCGTGGCTGCCGCCGG - Exonic
1077325588 11:1962602-1962624 TTCCTGGGTCTGGGTGTCTGAGG + Intronic
1077562212 11:3271116-3271138 TTCCTGCCTGTGGGTGGTGGTGG + Intergenic
1077568106 11:3316936-3316958 TTCCTGCCTGTGGGTGGTGGTGG + Intergenic
1084790996 11:71475055-71475077 CCCCTGCGGGTGGGTGTCGTTGG + Intronic
1085278748 11:75316536-75316558 TTCCAGCGGGTGGGTGTCATGGG + Intronic
1085332530 11:75666089-75666111 TTCCTGCAAGAGGGTGTGGGGGG - Intronic
1091135105 11:133181354-133181376 TTACTGCACGGGGGTGGCGGGGG + Intronic
1202808568 11_KI270721v1_random:17781-17803 TTCCTGGGTCTGGGTGTCTGAGG + Intergenic
1092727621 12:11500424-11500446 TTCCTGCGCCTGGGCGGCGGTGG - Intronic
1102041050 12:109800882-109800904 TTGCTGCCCTTGGGTGTCGCTGG - Intronic
1104004967 12:124885389-124885411 TTCCTGTGCCTGGGGGTGGGTGG - Intergenic
1104894096 12:132153478-132153500 TTGGTGCGCGTGGGTGTGGCTGG + Intergenic
1111487278 13:88920136-88920158 TTCCTGTGTGTGGGTGTGGTGGG + Intergenic
1112652609 13:101416019-101416041 TTCCTGCGCGTGGGTGTCGGGGG - Intronic
1117000387 14:51365594-51365616 TTCCTGGGAGTGGGTGGCTGAGG + Intergenic
1122030666 14:98909100-98909122 CCCCTGCGCGTGGGGGGCGGGGG + Intergenic
1122987462 14:105219117-105219139 GTCCTGCGTGTGAGTGTGGGCGG + Intronic
1128797976 15:70478788-70478810 TCCCTGAGCCTGGGTGTCTGTGG - Intergenic
1141133384 16:81449978-81450000 TTCCTGCAAGTGGGTGACAGAGG + Intronic
1144687728 17:17237164-17237186 GTCACGCGCCTGGGTGTCGGCGG - Exonic
1148442367 17:47717985-47718007 TCCCTGCACGTGGGTGTCCCTGG - Intergenic
1152676607 17:81644643-81644665 GTCCTATGCGTGGGTGTCTGCGG - Intronic
1152867939 17:82735453-82735475 TTCCTGCGCCCGGGATTCGGGGG - Intergenic
1156337937 18:36186821-36186843 TTCCCGCACGTGGGTGTGGCCGG - Intergenic
1158647961 18:59264445-59264467 TTCCTGCGCGTGGGCTCCAGCGG + Intergenic
1160730582 19:640079-640101 TTCCTGCGCGTGGATCCCGGCGG + Exonic
1161730005 19:5953949-5953971 GGCCTGCGTGTGGGTGCCGGTGG - Intronic
1163314583 19:16533146-16533168 CTCCTGCGGGCGGGGGTCGGTGG + Exonic
1163716803 19:18877669-18877691 TTCCTGGGCCTGGGAGGCGGCGG + Intronic
1165450456 19:35879253-35879275 TTCCTGAGCCCGGGTGTGGGCGG + Intronic
1167604975 19:50476794-50476816 CTCCTGCGCGTGCGTGACTGAGG - Intronic
929501271 2:42493575-42493597 TGCCTGCCCGTGGCTGACGGGGG + Exonic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
934620446 2:95800147-95800169 TTCCTGAGCGAGGCTGTGGGCGG + Intergenic
934640448 2:96024426-96024448 TTCCTGAGCGAGGCTGTGGGCGG - Exonic
935183099 2:100707412-100707434 TTCCTGGGTGTGGGTGCCGTGGG - Intergenic
937987762 2:127646169-127646191 TCTCCGCCCGTGGGTGTCGGTGG - Exonic
941661858 2:168203507-168203529 TTCCTAGGAGTGGGTGTCTGTGG - Intronic
944539506 2:200742585-200742607 TGCCTGCTCTTGGCTGTCGGAGG - Intergenic
948436343 2:237956464-237956486 CTCCTGCGCGGGGAGGTCGGTGG + Intergenic
948561853 2:238859389-238859411 TTCATGGGAGGGGGTGTCGGGGG + Intronic
948770511 2:240249256-240249278 TCCCTTCGGGTGGGTGGCGGGGG + Intergenic
1175205143 20:57305513-57305535 TCCCTGCTCGTGGGGGTGGGAGG - Intergenic
1175522315 20:59609653-59609675 TTCCTGGGCGTGGGAGAGGGCGG + Intronic
1176244905 20:64092892-64092914 TACCTGGCCGTGTGTGTCGGAGG + Exonic
1177418382 21:20824453-20824475 TGCCTGGGGGTGGGTGTGGGAGG + Intergenic
1180079269 21:45479169-45479191 TGACTGCGCGTGTGTGTGGGGGG + Intronic
1181594336 22:23904604-23904626 TTACTGTGGGTGGGTGTCTGGGG + Intergenic
1183213646 22:36465926-36465948 TTCCTGGGGGTGGGTGTGGAAGG + Intergenic
1184127969 22:42500956-42500978 GGCGTGCGCGTGGGTGTCGGGGG + Intergenic
1184136759 22:42554272-42554294 AGCGTGCGCGTGGGTGTCGGGGG + Intronic
1185335840 22:50270501-50270523 TTCCTGCGCCTCGGAGGCGGTGG + Intronic
950712015 3:14819688-14819710 TGCCTCCCCGGGGGTGTCGGGGG - Exonic
954796382 3:53163290-53163312 TGCCTGGGCGTGGGTGTTAGCGG + Intronic
962263370 3:133928640-133928662 TTCCTGAGCGTGGTTGGTGGGGG + Exonic
967503026 3:190222308-190222330 TGCATGTGCGTGTGTGTCGGGGG + Intergenic
967889133 3:194352496-194352518 TGCGTGCGTGTGGGTGTGGGGGG + Intergenic
967926601 3:194653782-194653804 TCCCAGCGCTTGGGTGGCGGAGG + Intronic
968870305 4:3238742-3238764 CTGCTGCGCCTGGGTGGCGGGGG - Intronic
968900769 4:3430752-3430774 CTCCTGCGCGAGGGAGACGGGGG - Exonic
973319132 4:48792432-48792454 TTCCTGTGCGGGGGTGCGGGGGG - Intergenic
975770072 4:77711127-77711149 TTCCCGTGCCTGGGTGTGGGTGG - Intergenic
982208895 4:153019258-153019280 CTCCTGCGTGTGGGTGGGGGTGG + Intergenic
982346182 4:154362705-154362727 TTCGGTCTCGTGGGTGTCGGAGG - Intronic
997237154 5:132279333-132279355 CGCGCGCGCGTGGGTGTCGGGGG - Intronic
997953122 5:138257782-138257804 GCCCTGCGCGTGGGGCTCGGCGG + Exonic
1002057822 5:176608974-176608996 CTCCTGCTCGGGGGTGTGGGGGG + Intronic
1005980064 6:30829825-30829847 TTCCTGTGGGTGTGTGTCTGGGG + Intergenic
1007230968 6:40347610-40347632 TTGCTGTGCCTGGGTGTCCGAGG - Intergenic
1013760673 6:113513656-113513678 TTCTTGTGCGTGTGTGTCGGGGG - Intergenic
1014851431 6:126343859-126343881 TTCCTGGGTGTGTGTGTAGGTGG - Intronic
1019333802 7:473254-473276 CTCCTGCTCGTGTGAGTCGGTGG + Intergenic
1019433847 7:1011892-1011914 TTCCTGCCTGTGTGTGTGGGCGG - Intronic
1020822146 7:12983637-12983659 TTCCTGGGAGTGGGTTTCTGTGG + Intergenic
1024262271 7:47581738-47581760 TTGCGGCGCGTGGGGGGCGGGGG - Intronic
1025266208 7:57459919-57459941 TTTCTGCCCGTGGGTGTGTGTGG + Intronic
1031862245 7:126994033-126994055 TTCCTGCCTGTGGTTGTGGGAGG - Intronic
1033587270 7:142783360-142783382 CTCCTGCGCCTCTGTGTCGGGGG - Intergenic
1035169568 7:157010043-157010065 TTCCTGGGCGCGGGCGGCGGCGG - Exonic
1035253803 7:157613652-157613674 TCCCTGCGTGTGGGAGACGGAGG - Intronic
1040671703 8:49698810-49698832 TTTGTGCTCGTGGGTGTAGGGGG + Intergenic
1043530752 8:81147376-81147398 TTCCTGCTCTTGGCTGTTGGGGG - Intergenic
1049815998 8:144600804-144600826 TACCTGCGCGTGTGTGTGCGTGG + Intronic
1054781279 9:69168345-69168367 TTCTTGGGGGTGGGTGTCAGAGG + Intronic
1060208897 9:121698857-121698879 TTCCTCCAGGTGGGTGTGGGGGG + Intronic
1060758404 9:126228792-126228814 TTTCTGCGTGTGGGTGTGTGTGG - Intergenic
1190116753 X:47630312-47630334 TTCCTGCTCGTGGGGGTGGAGGG + Intergenic
1192201859 X:69071318-69071340 TTCCAGCTCGTGGGTGGAGGAGG - Intergenic