ID: 1112652639

View in Genome Browser
Species Human (GRCh38)
Location 13:101416098-101416120
Sequence GGCGCCTCCACCCGAGAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112652639_1112652648 3 Left 1112652639 13:101416098-101416120 CCCCGCTCTCGGGTGGAGGCGCC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1112652648 13:101416124-101416146 CCCCACCCCTCCCCCGCGCGGGG 0: 1
1: 0
2: 7
3: 69
4: 616
1112652639_1112652646 2 Left 1112652639 13:101416098-101416120 CCCCGCTCTCGGGTGGAGGCGCC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1112652646 13:101416123-101416145 TCCCCACCCCTCCCCCGCGCGGG 0: 1
1: 1
2: 5
3: 95
4: 684
1112652639_1112652645 1 Left 1112652639 13:101416098-101416120 CCCCGCTCTCGGGTGGAGGCGCC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1112652645 13:101416122-101416144 CTCCCCACCCCTCCCCCGCGCGG 0: 1
1: 1
2: 5
3: 76
4: 769

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112652639 Original CRISPR GGCGCCTCCACCCGAGAGCG GGG (reversed) Intronic
900135699 1:1116091-1116113 GGCGCCACCGCCTGAGGGCGGGG - Exonic
900769393 1:4528700-4528722 GGCACCTTCCCCCGAGACCGTGG - Intergenic
903213113 1:21829564-21829586 GGAGCCAGCACCCGACAGCGAGG + Exonic
921384024 1:214551713-214551735 GGCTCCCCCACCCCAGAGCCGGG + Intronic
1073503845 10:103967060-103967082 GACGCCCCCACGCGAGCGCGCGG + Intergenic
1078190906 11:9091750-9091772 GCCCCCTCCACCCGAGGCCGGGG - Intronic
1089520588 11:119060129-119060151 GGTGCCTCCACAAGAGAGAGTGG - Intergenic
1090189387 11:124758595-124758617 CGCGGCTTCACCAGAGAGCGAGG + Intronic
1094624095 12:32106708-32106730 GGCGCCTCCCGCCGGGCGCGCGG - Intergenic
1108984295 13:56563864-56563886 GAGGCCTCCACCCAACAGCGAGG - Intergenic
1112652639 13:101416098-101416120 GGCGCCTCCACCCGAGAGCGGGG - Intronic
1113916649 13:113877836-113877858 CACCCCTCCACACGAGAGCGGGG - Intergenic
1122297335 14:100712858-100712880 GGCACCTCCACCCTTGAGAGAGG + Intergenic
1122994826 14:105257420-105257442 GGGGCCTCCAGCCCAGGGCGTGG - Intronic
1127293731 15:57592060-57592082 GGCGGCGCCGCCCGAGAGCAGGG - Exonic
1132666096 16:1082006-1082028 GGCGTCTTCACCCGAGAGTGAGG - Intergenic
1134212505 16:12289497-12289519 AGCGCCACCACCGGAGAGGGTGG - Intronic
1137565315 16:49529053-49529075 GGCCCCTCCACCCCAGCGTGGGG + Intronic
1142239650 16:88939438-88939460 GTGGCCTCCACCCGAGATTGGGG - Intronic
1142684656 17:1570962-1570984 GGCGCCACCACCCCAGGCCGAGG - Intronic
1143155427 17:4833452-4833474 CGCGCCTCCCCCGGAGACCGGGG - Exonic
1145037972 17:19554407-19554429 TGAGCCTCCACGCGAGAGTGGGG + Intronic
1148397797 17:47324035-47324057 GGGGCCTCCAGCCGAGAGGAAGG + Exonic
1155928847 18:31685230-31685252 GGCGCCTCACCCCGGGCGCGCGG - Intronic
1161156332 19:2733521-2733543 GTCGCCGCCACCCCTGAGCGTGG - Intronic
1164879242 19:31717048-31717070 TGCGCCTCCACCCAAGAGCCAGG - Intergenic
1165199813 19:34134540-34134562 TGCGCCTGCGCCCGAGGGCGCGG + Intergenic
926092253 2:10058589-10058611 GGCGCCTCCTCCCCAACGCGGGG - Exonic
927860471 2:26557330-26557352 GGCCCCTTCTCCCGAGAGAGGGG - Intronic
929068292 2:38002864-38002886 GGAGTCTCCACCCTAGAGGGGGG - Intronic
929701941 2:44169448-44169470 GGGGCCTATACCCGAGAGCCAGG - Intronic
931711007 2:64989175-64989197 GGAGGCTCCACCCGAGGCCGCGG - Intronic
937986953 2:127642260-127642282 AGCGCCTCCACCCCAGGGCACGG + Intronic
1168963938 20:1887503-1887525 GGCTCCGCCACCCGAGGGCCTGG - Intergenic
1181934560 22:26429426-26429448 GACGCCGCCGCCCGAGGGCGCGG - Exonic
1184547222 22:45179393-45179415 GGCGCCTCCTTTCCAGAGCGTGG + Intronic
1184793558 22:46717461-46717483 GGCAGCCCCACGCGAGAGCGTGG + Intronic
1184831879 22:46993934-46993956 GGCCCCACCCCCCGAGGGCGAGG - Intronic
1184884527 22:47334422-47334444 GGACCCACCACCCGGGAGCGAGG + Intergenic
950967448 3:17155982-17156004 GGTGCCTCCACCCAGGAGCTAGG + Intergenic
972203866 4:36747821-36747843 GGCCTCTCCATCCCAGAGCGGGG + Intergenic
978577158 4:110198896-110198918 GGCGCGTGGACCCGAGAGCTTGG + Intronic
985706215 5:1402883-1402905 GGCGCCTTCACCCGAGTGTGAGG - Intronic
1002855052 6:1028939-1028961 GCCGCCTCCACCCCAGCGTGTGG + Intergenic
1012062872 6:94511079-94511101 GGAGCCTCCACCTGGGAGTGGGG - Intergenic
1015625873 6:135181002-135181024 GCCGCCGCGACCCGGGAGCGGGG + Intergenic
1021998560 7:26202367-26202389 CCCGCCCCCACCCGGGAGCGCGG - Intronic
1029366396 7:100119268-100119290 GCCCCCGCCACCCGAGCGCGGGG + Intronic
1032194005 7:129779595-129779617 GGCGCCTCCGCCTGAAGGCGCGG + Intergenic
1037917567 8:22781775-22781797 GGCACCTCCAGCCGTGAGCTGGG - Intronic
1037924621 8:22834467-22834489 GGCACCTCCACCCAGGAGCTGGG + Intronic
1048847658 8:138615826-138615848 GGCGCCTCCAACCTAGTGGGTGG - Intronic
1049658960 8:143811255-143811277 GGCGCTGCCGCCCGAGATCGGGG - Exonic
1054906688 9:70419383-70419405 AGCCCCTGCACCCGGGAGCGCGG + Intergenic
1056570827 9:87813318-87813340 GGCACCTCCACCCGAAGGCTAGG - Intergenic
1057600294 9:96451014-96451036 GTCGGAGCCACCCGAGAGCGCGG + Intronic
1061230444 9:129312830-129312852 GGGGTCTCCAGCTGAGAGCGGGG + Intergenic
1061238409 9:129355188-129355210 TGCGCATCCCCCCGAGAGTGGGG - Intergenic
1061961508 9:133991468-133991490 GGCGGCTCGACCCGGGAGCCAGG + Intronic
1199947157 X:152679276-152679298 GACGCCTCCACCCCAGATAGAGG + Intergenic
1199962523 X:152789178-152789200 GACGCCTCCACCCCAGATAGAGG - Intergenic