ID: 1112652869

View in Genome Browser
Species Human (GRCh38)
Location 13:101417182-101417204
Sequence CCCTGGGCATGGTGCTTAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 219}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112652869_1112652882 23 Left 1112652869 13:101417182-101417204 CCTCCTAAGCACCATGCCCAGGG 0: 1
1: 1
2: 2
3: 19
4: 219
Right 1112652882 13:101417228-101417250 CTCTCTGAAAGGTTTACTTTGGG 0: 1
1: 0
2: 2
3: 25
4: 183
1112652869_1112652878 12 Left 1112652869 13:101417182-101417204 CCTCCTAAGCACCATGCCCAGGG 0: 1
1: 1
2: 2
3: 19
4: 219
Right 1112652878 13:101417217-101417239 ACTCATTCCCACTCTCTGAAAGG 0: 1
1: 1
2: 0
3: 13
4: 154
1112652869_1112652883 28 Left 1112652869 13:101417182-101417204 CCTCCTAAGCACCATGCCCAGGG 0: 1
1: 1
2: 2
3: 19
4: 219
Right 1112652883 13:101417233-101417255 TGAAAGGTTTACTTTGGGTCTGG 0: 1
1: 0
2: 1
3: 18
4: 260
1112652869_1112652881 22 Left 1112652869 13:101417182-101417204 CCTCCTAAGCACCATGCCCAGGG 0: 1
1: 1
2: 2
3: 19
4: 219
Right 1112652881 13:101417227-101417249 ACTCTCTGAAAGGTTTACTTTGG 0: 1
1: 0
2: 1
3: 11
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112652869 Original CRISPR CCCTGGGCATGGTGCTTAGG AGG (reversed) Intergenic
900107989 1:993619-993641 CACTGGGCCTGGGGCTTAAGAGG + Intergenic
901104380 1:6743826-6743848 CGCTGAGCCTGGTGCATAGGAGG - Intergenic
904544716 1:31260243-31260265 TCCTGTGGATGGTGTTTAGGAGG - Intronic
905271213 1:36788957-36788979 CACAGGGCACGGTGCTTAGAAGG + Intergenic
906209984 1:44007403-44007425 CCCTGGGCAGAGGGCTTTGGGGG - Intronic
906823501 1:48954013-48954035 CCCCGAGCAGAGTGCTTAGGGGG + Intronic
912413137 1:109491386-109491408 CCCTGAGCATGGGGCTTAATGGG + Exonic
915575428 1:156773154-156773176 CCCGGGGTGTGGTGCTTAGGGGG + Intronic
915587620 1:156852643-156852665 CCCAGGGCAGGGAGCTGAGGTGG - Intronic
919755571 1:201064156-201064178 CCCAGGGCCTGGTGCAGAGGAGG - Intronic
919882612 1:201910664-201910686 CTCTGGGCAGTGTGCTCAGGGGG + Intronic
922542249 1:226428302-226428324 ACCAGGGCATGGTGCATAGTTGG + Intergenic
923171423 1:231421378-231421400 CCCCGGGCGTGTTGCTTGGGGGG + Exonic
924043677 1:240008030-240008052 CTTTGGGGAGGGTGCTTAGGTGG + Intergenic
924728980 1:246694977-246694999 TGCTGGGCATGGTGCTTGGCTGG + Intergenic
924772057 1:247087616-247087638 GCCTGGGCATGATGGTCAGGTGG - Intergenic
1062917095 10:1248850-1248872 CACTGTGCTTGGTGCTTTGGCGG - Intronic
1066096141 10:32074025-32074047 CCCAGGGCATGGTGTTTAGTAGG - Intergenic
1067720200 10:48722363-48722385 GCCTGTGCATGGTGCATCGGGGG + Intronic
1067753361 10:48986050-48986072 AGCTGGGCCTGGTGCTCAGGTGG - Intergenic
1070658010 10:78284392-78284414 CCCTCTGCATGGTGGTGAGGAGG + Intergenic
1070764372 10:79048108-79048130 CCCTGAGCAGGGTGCACAGGAGG + Intergenic
1071827658 10:89341184-89341206 AACTGGGCATGGGGCTTAGTTGG - Intronic
1073944710 10:108737326-108737348 CCTTGGGCATGGGGATTATGAGG - Intergenic
1074109022 10:110409473-110409495 GCCTGGTCATGGTGCTGATGGGG - Intergenic
1074684611 10:115949411-115949433 CTCTGGGCTTGGTCCTTATGTGG + Intergenic
1075106240 10:119542125-119542147 CCCTGGGCCTGGGGCGTCGGGGG - Intronic
1075736842 10:124669552-124669574 CCCAGGACCTGGTGCTCAGGTGG - Intronic
1075788555 10:125066974-125066996 ACCTGGGCCTGGTGGTCAGGCGG - Intronic
1075894614 10:125984169-125984191 CGGTGGGCATGGTGTGTAGGAGG - Intronic
1076616224 10:131756645-131756667 CCCTGGGCATGGTGGGGAAGTGG - Intergenic
1077649354 11:3955965-3955987 CTCTGGGCATACTGCTTATGGGG - Intronic
1081281716 11:41217407-41217429 CCTTGGGCAAGTTGCTTAAGGGG - Intronic
1082262523 11:50088210-50088232 GACAGGACATGGTGCTTAGGTGG + Intergenic
1083261635 11:61526250-61526272 CCCTGGGCAAGGTCCCTGGGAGG - Intronic
1083800757 11:65045075-65045097 CCCTCATCCTGGTGCTTAGGTGG - Exonic
1084491492 11:69481025-69481047 TGCTGGGCATGGGGCTGAGGTGG + Intergenic
1085505385 11:77055959-77055981 CCCTGGGGATGGTGGGGAGGTGG + Intergenic
1087180950 11:95142139-95142161 CCCTGGGCATGCCCCTTAGAGGG - Intergenic
1088682190 11:112253006-112253028 CACTGTGCCTGGTGCTGAGGGGG + Intronic
1088918061 11:114242050-114242072 CCCTGAGCATGGGGATTTGGAGG + Intronic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1090957930 11:131530195-131530217 CACAGGGCATGGTGCTTAGTAGG + Intronic
1091059714 11:132450088-132450110 GCCTGGGCAGGGTGCTTTGGAGG - Intronic
1091243214 11:134069076-134069098 CCCTCGACATGGCGCTGAGGCGG + Exonic
1093112184 12:15165524-15165546 CCTTGGGCAAGTTGTTTAGGTGG + Intronic
1095626192 12:44318091-44318113 TCCTGGGCATGTAGCATAGGGGG + Intronic
1095883565 12:47164927-47164949 CCCTGGGCAGTGTGCCTATGGGG + Intronic
1097145193 12:56935092-56935114 CCCTGGGCAAGATGATGAGGAGG + Intergenic
1100343798 12:93707474-93707496 CTCTGGGCAGGGGGCTTAGCTGG + Intronic
1103569603 12:121836113-121836135 CCCTGGCCTTTGAGCTTAGGTGG - Intergenic
1103836190 12:123823099-123823121 CCCAGGGAATGCTGCTGAGGAGG + Intronic
1103949975 12:124545268-124545290 CCCTGGGCCTGCTGCGGAGGTGG - Intronic
1105069769 12:133227422-133227444 CCCTGGGCATGTTGTCTGGGTGG - Intronic
1108598200 13:51968123-51968145 CCCTGAGCTGGGTGGTTAGGGGG - Intronic
1112186911 13:97136618-97136640 CCCACTGCAGGGTGCTTAGGGGG - Intergenic
1112652869 13:101417182-101417204 CCCTGGGCATGGTGCTTAGGAGG - Intergenic
1113537021 13:111076201-111076223 CCCTGGGAAGAGTGCTCAGGTGG + Intergenic
1115963576 14:38863069-38863091 ACCTGGGCATGGTGCAGAGAGGG + Intergenic
1116984222 14:51203088-51203110 TCCTAGAGATGGTGCTTAGGAGG + Intergenic
1119224998 14:72938241-72938263 CCCAGGGCATGTCGCTTTGGTGG + Intronic
1119879059 14:78085887-78085909 CCCAGGGCTTGGTGCATAGCAGG + Intergenic
1121438117 14:93932165-93932187 GGCTGGGCATGGCGCTTGGGGGG + Intergenic
1121604640 14:95231529-95231551 CCATGGACAGGGTGCTGAGGGGG - Intronic
1121607659 14:95253135-95253157 CAGTGGGCATGGAGCTCAGGAGG - Intronic
1122369118 14:101218476-101218498 CACTGGGAATGGTGATTATGTGG - Intergenic
1122816275 14:104315779-104315801 CCATGGGCATGGTGCTGTGGAGG - Intergenic
1124892463 15:33745766-33745788 CCCTGGGAATGGTGCTTCTCAGG - Intronic
1125541279 15:40471263-40471285 CCCTGGGCCGGGCGCTGAGGCGG + Exonic
1127616899 15:60695092-60695114 CTGTGCCCATGGTGCTTAGGAGG + Intronic
1128270897 15:66308534-66308556 CCCTGGGCTGGGTGCTCTGGGGG - Intronic
1128728497 15:70005169-70005191 CCCTGGGAATGGGGCTAAGAGGG + Intergenic
1128778472 15:70341950-70341972 CCCTGGGCAAGAGGCTGAGGTGG + Intergenic
1129070459 15:72946317-72946339 CCCTGGGCAGTGTGCTCAGGTGG - Intergenic
1129407161 15:75327495-75327517 GCATGGACATGGTGCTTTGGGGG + Intergenic
1129760071 15:78124164-78124186 CCCTGAGCATGGTGCTAGGGGGG + Intronic
1130925624 15:88383616-88383638 CCCTGGGAATGGTGCCTAGGTGG - Intergenic
1131902114 15:97099245-97099267 CCCTGTCCATGGTGCTATGGAGG - Intergenic
1132057091 15:98660476-98660498 CCCAGTGCCTGGTGCATAGGAGG + Intronic
1135345806 16:21687549-21687571 TCCTGGGCAAGGTGCTGAGGGGG + Exonic
1137940425 16:52678115-52678137 CTCTGGGCATGGTCTCTAGGTGG + Intergenic
1138549460 16:57739677-57739699 CCCTGGTCAGGCTGCTTAGAGGG + Intronic
1139312488 16:66039520-66039542 CACAGGGCATGGTACCTAGGAGG - Intergenic
1139614157 16:68079013-68079035 CCATGGGCCTGGTGCTAAGGTGG + Exonic
1139657281 16:68396595-68396617 CCCTGTGCTTGGAGCTCAGGGGG - Intronic
1139950184 16:70664710-70664732 ACCTGGCCATGGTGCTGACGCGG - Exonic
1141036472 16:80630660-80630682 CTCTGAGCATGGTGTTTTGGGGG - Intronic
1141600270 16:85121670-85121692 CCCTGGGCTGGGTGCCTCGGAGG - Intergenic
1142230633 16:88898605-88898627 CCCTGAGGATGGTGCTCATGGGG - Intronic
1142262256 16:89048481-89048503 CCCTGGGCAGTGAGCTCAGGAGG + Intergenic
1142286424 16:89173281-89173303 CCCAGGGCATGGTGGTGGGGAGG + Intronic
1144781306 17:17809868-17809890 GCCTGGGTCTGGGGCTTAGGCGG + Intronic
1145820050 17:27825455-27825477 ACCTGGGCATGGTGGTTAAGAGG + Intronic
1149494859 17:57110943-57110965 CCCTGGGCTCTGTGCTCAGGTGG + Intronic
1151758313 17:76087218-76087240 CCCTGGGACTGGAGCTCAGGGGG - Intronic
1151887294 17:76930690-76930712 CCCTGGCCTTGGTGTGTAGGAGG + Intronic
1151975990 17:77483745-77483767 CTCTGGGAATGGTGCGCAGGAGG + Intronic
1152536412 17:80952581-80952603 CCCTGAGACTGGTGCTTTGGAGG + Intronic
1153913196 18:9721865-9721887 CCCTGGGCATGCTGGTTGGGAGG + Intronic
1156243559 18:35276420-35276442 CACAGGGCTTGGGGCTTAGGAGG + Intronic
1157547376 18:48555849-48555871 CACTGGGCATGGGGAATAGGGGG + Intronic
1160027623 18:75231324-75231346 CCTGGGGCATGGTCCTTCGGAGG + Intronic
1160955003 19:1687062-1687084 CCCTGGGCTGGGGGCTTCGGGGG + Intergenic
1161292855 19:3504900-3504922 CACTGGGCATGATGCTTTCGAGG + Intergenic
1161993329 19:7697647-7697669 CCCTGAGCCTGGGGCATAGGCGG - Intronic
1163379601 19:16956390-16956412 GGCTGGGCATGGAGCTTGGGAGG - Intronic
1163561815 19:18023689-18023711 CCCTGGCCATGGTGCTTAGGAGG + Intergenic
1164754753 19:30681300-30681322 GCCTGTGCAAGGTGCTGAGGAGG + Intronic
1166713819 19:44953947-44953969 CCCTGGGCCTCATGCTTAAGTGG - Exonic
1166773033 19:45295859-45295881 CACTGGGTCTGATGCTTAGGAGG + Intronic
926856730 2:17264562-17264584 CCCTTGGCATACTGTTTAGGGGG + Intergenic
927217485 2:20676173-20676195 ACATGGGCATGGTGGTGAGGAGG - Intergenic
928311119 2:30210744-30210766 CCCTGGGCATGGGGGTGCGGTGG - Intergenic
930198064 2:48529178-48529200 CCCATGGCATGGTGCTTTGGAGG - Intergenic
932414728 2:71566678-71566700 CCCTGGGGCTGGTGGTTTGGAGG + Intronic
933110777 2:78397379-78397401 GCCTGGGTATGTTTCTTAGGTGG - Intergenic
933190417 2:79327958-79327980 CCCTGGGCATGGGGTTGCGGGGG + Intronic
935362037 2:102253586-102253608 ACCTGGTCATGGTGGTGAGGAGG - Intergenic
936347266 2:111684676-111684698 CCCTGTGCATGTGGCTTAGCAGG - Intergenic
936837966 2:116730981-116731003 CACTGGCCTTGGTACTTAGGTGG + Intergenic
937280992 2:120717046-120717068 GCCTGGGCATGGGGCTCCGGAGG - Intergenic
938173483 2:129103442-129103464 GCATGGGCCTGGTACTTAGGAGG + Intergenic
938365500 2:130729993-130730015 CCCTGGACATGGTGCTGACCAGG + Exonic
940990628 2:160092640-160092662 GCCTGGGCATGGAGCTGTGGAGG - Intergenic
942344398 2:174987249-174987271 CCTTGAACATGATGCTTAGGAGG - Intronic
945011063 2:205464204-205464226 CACTGTGCATTGTGCATAGGAGG + Intronic
945197070 2:207246669-207246691 ACCTGGGCATGGTACTATGGAGG - Intergenic
945295221 2:208163661-208163683 ACCTGGGGGTGGTGCGTAGGGGG + Intergenic
945976362 2:216274136-216274158 CCCTGGAAATGATGCTCAGGTGG + Intronic
946315704 2:218910414-218910436 CCCTGAGCAGAGTGGTTAGGAGG - Intergenic
947528318 2:230893121-230893143 CTCTGGGCAGGGTGTTTAGGTGG + Intergenic
947733025 2:232441482-232441504 CCCTGGGGATGGTGCCTTGTTGG - Intergenic
948579491 2:238974724-238974746 CTCTGGGAATGGGGCTTTGGAGG - Intergenic
948654488 2:239468418-239468440 CCCTGGGAAGGGTCCTGAGGTGG + Intergenic
948685440 2:239666881-239666903 CCCAGGGCATGGTGTTTGGCGGG - Intergenic
948747657 2:240107926-240107948 CCCTGGGCCTGGTGGGCAGGAGG + Intergenic
1168868255 20:1107498-1107520 CCCTGGGCAATTTTCTTAGGTGG - Intergenic
1168961538 20:1873430-1873452 CCCTGAGCTTTCTGCTTAGGAGG + Intergenic
1170766394 20:19292992-19293014 CCTTTGGCAAGGTGATTAGGAGG - Intronic
1172052323 20:32127540-32127562 CACTGTGCCTTGTGCTTAGGAGG + Intronic
1172276833 20:33684739-33684761 CACTGGGCATGGGGCCAAGGGGG + Intronic
1172319634 20:33986263-33986285 CTCTGGGCATGCTGCCTAGGGGG + Intergenic
1173643361 20:44618565-44618587 ACCTGGGCACGGTGCGAAGGTGG - Exonic
1175953621 20:62596771-62596793 CCGTGGGCATGGTGCATGGCGGG - Intergenic
1178163387 21:29944456-29944478 CACTGTGCCTGGTGCTTAGAGGG + Intergenic
1178240421 21:30893530-30893552 CCCTGGGCATGCTGCCTATAAGG + Intergenic
1180981614 22:19880739-19880761 CCCCGGACATGGTGCTGACGTGG - Intronic
1181906253 22:26199272-26199294 CCCAGGGCCTGTTGCTTAGTAGG + Intronic
1183026184 22:35067295-35067317 CCCTGGGGCTGGTCCTTTGGAGG - Exonic
1183038632 22:35159511-35159533 CCCTGGGGATGGAGCTTTTGGGG + Intergenic
1184458418 22:44624260-44624282 GCCTGGGCCTGGTGCTGAGCTGG - Intergenic
1184554317 22:45225056-45225078 CCCTGGTCATGGTCCAAAGGTGG + Intronic
949543318 3:5051139-5051161 CCCAGTGCCTGGTACTTAGGAGG - Intergenic
950097308 3:10337745-10337767 CCCAGGGCGTGGTGGTCAGGGGG - Intronic
950549601 3:13658170-13658192 CACTGTTCATGCTGCTTAGGAGG - Intergenic
950631223 3:14283448-14283470 CCCTGGGGATGGTGCAGGGGTGG + Intergenic
953006020 3:38980038-38980060 CCCTGGGCCTGGTGCTGGTGTGG - Intergenic
953505531 3:43482540-43482562 ACCTGGGTATGGTGTTTTGGGGG - Intronic
953746218 3:45575966-45575988 CCCTGGCAATGGTGCTAAGCTGG + Intronic
954762916 3:52890048-52890070 CCCTTAGCCTGGTGCTCAGGTGG + Intronic
956511070 3:69994016-69994038 CCCTGGGCAGGGTTTTTAGTAGG + Intergenic
956663525 3:71621248-71621270 CCCTTTCCATGGTGCTTAGAGGG + Intergenic
958497562 3:94864288-94864310 GCCTGGGCATGAAGTTTAGGGGG + Intergenic
958860481 3:99439200-99439222 CCAGGGGCATGGTGATTAGAAGG + Intergenic
960447271 3:117763704-117763726 CCCTGGGCATGTTTCTGAGCCGG + Intergenic
962023827 3:131527023-131527045 CCCTGGCCATGGAGCTGAGCCGG + Intergenic
962871902 3:139504135-139504157 ATCTGGGCATGGTGCTTTTGTGG + Intergenic
968658721 4:1789906-1789928 CCCTGGGTATGGGCCTCAGGAGG + Intergenic
968817569 4:2829746-2829768 CGGTGGGCATGGTGCTCAGAGGG - Exonic
968948200 4:3676542-3676564 CACTGGGCATGGGGCTAATGTGG + Intergenic
969606429 4:8204463-8204485 CCCTGGCCATGGTGTTCTGGAGG + Intronic
973724673 4:53763572-53763594 CCCTGGGCAAGGCCCTTGGGTGG + Intronic
973925288 4:55730766-55730788 CACTGAGCATGGAGCTTGGGAGG - Intergenic
978342658 4:107734678-107734700 CCGTGAGCATGATGTTTAGGAGG - Intergenic
983720955 4:170850738-170850760 CAGTGGGCATGGTGTTGAGGAGG + Intergenic
984609914 4:181826533-181826555 CCCTGGCCCTGGTGCTTAGTAGG - Intergenic
985041958 4:185899607-185899629 GCCTGGGCATGTTGCGTAGTTGG - Intronic
987669751 5:20991070-20991092 GCCTGGGCATGGAGCAGAGGGGG - Intergenic
988451427 5:31347410-31347432 CCCAGGGCATGGAGGTTAAGAGG + Intergenic
989103735 5:37841928-37841950 CCCTGGGCATTGTGCTGATTGGG + Intergenic
992424346 5:76640721-76640743 CTCTGAGCTTGGTGCTGAGGTGG - Intronic
995388725 5:111615854-111615876 CCCTGGGCATGGAGCAGAGAGGG + Intergenic
997043158 5:130280977-130280999 AGCTGGGCATAGTGGTTAGGAGG + Intergenic
1001241752 5:170076596-170076618 CCATGAGCCTGGTGCTTACGGGG + Intronic
1001525977 5:172429233-172429255 CCCTGGCCATGTTGCTGAGGTGG + Intronic
1007559927 6:42798822-42798844 CTCTGGGCATGCTGCCTATGGGG - Intronic
1007628388 6:43259348-43259370 CCGGGGACAGGGTGCTTAGGAGG - Intronic
1008650344 6:53555014-53555036 CCCTTGGCTTAGTGCTTTGGAGG - Intronic
1008814997 6:55554708-55554730 CCCTGGCCATGGTGCCTAAAGGG - Intronic
1013095958 6:106945003-106945025 CCCTGGGCCTGCTGCTTTTGGGG + Intergenic
1013296773 6:108764662-108764684 CGCTGGGCAGGCTGCTGAGGAGG + Intergenic
1015582265 6:134738511-134738533 CTCTGGGCTTGGCACTTAGGAGG - Intergenic
1015772251 6:136781198-136781220 TCCTGGGCATGATGGTTAGATGG - Intronic
1019326225 7:439591-439613 CCCTGGGCCTGGACCTAAGGGGG + Intergenic
1019384359 7:746365-746387 CCCTGGGCATGTTGGGTGGGGGG - Intronic
1019384376 7:746417-746439 CCCTGGGCATGTTGGGTGGGGGG - Intronic
1019384393 7:746469-746491 CCCTGGGCATGTTGGGTGGGGGG - Intronic
1019384440 7:746635-746657 CCCTGGGCAAGGTGGGTGGGGGG - Intronic
1019384456 7:746684-746706 CCCTGGGCAGGGTGGGCAGGGGG - Intronic
1021958680 7:25852144-25852166 CCCTGGTCATGCTGCTTTTGGGG + Intergenic
1022514824 7:30968931-30968953 CCCTGGGTATGGGGCCTAGGAGG + Exonic
1023999530 7:45181478-45181500 CCCTGGGGATGGTTGTTGGGGGG + Intronic
1024237663 7:47410108-47410130 CCCTGGGCTTGTTTCCTAGGAGG - Intronic
1024615634 7:51109185-51109207 TCCTGGGCATGGTGCTCCGCAGG + Intronic
1026771283 7:73201551-73201573 ACCTGGGGTTGGTGCTCAGGTGG - Intergenic
1026978371 7:74512544-74512566 CCCTGGGGCTGGGGCTAAGGGGG + Intronic
1027012150 7:74754948-74754970 ACCTGGGGTTGGTGCTCAGGTGG - Intronic
1027075891 7:75191106-75191128 ACCTGGGGTTGGTGCTCAGGTGG + Intergenic
1028087746 7:86657204-86657226 CACTGGGCAAGGTACTGAGGAGG + Intronic
1030064884 7:105651993-105652015 CCCAGGGCATGGAGCTCAGAAGG + Intronic
1031987184 7:128170782-128170804 CCCTGGGTCAGGTGCTTAGCAGG + Intergenic
1032526694 7:132583242-132583264 CACTGGGCCTGGTGCTTGGTGGG - Intronic
1035631589 8:1110897-1110919 CCCTGTGGATGGTGCTTTTGGGG + Intergenic
1035784797 8:2252070-2252092 CCCTGGGCTTGGTGCAGGGGTGG + Intergenic
1035808010 8:2469651-2469673 CCCTGGGCTTGGTGCAGGGGTGG - Intergenic
1036609208 8:10335051-10335073 GCCTGGGCATGGTGCGTTGCAGG + Intronic
1037740937 8:21608804-21608826 CACTGGGAATGGTGCTAAGAAGG - Intergenic
1039845693 8:41324028-41324050 TCCTGGGGATGGTGCTGATGGGG - Intergenic
1040758054 8:50804797-50804819 GCCTGGGCATGGAGCGGAGGGGG - Intergenic
1045984931 8:108239057-108239079 CCTTGGGCATGGAGCTTGGAAGG + Intronic
1049174762 8:141185025-141185047 ACATGGGCCTGGCGCTTAGGAGG + Intronic
1049707723 8:144050623-144050645 CCCTGGGTATCGCGCTTGGGGGG + Intergenic
1049707746 8:144050690-144050712 CCCTGGGTATCGTGCTTAGGGGG + Intergenic
1050722735 9:8609274-8609296 CACTGGACAGGGTGTTTAGGAGG + Intronic
1051259786 9:15251916-15251938 CCCTGTGCCTGGTGCATAGTAGG - Intronic
1053544013 9:39003964-39003986 CCCTGTGCATGGTGACTTGGGGG - Intergenic
1053808447 9:41827461-41827483 CCCTGTGCATGGTGACTTGGGGG - Intergenic
1054622145 9:67359967-67359989 CCCTGTGCATGGTGACTTGGGGG + Intergenic
1055203119 9:73692256-73692278 CCCTGTCCATGGTTCTTAGCAGG - Intergenic
1059229770 9:112708807-112708829 AGCTGGGCATGGGGCTGAGGTGG - Intronic
1059762108 9:117347935-117347957 CCCTGTGCATGCTGCTTAGTTGG + Intronic
1060158833 9:121340890-121340912 CTCTGGCCTGGGTGCTTAGGGGG + Exonic
1060240533 9:121898655-121898677 CCCTGGGCATGGCACTTAATGGG + Intronic
1062285558 9:135771122-135771144 CCCTGGGCCTGCTCCTTTGGCGG + Intronic
1186034333 X:5404527-5404549 CCCTTGGCTTGGTGATTTGGGGG + Intergenic
1187561926 X:20411536-20411558 CCCTGGGGAGGTTGGTTAGGTGG + Intergenic
1187822434 X:23302412-23302434 CCATGGGGAGGGTGCTGAGGAGG - Intergenic
1188113921 X:26221903-26221925 CCCGGGGCATGCTTCTGAGGTGG - Intergenic
1193813446 X:86078752-86078774 CCTTGGGCATGATGCTTCAGAGG + Intergenic
1195468566 X:105208891-105208913 CAGTGTGCATGGTGCTTAAGTGG - Intronic
1197621062 X:128749498-128749520 CCCTGGGAATGGGGCTTTGAAGG - Intergenic
1199322407 X:146455897-146455919 GCCTGGGCATGGAGCATAGGTGG - Intergenic