ID: 1112655513

View in Genome Browser
Species Human (GRCh38)
Location 13:101448425-101448447
Sequence GGCTATGGCAATAGTGTACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112655513 Original CRISPR GGCTATGGCAATAGTGTACG AGG Intergenic
900552771 1:3264862-3264884 GGCTATGGAAATAGGGTCCAAGG + Intronic
901675575 1:10881744-10881766 GGCAAGGGCAAGAGTGGACGTGG - Intergenic
915973174 1:160367917-160367939 GGGGATGGCAATAGTGTGGGAGG - Intronic
921100491 1:211924548-211924570 GGCTCTGGCAAGAGTCTACTCGG - Intergenic
922751399 1:228071726-228071748 GTGTAGGGCAATAGTGTAGGGGG + Intergenic
922751403 1:228071752-228071774 GTGTAGGGCAATAGTGTAGGAGG + Intergenic
1066532915 10:36359871-36359893 GGCTATGGAAATAGTTCACTTGG + Intergenic
1080181133 11:29427487-29427509 GGCTGTGGCATTAGTGTCCCTGG + Intergenic
1084043799 11:66557596-66557618 GGCTGTGGCCAGAGTGTAGGTGG - Intronic
1087479806 11:98684959-98684981 GGTAATGGCAACAGTGTACAAGG + Intergenic
1087828993 11:102798673-102798695 TGCTATCGCAATAGGGTACCAGG - Intergenic
1091278527 11:134368882-134368904 GTCTTTGGCAATAGAGTACCTGG + Intronic
1097854859 12:64451935-64451957 GGCGAGGGCAACAGTGGACGGGG + Exonic
1102328693 12:112011621-112011643 GGGTATGGCAATAGTCTAGTTGG - Intronic
1102796817 12:115696095-115696117 GGCAATAGCAAGAGTGTACCTGG + Intergenic
1107600291 13:42005954-42005976 GGTTATGGCAGTAGAGTAGGTGG - Intergenic
1112655513 13:101448425-101448447 GGCTATGGCAATAGTGTACGAGG + Intergenic
1116141326 14:40998575-40998597 GACTATGGCAATAGAGTATCGGG + Intergenic
1129268386 15:74406960-74406982 GGCTGAGGCATTAGTGTAGGGGG + Intergenic
1135823725 16:25707592-25707614 GGCTTTGGCAATAGAGGAAGAGG + Intronic
1157820893 18:50767589-50767611 AGCAATGGCAGTAGTGTTCGTGG - Intergenic
1158919716 18:62177905-62177927 GGCTAAGGCAGAAGTGTAGGTGG - Intronic
1160764910 19:803255-803277 GGCCGTGGAGATAGTGTACGTGG + Intronic
926646268 2:15292868-15292890 TGAAATGGCAATAGTGTACAGGG - Intronic
928471873 2:31582801-31582823 GGCTATGGCAATTGAGGACAGGG - Intergenic
928968742 2:37004441-37004463 GGCTTTGGGAATAGTGCAGGGGG - Intronic
931114102 2:59145748-59145770 GGCTATTGCAATAGTATAGGTGG - Intergenic
945750706 2:213778935-213778957 GGCTATGTCATTAGTTTATGGGG - Intronic
1170182800 20:13551910-13551932 GGCCATGGCAATTTTGTAAGGGG + Intronic
1173198258 20:40933744-40933766 GGCTATGGCTAAAGTGTAAGAGG - Intergenic
1173696913 20:45025053-45025075 AGCTTTGGCAAGAGTGTACCTGG + Exonic
1178427652 21:32491807-32491829 GGCTATGGCAGGAGAGTAGGAGG + Intronic
965931531 3:174049452-174049474 CACCATGGCAATAGTGTAGGTGG + Intronic
969507471 4:7597202-7597224 GGCTATTGCAATAGGGAAGGAGG + Intronic
969507475 4:7597223-7597245 GGCTATTGCAATAGGGAAGGAGG + Intronic
969507532 4:7597481-7597503 GGCTATTGCAATAGGGGAGGGGG + Intronic
971226007 4:24752132-24752154 GGCTATGCCAATGGTGTCCATGG + Intergenic
979341082 4:119525067-119525089 GGTTATAACAATAGTGTACAGGG - Intronic
989613786 5:43319629-43319651 GGCTATGGCAATACTAGTCGGGG - Intergenic
994940239 5:106314325-106314347 GGTCATGGCAATAGTTTAGGAGG - Intergenic
995824018 5:116272529-116272551 GGCTATGGCAACAGTGTTCTGGG - Intronic
996277974 5:121691540-121691562 GGCTATGGCAGTAGGGTAGAGGG + Intergenic
997845363 5:137281294-137281316 GTCTATGCCACTGGTGTACGTGG - Intronic
1007329697 6:41096000-41096022 GGATATTGCAATAGTGCAAGTGG - Intronic
1010551747 6:77231818-77231840 GGCAATGGCAATGTTGTAAGAGG + Intergenic
1012677288 6:102132652-102132674 GGATATGGCAATAGTGTGTTAGG - Intergenic
1023812674 7:43924540-43924562 GGCCATGTCAATAATGTAGGAGG + Intronic
1025823801 7:64994996-64995018 GACTGTGGCAACAGTGGACGAGG - Intronic
1047531050 8:125675607-125675629 GGCTCTGGCAATAGAGAACATGG - Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1189847466 X:45150308-45150330 GGCCAGGGCAAGAGTGTACATGG + Exonic
1192072481 X:67955865-67955887 GGCTATTGCAACAGTCTAGGCGG - Intergenic
1192072593 X:67956954-67956976 GGCTATTGCAACAGTCTAGGCGG - Intergenic
1199937969 X:152595801-152595823 AGCTATTGCAATATTGTAAGAGG - Intergenic