ID: 1112659896

View in Genome Browser
Species Human (GRCh38)
Location 13:101496012-101496034
Sequence TTGTGGAATTTGAAGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112659896 Original CRISPR TTGTGGAATTTGAAGCTGGT GGG (reversed) Intronic
900885947 1:5415527-5415549 TTGGTGAATTTGAGGCTGCTTGG - Intergenic
901357518 1:8664065-8664087 TTGTGGACTTTGCAGTTAGTGGG - Intronic
901544061 1:9942656-9942678 TTGTGCAATTTGAGACCGGTCGG - Exonic
905797260 1:40822755-40822777 TAGTGGATATTGCAGCTGGTTGG + Intronic
905966951 1:42106462-42106484 CTGTGGAATTACAAGCTGGGTGG - Intergenic
906726747 1:48049869-48049891 TGGAGGAATTTGAGGCTGATGGG + Intergenic
907246079 1:53110009-53110031 TTTGGGAATGGGAAGCTGGTGGG - Intronic
907250045 1:53132067-53132089 TTAGGGAACTTGAGGCTGGTGGG + Intronic
908998204 1:70184740-70184762 TTGTACAATTTGGGGCTGGTGGG - Intronic
910018039 1:82551311-82551333 TTTTGGGATTTTATGCTGGTGGG - Intergenic
914665583 1:149829743-149829765 CTTTGGAATTTTAAGTTGGTTGG + Intergenic
914670182 1:149864051-149864073 CTTTGGAATTTTAAGTTGGTTGG - Intronic
915216522 1:154344128-154344150 TTGTGGTATTTTCAGCTGCTGGG + Exonic
921105037 1:211968569-211968591 TTGTGGCAATTGCAGGTGGTGGG + Exonic
921331832 1:214046662-214046684 AACTGGAATTTGAAGCGGGTGGG + Intergenic
922889905 1:229053829-229053851 ATGTGGAAATGGAAGCTGGGAGG - Intergenic
923122016 1:231000980-231001002 TTGCAGCATTTGAAGCTGGGAGG + Intergenic
1063506857 10:6607435-6607457 GTGTGGTATGTGAGGCTGGTGGG - Intergenic
1064701071 10:18022778-18022800 TGGTGTAATTTGAGCCTGGTCGG + Intronic
1066692666 10:38046140-38046162 TTCTAGAATTTGAAGCTGTAGGG + Intronic
1068972935 10:62978157-62978179 TTGTGAAAGTTGAATCTAGTTGG - Intergenic
1071482094 10:86072334-86072356 TTCTGCAATTTGAAACAGGTAGG + Intronic
1071541008 10:86483959-86483981 TTGGGGAAGTTGAGGCAGGTGGG - Intronic
1071859610 10:89658801-89658823 CTGAGGAATTTGTAGCTGGTTGG - Intergenic
1074435163 10:113427593-113427615 TTTTAGAATTTGAAACTGGGAGG - Intergenic
1074839423 10:117334253-117334275 TTTGGGAGGTTGAAGCTGGTGGG + Intronic
1077028934 11:454855-454877 CTGTGGAACTTGGTGCTGGTGGG + Intronic
1077988286 11:7377569-7377591 TTTTTGCGTTTGAAGCTGGTGGG - Intronic
1079396575 11:20068852-20068874 TTGTTGAATTGAATGCTGGTTGG - Intronic
1080172801 11:29326164-29326186 ATGTGGAAATTGAAGATGATGGG + Intergenic
1081372845 11:42325190-42325212 ATGTGGAATATGAGGCTGGATGG + Intergenic
1083547470 11:63559559-63559581 TTGGAGAATTTAAAGCTGGAGGG - Intronic
1087424340 11:97969335-97969357 TTCTGGAAATTGAATCAGGTGGG - Intergenic
1088827091 11:113505201-113505223 TTGTGTCATCTGAATCTGGTTGG + Intergenic
1090000140 11:122949318-122949340 TGGAGGAATTTTAAACTGGTTGG + Intronic
1090056111 11:123426520-123426542 AAGTGGAATTTGAGGCTGGCAGG - Intergenic
1090698952 11:129278387-129278409 TTGTGAAACTTGAAGATGGAAGG - Intronic
1090751063 11:129746970-129746992 CTGTGGAAGTTGCAGATGGTGGG - Intergenic
1092808054 12:12245727-12245749 TTGAGAAAGTTGAAGCTGTTGGG + Intronic
1092830714 12:12441871-12441893 TTGAGAAATGTGAAGCTGGATGG + Intronic
1093930159 12:24948390-24948412 TTGTGGAAATTAAAGCTTCTAGG - Intronic
1095282650 12:40374013-40374035 TTTTAAAGTTTGAAGCTGGTAGG + Intergenic
1096470302 12:51871449-51871471 TTTTGGAGTTTGATCCTGGTGGG - Intergenic
1097345008 12:58481482-58481504 ATGTGGAATTTGAAACTGAATGG - Intergenic
1099031829 12:77535778-77535800 TTGTTGAATCTGAAACTGTTCGG + Intergenic
1099225994 12:79969842-79969864 TTGTGGAAGTTGAGACTGGAAGG + Intergenic
1099594235 12:84637961-84637983 TTATTGGCTTTGAAGCTGGTGGG + Intergenic
1101520031 12:105474129-105474151 CTGTGGCATTTGAAGCTGCTGGG + Intergenic
1102338852 12:112105916-112105938 TTGTTGAATTTTTGGCTGGTGGG + Intronic
1107895582 13:44959434-44959456 TTGTGTGATTTGAAGCTAGAAGG - Exonic
1109742582 13:66574274-66574296 TTGAGGAGACTGAAGCTGGTTGG - Intronic
1109793203 13:67276655-67276677 TTGTGAATTTTGTAGGTGGTAGG - Intergenic
1109882185 13:68494313-68494335 ATGAGGAATTTGACTCTGGTTGG - Intergenic
1109909452 13:68890661-68890683 TAGAGGAAGTTGCAGCTGGTGGG + Intergenic
1110428469 13:75396143-75396165 ATGTGAAATTTGCAGCTTGTGGG - Intronic
1112659896 13:101496012-101496034 TTGTGGAATTTGAAGCTGGTGGG - Intronic
1113275071 13:108719382-108719404 TTGTGGAATTATAAGCAGTTTGG - Intronic
1113389131 13:109879004-109879026 TATGGGAATTTGCAGCTGGTGGG + Intergenic
1116191028 14:41666732-41666754 TTGTGGAATATGAAGTTCTTTGG + Intronic
1117580697 14:57148794-57148816 TTATGAAAATTGAAGGTGGTTGG - Intergenic
1117695835 14:58361836-58361858 TTGTGGAATTTGCAGCATTTTGG + Intronic
1121788798 14:96683288-96683310 GTGTGGATTTTGGAGCCGGTTGG - Intergenic
1122025535 14:98873138-98873160 TTGAAGGATTTGAAGCTGGGAGG - Intergenic
1122229436 14:100298280-100298302 TTGGGGAATTTCCAGCTGGAGGG + Intronic
1122368405 14:101212930-101212952 CTTTGTAATTTGAAGCTTGTTGG + Intergenic
1123630364 15:22256816-22256838 TGGTGGGATTTAAAGGTGGTTGG + Intergenic
1125280758 15:38040282-38040304 TTGTGGAAGTTGTAGCAGGATGG - Intergenic
1125391414 15:39196616-39196638 CTGTGGAATTTCAACCTGGTTGG + Intergenic
1125437929 15:39667900-39667922 TAGTGAAAGTTGAGGCTGGTGGG + Intronic
1125783422 15:42292136-42292158 CTGTGAAATTGGAGGCTGGTGGG + Intronic
1127104218 15:55595957-55595979 TTGTGGAATCTGATGATGGATGG - Intergenic
1134915180 16:18063299-18063321 GTGTGGAATTTGCAGCTTGGCGG - Intergenic
1136445473 16:30315114-30315136 TTTTGGAATTTGAAGATAATGGG - Intergenic
1137792141 16:51184212-51184234 TTGTGGAAATAGAATCTTGTGGG + Intergenic
1138143675 16:54589415-54589437 CTTTGGAAATTGCAGCTGGTTGG - Intergenic
1138894543 16:61187717-61187739 TTGTTGACTTTGAAGATGGAAGG - Intergenic
1141204314 16:81921658-81921680 TTGTGTAATTTCATGCAGGTAGG + Intronic
1141972721 16:87493826-87493848 TGGTGGGATTTAAAGGTGGTTGG - Intergenic
1144839581 17:18177635-18177657 TGGTGGGATTTGAACCTGGATGG - Intronic
1150024136 17:61653972-61653994 TTCTGAAATTTGAATATGGTAGG - Intergenic
1151508900 17:74546395-74546417 CTGTGGGATTTTAACCTGGTTGG - Intergenic
1152619469 17:81355004-81355026 TTCTGTCATTTGCAGCTGGTCGG - Intergenic
1203171913 17_GL000205v2_random:156353-156375 TTCTGGAATGTGAATATGGTGGG + Intergenic
1156978182 18:43251627-43251649 TTGTAGAATTTGTAACTGATGGG - Intergenic
1158453610 18:57587677-57587699 TAATGCAATTTGAAGCAGGTGGG + Intergenic
1160456010 18:79001076-79001098 TACAGGGATTTGAAGCTGGTTGG - Intronic
1161428203 19:4216124-4216146 TGGGGGAGTTTGAAGCTGGGAGG + Intronic
1163384510 19:16991315-16991337 TAGTGGAATTTGCAGCCAGTAGG + Intronic
1165725645 19:38110763-38110785 TTGGGGGATTTGCAGCTGGTAGG - Intronic
1168332919 19:55580259-55580281 GGGTGGGATTTGAAGCCGGTAGG + Intronic
1168427826 19:56253073-56253095 CTGTGGACTTAGAAGCTGGGAGG + Intronic
1168552665 19:57310712-57310734 TGGTGGATTGGGAAGCTGGTTGG - Intergenic
927201967 2:20583558-20583580 CTCTGGACTTTGAAGCTGGAAGG - Intronic
931072727 2:58672014-58672036 TTGTGTAATTAGAATATGGTTGG + Intergenic
931766993 2:65465837-65465859 TTTTGCAATTAGAGGCTGGTTGG - Intergenic
932747328 2:74344715-74344737 TTAGGGAATTTCCAGCTGGTTGG + Intronic
933121861 2:78547839-78547861 TTGGTGGTTTTGAAGCTGGTGGG + Intergenic
933162577 2:79042145-79042167 TTGTGGAAGTTGAAAGTGGGAGG - Intergenic
935680946 2:105636408-105636430 TTGTTGATATTGCAGCTGGTTGG + Intergenic
935839255 2:107091234-107091256 TTGTAGCATTTGAGGCTGGATGG + Intergenic
936142307 2:109950844-109950866 GTGTGGAAATAGAAGCTGCTGGG + Intergenic
936178997 2:110248803-110248825 GTGTGGAAATAGAAGCTGCTGGG + Intergenic
936202381 2:110420629-110420651 GTGTGGAAATAGAAGCTGCTGGG - Intronic
937839980 2:126515111-126515133 TTTTGGAATTTGTAGCTGGTGGG - Intergenic
939155170 2:138516525-138516547 TCAAGGAATTTGATGCTGGTAGG + Intronic
939513203 2:143132793-143132815 TTATGGAATTTGAAGAAGTTGGG - Intronic
939675282 2:145064696-145064718 TTTAGGAATTTGTTGCTGGTTGG - Intergenic
939703554 2:145423171-145423193 TTGTTGAATTTGGAGGGGGTGGG - Intergenic
940078940 2:149778194-149778216 TGGTGGAAGCTGAAGCAGGTGGG + Intergenic
940793289 2:158050751-158050773 TTATGGAATTTGAAACAGGGTGG + Intronic
942831837 2:180245817-180245839 TTCTGGATTTTGAAGCTAATCGG + Intergenic
943352382 2:186811126-186811148 TTTGGGAATCTGAAGCAGGTAGG - Intergenic
945002725 2:205368757-205368779 TTGTGGAACATGAGACTGGTAGG + Intronic
948555569 2:238807819-238807841 TTGTGGGATTTGTCGCAGGTAGG + Intergenic
1169640692 20:7747532-7747554 TTGTTGAAGATGAGGCTGGTGGG + Intergenic
1170295514 20:14820314-14820336 TTCTGGTATCTGAAGGTGGTGGG + Intronic
1170478437 20:16740899-16740921 TTGTTGAATTTGAAAATGATGGG + Exonic
1171005264 20:21458627-21458649 ATTTGGAATTTCAATCTGGTTGG + Intergenic
1172873569 20:38150676-38150698 TTGGGAACTGTGAAGCTGGTTGG - Intronic
1176327896 21:5518190-5518212 TTCTGGAATGTGAATATGGTGGG + Intergenic
1176362129 21:6006500-6006522 TAGAGGAATTTGAAGCCAGTGGG - Intergenic
1176399861 21:6302761-6302783 TTCTGGAATGTGAATATGGTGGG - Intergenic
1176437296 21:6686343-6686365 TTCTGGAATGTGAATATGGTGGG + Intergenic
1176461558 21:7013413-7013435 TTCTGGAATGTGAATATGGTGGG + Intergenic
1176485119 21:7395191-7395213 TTCTGGAATGTGAATATGGTGGG + Intergenic
1178885317 21:36480261-36480283 TGGTGGAATGTGGAGCTGGACGG + Intronic
1179761389 21:43532045-43532067 TAGAGGAATTTGAAGCCAGTGGG + Intronic
949136996 3:579783-579805 CAGTGGAACCTGAAGCTGGTGGG + Intergenic
953106054 3:39880209-39880231 TTGAGGAATTTGACCCTGGGGGG - Intronic
955496277 3:59536342-59536364 TTGTTGAATTTTAAAATGGTGGG + Intergenic
957705638 3:83778579-83778601 TTGTGTAATTTTAATTTGGTGGG + Intergenic
959598609 3:108154085-108154107 TTGTTGAATTTGAAGCATATTGG - Intergenic
960022214 3:112967540-112967562 TCATGGAATTTAAATCTGGTGGG - Intronic
960586881 3:119328301-119328323 TTGTGGAATTTGGGGTTGGAAGG + Intronic
961778208 3:129305306-129305328 TTTTGGAAAGTGATGCTGGTGGG + Exonic
962046207 3:131761802-131761824 ATGTGGAAATAGAAGCAGGTAGG + Intronic
962479191 3:135783850-135783872 TTGTGGAATTTTGAGCTAGCAGG - Intergenic
963016308 3:140827656-140827678 TTGTGGAACTGGAAGATGTTTGG - Intergenic
963040869 3:141068921-141068943 TTGGGGTATTTTAAGCTTGTGGG + Intronic
963921509 3:150910175-150910197 TTGGGGGATTGGAAACTGGTTGG + Intronic
968286916 3:197514163-197514185 TTGTGGACATTGGAGCTGCTGGG + Intronic
969139288 4:5054545-5054567 TTGTGGAGTATGAAGCTGAAAGG + Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
969936036 4:10682563-10682585 TTGTGTAATTTGAAACTGGGAGG - Intronic
970459468 4:16258251-16258273 TAGTGGATTTTTAACCTGGTTGG + Intergenic
970516207 4:16833511-16833533 TGGTGGAAAGTGAAGCTGTTGGG - Intronic
971451896 4:26808434-26808456 TTAAGAAATTTGAAGCTGGCTGG + Intergenic
971662114 4:29432286-29432308 TGGTGGAAGGTGAAGCAGGTGGG - Intergenic
974995030 4:69144839-69144861 TTGTGGAATCTGAACCAGGGCGG - Intronic
975149954 4:71009793-71009815 TTGTGGAATATGAGGATGGTTGG + Intronic
976633830 4:87267306-87267328 TTGTGCTATTTGAAGCTATTTGG - Intergenic
976859799 4:89649738-89649760 TTGTGGGATTTGAGGCTTTTGGG - Intergenic
977133685 4:93273711-93273733 TTGCTGAATTTGAAGATGGAGGG + Intronic
979193177 4:117888709-117888731 TAGTGCAATGTGAAGCTGGTTGG + Intergenic
980671350 4:136010750-136010772 TTGTGGAATATAAACCTGGGAGG - Intergenic
981089897 4:140721628-140721650 CTGTGGAATCTGAAGTAGGTAGG - Intronic
982577438 4:157132518-157132540 CTGTAGAACTTAAAGCTGGTGGG - Intronic
983564483 4:169134941-169134963 TTGTGGCATTTTTAGGTGGTAGG - Intronic
985716414 5:1464453-1464475 TACTGGAAATTGCAGCTGGTCGG + Intronic
985863091 5:2489760-2489782 TTGTGAAAGTGGAAGCTGATTGG - Intergenic
986081384 5:4398432-4398454 GTGTGGAATTTAAAGTTGTTGGG + Intergenic
989689193 5:44120114-44120136 CTATGGAATTTGCAACTGGTGGG - Intergenic
992117568 5:73555334-73555356 TTGTGGAACTTGGATCTAGTTGG - Intronic
997739798 5:136243458-136243480 CTGTGGAATTTTGAGCTTGTAGG - Intronic
998033757 5:138895424-138895446 TTGTGGGATGTGGAGATGGTGGG + Intronic
998376899 5:141697031-141697053 AGGTGGCATTTGAACCTGGTTGG + Intergenic
999592959 5:153169085-153169107 TTGCAGAATTAGAAACTGGTAGG + Intergenic
1000522144 5:162308538-162308560 TAGGGGAATTTCAAGCAGGTTGG - Intergenic
1000929733 5:167236725-167236747 TTATGGAATTGGAAGCTCATGGG + Intergenic
1001925484 5:175633130-175633152 TTGTGAAATCTGAAGTGGGTGGG - Intergenic
1002609471 5:180405307-180405329 TTGGGGAATTGTAAGTTGGTGGG - Intergenic
1003263583 6:4547103-4547125 TTGTAGAATTTTAATCTGGAAGG - Intergenic
1004479727 6:16007080-16007102 TTCTGGAGCTTGAAGCTGGCTGG - Intergenic
1005868335 6:29954614-29954636 TTGTGGGCTTTGAAAATGGTGGG + Intergenic
1007008140 6:38387127-38387149 TTGTTTAATTTGAAGTTTGTAGG - Intronic
1009799111 6:68510476-68510498 TTGTGGAATATAAAACTGATTGG - Intergenic
1010403583 6:75476790-75476812 TTTTGGAATTTGGTGCTGTTAGG - Intronic
1014015768 6:116528288-116528310 TTGTGGATTTTGAGACTGATTGG - Intronic
1015389731 6:132668014-132668036 ATGTGGAATTTGGGGCTGGCAGG + Intergenic
1015618335 6:135103205-135103227 TTGTGGATTTTTAAGCAGGGAGG - Intergenic
1015957078 6:138610055-138610077 TTGTGGAAGTTGAAACAGGTGGG - Intronic
1016372712 6:143391476-143391498 TTGTGGAATATGGAGCTGTTTGG + Intergenic
1016901972 6:149112093-149112115 TTGTTGAATTTGAAAATGATGGG - Intergenic
1019212889 6:170420974-170420996 GTGTAGAATCTGAAGCCGGTCGG + Intergenic
1019700712 7:2474030-2474052 GTGTGGAACCTGAGGCTGGTTGG + Intergenic
1019855750 7:3605255-3605277 TTGTGGAATTTTAGGCTGTCAGG + Intronic
1022241132 7:28513652-28513674 AGGTGGAATTTGACGCTGGAAGG + Intronic
1024536285 7:50437250-50437272 ATGGGAACTTTGAAGCTGGTTGG - Intergenic
1024987626 7:55209043-55209065 TTGTGTAGGATGAAGCTGGTGGG + Exonic
1025841786 7:65156426-65156448 TTATATAATTTGAAGCTGTTTGG - Intergenic
1025881262 7:65539550-65539572 TTATATAATTTGAAGCTGTTCGG + Intergenic
1025892177 7:65663065-65663087 TTATATAATTTGAAGCTGTTTGG - Intergenic
1029975332 7:104828302-104828324 CTGGGGAATTTGAGGTTGGTGGG - Intronic
1030161654 7:106515604-106515626 TTTTGGGCTGTGAAGCTGGTGGG - Intergenic
1031440132 7:121784508-121784530 TTGTGGAATTACTAACTGGTTGG + Intergenic
1035579805 8:732279-732301 TGGAGGAAAATGAAGCTGGTAGG + Intronic
1036481127 8:9140609-9140631 TTGTGTAATCTGAACCTGGCTGG + Exonic
1037016151 8:13909313-13909335 TTGTTGAATTTGAAAATGATGGG - Intergenic
1038403536 8:27304969-27304991 TGCTGGGATTTGAACCTGGTCGG - Intronic
1038917769 8:32044672-32044694 TTGTTGAATTTCAAACTGTTCGG - Intronic
1041032639 8:53753999-53754021 TTGTGGAAATTGAGGCTTGGGGG - Intronic
1044139352 8:88630680-88630702 TAGAGGAATTTGAAGCTTCTGGG - Intergenic
1045584484 8:103517417-103517439 TGGTGGAAGGTGAAGCTAGTTGG + Intronic
1046569491 8:115945372-115945394 TTCTGGAATTTGAATATGCTTGG - Intergenic
1048433218 8:134390137-134390159 TAGTGGCAATTGGAGCTGGTGGG - Intergenic
1048531941 8:135257523-135257545 TATTGGAATTTGAACCTGGAAGG - Intergenic
1053390651 9:37733054-37733076 TGGGGGATTTTGAAGCTGCTAGG + Intronic
1056460002 9:86800314-86800336 TTGTGCAAACTGAAGCTGGCGGG - Intergenic
1057891204 9:98871345-98871367 TTGTTGAATTTAAACCTGGAGGG + Intergenic
1058162076 9:101580546-101580568 CTTTGGAATTTGGATCTGGTAGG + Intronic
1059464691 9:114460526-114460548 TGGTGGGGTTTGAAGCTGGGGGG + Intronic
1059639209 9:116200117-116200139 TTGAGGAAGATGAAGCTGGAGGG - Intronic
1203434212 Un_GL000195v1:122268-122290 TTCTGGAATGTGAATATGGTGGG - Intergenic
1185539266 X:889152-889174 TTGTGGATTTGGAACCTGCTGGG - Intergenic
1186009654 X:5115327-5115349 TTGTGGAATTTGGAATGGGTTGG + Intergenic
1186190339 X:7061782-7061804 TTATAAAATTTGAAGTTGGTGGG - Intronic
1186277570 X:7956659-7956681 ATGTGGAATTTGATGGAGGTGGG - Intergenic
1188280499 X:28262338-28262360 TTTTGGAATTTGAAGCATTTTGG - Intergenic
1190109910 X:47582961-47582983 TTGAGGAATTTGGAGGAGGTTGG - Intronic
1194257678 X:91654114-91654136 TGTAGGAGTTTGAAGCTGGTGGG - Intergenic
1195332915 X:103820413-103820435 TTGAGTAATTTCAAGCTGGGAGG - Intergenic
1197196378 X:123705810-123705832 GTGTGGGATTTGAAGCTTCTTGG - Intronic
1199276341 X:145947577-145947599 CTGAGAAATTTGAAGCTGGGAGG - Intergenic
1200576335 Y:4893060-4893082 TGTAGGAGTTTGAAGCTGGTGGG - Intergenic
1201469614 Y:14318780-14318802 TTGTGGAACTTTAATCTGATGGG + Intergenic
1202092198 Y:21204348-21204370 TTGTGAAAATTGATGCTGGAAGG - Intergenic