ID: 1112663896

View in Genome Browser
Species Human (GRCh38)
Location 13:101545319-101545341
Sequence ATAGATGCACACAGGCCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112663896 Original CRISPR ATAGATGCACACAGGCCCAT TGG Intronic
901733677 1:11298614-11298636 ATATGTGCACACATGCACATGGG - Intergenic
901907717 1:12428685-12428707 ATGGAAGCACACGGGGCCATGGG - Intronic
902569199 1:17336051-17336073 ATGGGTGCACACAGTCCCCTGGG + Intronic
902881345 1:19373824-19373846 ATAGAGGCACACACACACATAGG - Intronic
904357023 1:29946900-29946922 AGAGATGCAGACAGGGACATAGG - Intergenic
906207541 1:43995229-43995251 ATGTATGCACACAGGTACATGGG - Intronic
906695716 1:47822110-47822132 ATAGATGCACACAGACCTCTAGG + Intronic
906806888 1:48787798-48787820 AAAGATGCACACAGGTGCATGGG + Intronic
908213967 1:61931885-61931907 ATAGATGCACACATACACACAGG + Intronic
911367382 1:96954772-96954794 AAAGGTGCACAGAAGCCCATGGG + Intergenic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
916989736 1:170229477-170229499 ATTGATGTACACAGCACCATAGG + Intergenic
917666370 1:177229735-177229757 TGTGATGCTCACAGGCCCATGGG + Intronic
918308639 1:183269576-183269598 AGGGATGCACATGGGCCCATTGG + Intronic
918586285 1:186192773-186192795 ATAAATGCACACATGCACACAGG + Intergenic
921063823 1:211608682-211608704 ATAGCTGCAAACAGGGCAATTGG + Intergenic
1067159322 10:43809776-43809798 GTACATGCACACATGTCCATGGG - Intergenic
1067848490 10:49740591-49740613 AGAGATGCTCAGAGGCCCTTAGG - Intronic
1074476441 10:113779079-113779101 AGATATGAACACAGGGCCATAGG + Intronic
1074503782 10:114048758-114048780 TTTGATACACACAAGCCCATGGG - Intergenic
1079390895 11:20021453-20021475 ATGGAGACACACAGGCACATGGG - Intronic
1079608347 11:22398340-22398362 AAAGAGACACCCAGGCCCATTGG + Intergenic
1082797226 11:57387079-57387101 AGAGATGCAAACTGGGCCATTGG + Exonic
1083747506 11:64744169-64744191 ACACATGCACACACCCCCATGGG + Intronic
1088077951 11:105875140-105875162 ATAGATGCAGAAAAGCCCTTCGG - Intronic
1090208466 11:124898726-124898748 ATATATGGACACAGGCTCTTGGG - Intergenic
1093773811 12:23049007-23049029 ATAGAAGCATAGAGACCCATAGG - Intergenic
1094763440 12:33561879-33561901 ATTGATGCACACAGACCCCAGGG + Intergenic
1096473965 12:51896752-51896774 AGACATCTACACAGGCCCATTGG + Intergenic
1096969588 12:55655083-55655105 ATAGCTGCAGACAGGCGCTTCGG - Intergenic
1097188862 12:57210080-57210102 ACAGGTGCAGACAGGCCCACTGG - Exonic
1102298240 12:111753603-111753625 ATGGCTGCACACAGGCACCTTGG + Intronic
1102300728 12:111769087-111769109 AGATATGCACCCAGGCCCATAGG + Intronic
1102394749 12:112575974-112575996 TCAGATGCACACAGGGCCAGAGG + Intronic
1109568090 13:64145416-64145438 ATAGATGCACACAATTCTATTGG + Intergenic
1112663896 13:101545319-101545341 ATAGATGCACACAGGCCCATTGG + Intronic
1112773303 13:102815797-102815819 ATAGATGCATACATGCACACAGG + Intronic
1114833103 14:26168930-26168952 ATACATGCAAACATGTCCATTGG - Intergenic
1117279475 14:54223642-54223664 ACAGATGCAAACACGGCCATAGG + Intergenic
1117884257 14:60343200-60343222 AAAAATGGACACAGGCCTATTGG - Intergenic
1118402293 14:65391125-65391147 AAAAATGTACACAGGACCATAGG - Intergenic
1121899348 14:97678638-97678660 ATAGATGCAGAAAGGGCCTTCGG + Intergenic
1122121311 14:99554938-99554960 ACAGATGGACATAGGCCCATGGG + Intronic
1122792404 14:104189791-104189813 ATACATGCACACGGGCACACAGG + Intergenic
1125356044 15:38818336-38818358 ATATATACACACAGGCACACAGG + Intergenic
1125389776 15:39179512-39179534 ATATATGAATACAGGCACATGGG + Intergenic
1127837942 15:62805894-62805916 AAAAATGCACACAGGGCCAGGGG + Intronic
1127852060 15:62922314-62922336 ATATATGTACACAGTCCTATTGG - Intergenic
1129614936 15:77090977-77090999 ATAGATCTACACTGGCTCATGGG - Intergenic
1131377085 15:91934392-91934414 GTAGAAGCACAGAGACCCATGGG + Intronic
1133747261 16:8696699-8696721 ATAGATGCTGATAGGCCCATGGG + Intronic
1144259962 17:13508699-13508721 ATAGAAGCACACCGGCTCCTAGG - Intronic
1149992148 17:61389256-61389278 TTACATGAACACAGGCCCAGAGG + Intronic
1151122562 17:71808780-71808802 ATTGGTGCACACACACCCATGGG + Intergenic
1156864195 18:41870473-41870495 GTGGATGGACACAGGCCAATGGG - Intergenic
1159782088 18:72671907-72671929 ATAAATGCACACAGGAACAGAGG + Intergenic
1161226549 19:3149537-3149559 ATAGATGTACACATGTACATGGG - Intronic
1161326484 19:3666713-3666735 ATAGATGCACACACGCACGCAGG + Intronic
1163200217 19:15761223-15761245 AAAGATGCTCACAGCCTCATGGG - Intergenic
1165230347 19:34382801-34382823 ATAGCTGGACACAGGAACATGGG + Intronic
928657516 2:33467791-33467813 AGATAGGCACAAAGGCCCATTGG + Intronic
928675994 2:33652147-33652169 ACAGATGGACACATCCCCATGGG - Intergenic
934092974 2:88570430-88570452 ATAGAGGCACACAGGCCGGCAGG - Intronic
937238332 2:120443917-120443939 CTTGGTGCACACAGACCCATGGG - Intergenic
938694154 2:133820023-133820045 ATGAGTGCACACAGGCCAATGGG + Intergenic
940896016 2:159082183-159082205 AGGGGTGCACACAGGCCCCTTGG + Intronic
941512313 2:166427152-166427174 ATAGCTGCACAGAGTTCCATTGG + Intronic
941592654 2:167438914-167438936 ATAGATGGACACACTTCCATGGG - Intergenic
943095225 2:183420350-183420372 ATAGATGCAGAAAAGGCCATTGG + Intergenic
944053641 2:195499805-195499827 ATAGATACAGACAGGCTTATGGG + Intergenic
944380195 2:199100334-199100356 ACACATACACACAGGTCCATAGG - Intergenic
949066672 2:241995071-241995093 ACACATACACACAGGCACATTGG + Intergenic
1176261866 20:64186089-64186111 ATTGATGCACAAAGGTCCAGAGG - Intronic
1181048032 22:20224959-20224981 ATACATGCACACATGAACATGGG + Intergenic
1183714361 22:39525140-39525162 ATGGGTGGACACTGGCCCATGGG + Intergenic
1185094996 22:48801303-48801325 ACACATGCACACAGGCACACAGG + Intronic
951828190 3:26892890-26892912 CTATATGCACACAGACACATGGG - Intergenic
952154221 3:30625849-30625871 ACAGAGGCAGTCAGGCCCATAGG - Intronic
952525997 3:34211272-34211294 ATAGATTTACTCAGGCCCCTTGG + Intergenic
953921408 3:46954444-46954466 ATTGATGTAAACAGGGCCATGGG - Intronic
954678886 3:52330862-52330884 AGAGAGACACACAGGCCAATGGG - Intronic
954987778 3:54810804-54810826 AGAGTTTCACACAGACCCATGGG - Intronic
956594873 3:70956208-70956230 AAAGATTCACACAGACACATCGG + Intronic
958892574 3:99796785-99796807 ATAAATTCACAAAGGCCGATTGG - Exonic
959834336 3:110900798-110900820 TTAACAGCACACAGGCCCATGGG + Intergenic
960682365 3:120262771-120262793 ATCGAAGCACACAGGGTCATGGG + Intronic
960836491 3:121912185-121912207 ATACATGTACACAGGCACACAGG - Intronic
962695163 3:137940638-137940660 GTAGATGCACACAGGCTAAAAGG - Intergenic
967192388 3:186995957-186995979 ATAGGTAGACACAGGCCCACAGG + Intronic
969283806 4:6190013-6190035 CTAGATTCAGACAGGCCCAGGGG - Intronic
971689250 4:29811767-29811789 TTGGATGTACACAGGACCATTGG - Intergenic
978180983 4:105795551-105795573 ATAGATACACACATGCACACAGG - Intronic
979429851 4:120616175-120616197 ATAAGTGCTCACAGTCCCATGGG - Intergenic
980347991 4:131648475-131648497 ATATATACACACAGACCCACTGG - Intergenic
983799333 4:171906909-171906931 ATAGATGCAGAAAAGCCCTTTGG + Intronic
986022609 5:3819035-3819057 GTAGATGGGCACACGCCCATAGG - Intergenic
986645779 5:9914667-9914689 AGAGATGCACACAGGCTCACAGG + Intergenic
991191889 5:63884252-63884274 GCAGATGCAGACAGGCCAATGGG - Intergenic
993522067 5:88915164-88915186 ATAGAGCCACACTGGCCCCTAGG - Intergenic
994009740 5:94887346-94887368 ATAGTGGCACACAGGCCAACTGG + Intronic
999413490 5:151373965-151373987 ATACATACACACCAGCCCATAGG - Intergenic
1000036513 5:157452618-157452640 GTAGGTCCACACAGGCCCAGGGG + Intronic
1002383572 5:178848931-178848953 TTACATGCACACGTGCCCATGGG + Intergenic
1002440450 5:179261863-179261885 AAGGATGCACACACGTCCATGGG + Intronic
1016908385 6:149173463-149173485 ATAGAAGCACAGAGACACATAGG + Intergenic
1018192448 6:161322068-161322090 ATGGATGCACCCAGGCACAGTGG + Intergenic
1022062806 7:26817239-26817261 ATACATTCACACAGGTCTATAGG + Intronic
1023479566 7:40619151-40619173 ACAGAAGCAGACATGCCCATGGG - Intronic
1024045560 7:45583202-45583224 ATGCATGCACACATGCACATGGG - Intronic
1025161351 7:56663842-56663864 ATAGATAGACATAGGTCCATGGG + Intergenic
1026093766 7:67324153-67324175 ATAGAGCCACACTGGCCCCTAGG + Intergenic
1028859607 7:95633934-95633956 ATAGATGAACACAGGCATATAGG + Intergenic
1030450880 7:109709362-109709384 ATAGATGCAAAGAATCCCATAGG + Intergenic
1038081861 8:24146805-24146827 ATAGATGCAGAAAGACCCTTTGG - Intergenic
1038333744 8:26629981-26630003 ATACATACACACACGTCCATAGG + Intronic
1038632336 8:29257910-29257932 ATATATGCACATAGGGCCAGAGG - Intronic
1039156966 8:34571216-34571238 AAACATTCACACAGGACCATTGG + Intergenic
1041184081 8:55280487-55280509 ATAGATGCACATAGGACTAGAGG - Intronic
1042164648 8:65933803-65933825 ATAAAGGCACAAAGGCCAATGGG + Intergenic
1042264584 8:66895264-66895286 ACAGATGCAGACAGACCCTTTGG + Intronic
1042374052 8:68028177-68028199 ATACATACACACATTCCCATAGG - Intronic
1043082784 8:75786146-75786168 AGAAAGGCACACAGGCCAATTGG + Intergenic
1044011541 8:86999855-86999877 ATAGATGGACATTGGCCCATGGG + Intronic
1045065295 8:98438659-98438681 ATAGATACACACATGCACACCGG - Intronic
1046845613 8:118912181-118912203 ATAGATGCACACACCCAAATAGG + Intergenic
1048305826 8:133284180-133284202 ATAGACACACACAGGCACACCGG - Intronic
1048583512 8:135750627-135750649 AATGAGCCACACAGGCCCATAGG - Intergenic
1049872109 8:144988471-144988493 AAAGATGCAGACTGGCCAATTGG - Intergenic
1051504096 9:17808939-17808961 ATAGTTGCTCCCAGGCCTATGGG + Intergenic
1051564417 9:18480982-18481004 ATAGAAGCACACAGATCCAAGGG + Intronic
1052704264 9:31975323-31975345 ATATATGTACACATACCCATTGG - Intergenic
1059717383 9:116925896-116925918 ACACATGCACACATGCACATAGG + Intronic
1061324667 9:129856342-129856364 TTACCTGCAGACAGGCCCATAGG - Exonic
1061807958 9:133147074-133147096 ATAGCTGTCCACAGGCCCCTGGG + Intronic
1062239899 9:135531328-135531350 ACAGATACACACAGCCCCATGGG + Intergenic
1062561004 9:137141844-137141866 CCAGATGCACACATGCCCACAGG - Intronic
1191696422 X:63995379-63995401 AGAGATGCACATAGGACCCTTGG + Intergenic
1194461578 X:94176190-94176212 ATAGATGCACACAGGTATGTGGG + Intergenic
1195050824 X:101095088-101095110 ATAGATGTACACAAGCCAATAGG - Exonic
1200239035 X:154484284-154484306 AAAGATGGACAGAGGCCCAATGG - Exonic
1201863306 Y:18623189-18623211 ACAGATGCAGACAGCCCCTTGGG - Intergenic
1201870016 Y:18697189-18697211 ACAGATGCAGACAGCCCCTTGGG + Intergenic
1202172130 Y:22060995-22061017 ACAGATGCACACATGTGCATTGG - Intergenic
1202219232 Y:22525376-22525398 ACAGATGCACACATGTGCATTGG + Intergenic
1202323949 Y:23670689-23670711 ACAGATGCACACATGTGCATTGG - Intergenic
1202546822 Y:25999365-25999387 ACAGATGCACACATGTGCATTGG + Intergenic
1202593496 Y:26512028-26512050 ATACACACACACAGGCACATGGG + Intergenic