ID: 1112665858

View in Genome Browser
Species Human (GRCh38)
Location 13:101572411-101572433
Sequence AGGCCCCGGCACCACTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 88}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112665855_1112665858 -3 Left 1112665855 13:101572391-101572413 CCAGTGTGCAGAGCAGGGTGAGG 0: 1
1: 0
2: 4
3: 57
4: 401
Right 1112665858 13:101572411-101572433 AGGCCCCGGCACCACTGTACAGG 0: 1
1: 0
2: 0
3: 9
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112665858 Original CRISPR AGGCCCCGGCACCACTGTAC AGG Intronic
900186682 1:1336259-1336281 TGGCCCCCCCACCACTGTATAGG + Exonic
900376050 1:2355323-2355345 AGGGCCCGGCGCCACTCCACGGG - Intronic
900688710 1:3966275-3966297 TGGCCCCTGCACCACTCTGCAGG + Intergenic
902212605 1:14914447-14914469 AGGCCCAGGCACGACTACACAGG + Intronic
902580550 1:17404944-17404966 AGGCCCCGGCTGCTCTGTATTGG + Intergenic
904768838 1:32870161-32870183 GGGCCCCGGCACCCCTGATCTGG - Intronic
905013177 1:34760515-34760537 AGGCCCCAGCACCAGTACACGGG + Intronic
905059422 1:35126742-35126764 AGGCCCTGGAACCAGTGGACAGG - Intergenic
906667594 1:47632463-47632485 AGGTCCCAGCACCTCTGTCCTGG + Intergenic
918282692 1:183022784-183022806 ACGCCCCGGGACCTCTGTTCGGG + Intergenic
920851715 1:209632582-209632604 AGGCCCCTCCACCGCTGTGCAGG - Exonic
922818968 1:228471010-228471032 AAGCCCCGGCACCAGAGTGCAGG - Intergenic
923524370 1:234760660-234760682 AGGCCAGGGCACCACAGTGCAGG + Intergenic
924851801 1:247838506-247838528 AGGCTCAGGGACCACTGCACTGG + Intergenic
1064147091 10:12834222-12834244 ATGCCCCGGGACCACCGAACAGG - Exonic
1065040641 10:21691855-21691877 AGTCCCTGGCACCACAGTATTGG - Intronic
1070823069 10:79374624-79374646 AGGCCCAGGTATCCCTGTACTGG + Intergenic
1075686221 10:124367085-124367107 AGGGCCCAGCACCACTGTAAGGG - Intergenic
1076187281 10:128459632-128459654 AAGCCCCGGCTCCACTTCACCGG - Intergenic
1077159792 11:1107493-1107515 AGCCCCCGGGGCCACTGCACAGG - Intergenic
1077159813 11:1107578-1107600 AGCCCCCGGGGCCACTGCACAGG - Intergenic
1078102673 11:8338990-8339012 AGGCCCCGGCATCACTTTGCTGG + Intergenic
1078639651 11:13082875-13082897 AGACCCAGGAACCACTGGACTGG - Intergenic
1081989490 11:47330177-47330199 AGGCCCCAGCTCCCCTGTTCTGG + Intergenic
1083316045 11:61815650-61815672 AGGCCCCGGCGCCTCTCTGCTGG - Intronic
1093622262 12:21305988-21306010 AGCCCTAGGCACCAATGTACTGG - Intronic
1096232084 12:49902468-49902490 AGGCCCAAGGACCACTGAACTGG + Intronic
1104954709 12:132458571-132458593 AGGCCCCGGCTGCACTCTGCTGG + Intergenic
1108266960 13:48720455-48720477 AGGACCTGGCACCTCAGTACCGG - Intergenic
1111445271 13:88339457-88339479 ATGCCCTGCCAACACTGTACAGG + Intergenic
1112379733 13:98877509-98877531 AGGACCCAGCACCACAGTTCAGG - Intronic
1112665858 13:101572411-101572433 AGGCCCCGGCACCACTGTACAGG + Intronic
1113482165 13:110629022-110629044 AGACCACGGCAACAGTGTACAGG - Intronic
1114016582 14:18435421-18435443 AGGTCCCAGCAGCACTGTTCTGG + Intergenic
1118059082 14:62116125-62116147 AGGCCCTGGCATGACTCTACAGG + Intergenic
1121719320 14:96098174-96098196 AGCCCCCCGCCCCACTCTACTGG - Intergenic
1122421331 14:101579369-101579391 AGCCCCTGACACCACTGCACAGG + Intergenic
1125601146 15:40916352-40916374 AGGCCCCAGCATCACTGCCCAGG - Intergenic
1126102671 15:45129349-45129371 AGACCCCGGTACTACTGTCCTGG - Intronic
1130273382 15:82463995-82464017 AGGCCACGTCACCACTGCTCTGG - Intergenic
1130465733 15:84191366-84191388 AGGCCACGTCACCACTGCTCTGG - Intergenic
1130486958 15:84403444-84403466 AGGCCACGTCACCACTGCTCTGG + Intergenic
1130498532 15:84482170-84482192 AGGCCACGTCACCACTGCTCTGG + Intergenic
1130588022 15:85195962-85195984 AGGCCACGTCACCACTGCTCTGG - Intergenic
1142005870 16:87689398-87689420 AGGCCCAGGCACCACAGGAAGGG - Intronic
1146257304 17:31398990-31399012 AGGCCGGGGCACCATTGTCCAGG - Intronic
1151800497 17:76376684-76376706 AGGAGCCGGCACCTCTGCACAGG - Intronic
1153274275 18:3352733-3352755 AGGCACCAGGACTACTGTACAGG + Intergenic
1160941659 19:1622905-1622927 AGGCCCCAGCCCCACAGTCCAGG - Intronic
1162435582 19:10655925-10655947 GGGCCCCAGCACCACGGAACAGG - Intronic
1167311627 19:48740546-48740568 AGGCCCTGGCTCCACTGGCCTGG + Exonic
1167439539 19:49500381-49500403 GGGCCCCGGTACCACTGAACAGG - Intergenic
925083087 2:1084935-1084957 ACACCCCGGCACCACTGCCCTGG + Intronic
930108336 2:47657484-47657506 ACGCCCCTGCACCACTGAGCGGG + Intergenic
932054241 2:68428609-68428631 AGGCCCCTGAACAACTGCACAGG - Intergenic
935388417 2:102525153-102525175 AGTCCCCAGCCCCAATGTACCGG - Exonic
941898272 2:170652810-170652832 AGACCCTGGTACCTCTGTACTGG + Intronic
1171407153 20:24919018-24919040 AGGCCCCGGCAGCATGGTCCTGG - Intergenic
1172189154 20:33051359-33051381 AAGCCCAGGCACCACTGGACAGG + Intergenic
1172625397 20:36343773-36343795 AGGCCCCAGCAGCACTGCTCTGG + Intronic
1176043648 20:63081320-63081342 AGGCCTCGGCAGGACTGTTCAGG - Intergenic
1180441088 22:15366294-15366316 AGGTCCCAGCAGCACTGTTCTGG + Intergenic
1180961856 22:19765900-19765922 AGGCCCCGGAACCACCGGCCCGG + Exonic
1184754329 22:46507750-46507772 GGGCCCCTGCCCCACTGAACAGG - Intronic
950359518 3:12440717-12440739 AGACCCAGGCAACACTGGACAGG - Intergenic
954685483 3:52367926-52367948 AGGCACAGGGACCACTGCACTGG + Intronic
965772962 3:172200049-172200071 TGGCCCCCGCAACACTGAACTGG - Intronic
968698608 4:2044268-2044290 AGGCTCCTGCACCACTGAACTGG + Intergenic
968775067 4:2535777-2535799 AGGCACCGGGACCACTGGAGAGG + Intronic
968910220 4:3473671-3473693 GGGCCCCGGCACACCTGAACGGG - Intronic
969219771 4:5752096-5752118 AGGCCTAGGCACCTCTGTGCTGG - Intronic
970526712 4:16939660-16939682 AGCCCCAGGCAGCACTGAACAGG - Intergenic
972527679 4:39931740-39931762 AGTCCCCTGCAACACTGAACGGG - Intronic
992077590 5:73205523-73205545 GGGCCCAGGCCCCACTCTACAGG + Intergenic
997304099 5:132825814-132825836 GGACCCCGGGACCACTGAACAGG - Exonic
999268998 5:150285532-150285554 AGGCCCCAGGACCTCAGTACAGG + Intronic
1001237933 5:170045662-170045684 AGCCCCCGGCCCCTCTGTATGGG + Intronic
1006568638 6:34981811-34981833 TGGACCTGGCAGCACTGTACGGG + Exonic
1006603916 6:35243203-35243225 AGGCCCGGGCAGCACCGTGCTGG + Exonic
1007429550 6:41768804-41768826 AGGCCCAGGCAGCAGTGTCCTGG + Intergenic
1018067145 6:160132119-160132141 AGGCCACCGCACCACTGTCCTGG - Intronic
1020244901 7:6422441-6422463 AGGCCCCGGCAGCAGCGTCCAGG + Intronic
1032334410 7:131011640-131011662 AGGCCCCAGCAGCACAGCACGGG + Intergenic
1036586130 8:10125458-10125480 TGGCCCTGGTACCACTGCACAGG - Intronic
1036687976 8:10924473-10924495 GGGCCCCGTCAGCACTGCACTGG + Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1044660706 8:94590980-94591002 AGGCCCCCTCACCTCTGGACGGG - Intergenic
1046012937 8:108572533-108572555 AGGCTCCAGCACCGCTGTGCTGG - Intergenic
1049803754 8:144529874-144529896 AGGCCCCGGGCCCACTGTCCTGG + Exonic
1053719237 9:40928594-40928616 AGACCCCAGCAGCACTGTTCTGG - Intergenic
1056673443 9:88651832-88651854 TGGCCCAGGGACCACTGTATGGG + Intergenic
1057173293 9:92976550-92976572 TGGCCCAAGCCCCACTGTACTGG + Exonic
1057665104 9:97038879-97038901 AGGCGCCGGCACCACTGGGAGGG - Intronic
1058887162 9:109330275-109330297 AGGCCCCTGGACCACTGCACTGG + Intergenic
1061387897 9:130301216-130301238 AGGCCCCGGAACCACAGTAGGGG - Intronic
1062021116 9:134319857-134319879 TGGCCCCGGCACCACTCCTCGGG - Intronic
1203485197 Un_GL000224v1:47015-47037 AGACCCCGGCAGCAGTGTTCTGG + Intergenic
1186453958 X:9696587-9696609 GGGGCCAGGCACCAATGTACTGG - Intronic