ID: 1112671430

View in Genome Browser
Species Human (GRCh38)
Location 13:101643715-101643737
Sequence ACCAGCTGGATCCACTGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112671422_1112671430 19 Left 1112671422 13:101643673-101643695 CCCTCAAATTTCTAATACAGGGT 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1112671430 13:101643715-101643737 ACCAGCTGGATCCACTGTAGGGG 0: 1
1: 0
2: 1
3: 42
4: 157
1112671423_1112671430 18 Left 1112671423 13:101643674-101643696 CCTCAAATTTCTAATACAGGGTA 0: 1
1: 0
2: 0
3: 13
4: 177
Right 1112671430 13:101643715-101643737 ACCAGCTGGATCCACTGTAGGGG 0: 1
1: 0
2: 1
3: 42
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112671430 Original CRISPR ACCAGCTGGATCCACTGTAG GGG Intronic