ID: 1112671433

View in Genome Browser
Species Human (GRCh38)
Location 13:101643720-101643742
Sequence CTGGATCCACTGTAGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112671422_1112671433 24 Left 1112671422 13:101643673-101643695 CCCTCAAATTTCTAATACAGGGT 0: 1
1: 0
2: 0
3: 8
4: 138
Right 1112671433 13:101643720-101643742 CTGGATCCACTGTAGGGGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 126
1112671423_1112671433 23 Left 1112671423 13:101643674-101643696 CCTCAAATTTCTAATACAGGGTA 0: 1
1: 0
2: 0
3: 13
4: 177
Right 1112671433 13:101643720-101643742 CTGGATCCACTGTAGGGGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112671433 Original CRISPR CTGGATCCACTGTAGGGGCT GGG Intronic
900109629 1:1000062-1000084 CGGGATCCGCCCTAGGGGCTCGG - Exonic
900612613 1:3550750-3550772 CTGGATCGGCTGCAAGGGCTGGG - Intronic
902758047 1:18562264-18562286 CTGGATGGACTGGAGGGGCTGGG - Intergenic
903669704 1:25028186-25028208 CTGGAGCCACTGTGGGGTCCTGG - Intergenic
904645400 1:31962045-31962067 CTGGATTCACTGGACTGGCTTGG + Intergenic
905198868 1:36302964-36302986 CAGAATCCAATGTTGGGGCTGGG - Intronic
905222217 1:36456062-36456084 CTGGATCCATTCCAGGGCCTGGG + Intronic
908339235 1:63159425-63159447 CTGGAGCCTTTGGAGGGGCTGGG + Intergenic
911142918 1:94524999-94525021 CTAGATCCAGTGTGGGGCCTGGG + Intergenic
917792097 1:178505559-178505581 CTGAATCCACTGCAGGAGCCAGG - Intergenic
920199671 1:204251839-204251861 CTGGAGGCACTGCAGAGGCTGGG + Intronic
924244082 1:242064470-242064492 CTGGTTCCAGAGTAGGGGATGGG + Intergenic
1063539126 10:6914349-6914371 CTGTGTCCACTGGAGGAGCTCGG - Intergenic
1063574376 10:7248499-7248521 TTTGATCCACTCTAGGGGCTGGG + Intronic
1065919398 10:30378881-30378903 CTGGGCCCACTGGAGGTGCTAGG - Intergenic
1067513949 10:46920700-46920722 CTGAGGCCACTGTGGGGGCTGGG + Intronic
1067648305 10:48131132-48131154 CTGAGGCCACTGTGGGGGCTGGG - Intergenic
1068533008 10:58210100-58210122 CTGCAGCCACTGTGGGGGATGGG + Intronic
1069622450 10:69846264-69846286 CTGGTGGCACTGGAGGGGCTGGG + Intronic
1070574522 10:77667467-77667489 CTAGAACCACTGCAGGTGCTGGG - Intergenic
1080524215 11:33097779-33097801 CTGGACACTCTGTAGGTGCTAGG - Intronic
1084164014 11:67366771-67366793 CTGGCTCCAGAGTAGGGTCTGGG + Intronic
1086750691 11:90490085-90490107 CTGTATGCACTCTAGGGACTTGG + Intergenic
1087699824 11:101423520-101423542 GTGGATCCACTGGAGGGGAAGGG + Intergenic
1090401579 11:126452750-126452772 CCGGAGCCGCTGTCGGGGCTGGG + Intronic
1095108293 12:38261326-38261348 CTGGATCCAGTGAAGTGGCAGGG + Intergenic
1095225797 12:39675239-39675261 CTGCAGCCACTGTGGGGGATGGG - Intronic
1101185902 12:102278720-102278742 CTGGAGCAAGTGTATGGGCTTGG + Intergenic
1101650052 12:106669227-106669249 CTGGATCCAGTGTGGGGGAGGGG - Intronic
1106781376 13:33061983-33062005 ATAGATCCAGAGTAGGGGCTAGG - Intronic
1110730336 13:78873357-78873379 GTGTTTCCACTGGAGGGGCTGGG + Intergenic
1111956433 13:94763737-94763759 CTGGCTTCACTGTAGGGCTTGGG - Intergenic
1112337253 13:98525579-98525601 CCGGCTCCACTGTAGGGACAAGG - Intronic
1112671433 13:101643720-101643742 CTGGATCCACTGTAGGGGCTGGG + Intronic
1119942407 14:78655624-78655646 CAGGGTCCACTCTAGGTGCTGGG - Intronic
1121122833 14:91386825-91386847 CTAGCCCCACTTTAGGGGCTTGG + Intronic
1121526135 14:94620812-94620834 CTGGGCCCACTGCAGGGTCTGGG - Intronic
1124086616 15:26556888-26556910 CTGGCTCCACAGCAGGGACTTGG - Intronic
1124438438 15:29670173-29670195 CAGGATCCATGGTGGGGGCTGGG + Intergenic
1124625983 15:31307818-31307840 CTGGCTCACCTGAAGGGGCTAGG + Intergenic
1125318124 15:38454210-38454232 CTGGACACACTGGAGGCGCTGGG + Exonic
1128260001 15:66226732-66226754 CAGCATCCACTGGGGGGGCTTGG + Intronic
1130027211 15:80280256-80280278 CAGGCTCCATTTTAGGGGCTGGG + Intergenic
1132761106 16:1509050-1509072 GTGGAGCCACTGATGGGGCTGGG + Intronic
1133035372 16:3031142-3031164 CTGGAGCCGCTGTGGGGGCCAGG + Exonic
1133277548 16:4647927-4647949 CTGGAATCACTGTTGGGGCCCGG + Intronic
1134246201 16:12541954-12541976 CTGGATCCACTTCAGAGACTTGG + Intronic
1137978169 16:53048288-53048310 CTGCAGCCACTGTAGTAGCTGGG - Intergenic
1138519617 16:57563567-57563589 CTGGATCCCTGGCAGGGGCTGGG + Intronic
1139794752 16:69473436-69473458 CTGGCTCCAGTGGATGGGCTTGG + Intergenic
1141501905 16:84450371-84450393 CTAGATCCCCTGGAGTGGCTTGG + Intronic
1141651488 16:85395421-85395443 CTGGACCCATTGTCGGGCCTTGG - Intergenic
1141859544 16:86706993-86707015 CAGGAACCACTGTAGGAGCTGGG + Intergenic
1147487073 17:40826486-40826508 TTGGAGTCACTTTAGGGGCTGGG + Intronic
1148210527 17:45805956-45805978 CTGCATGCTCTGTAGGGGCAGGG - Intronic
1151675007 17:75592733-75592755 CTGAAGGCACTGCAGGGGCTCGG + Intergenic
1152242849 17:79169247-79169269 CGGGTTTCACTGGAGGGGCTGGG + Intronic
1152530209 17:80914298-80914320 CTGGATCCAGAGTTGTGGCTGGG - Intronic
1155315549 18:24567379-24567401 CTGTCTCCACTGCAGGGGATGGG - Intergenic
1157301254 18:46481495-46481517 CTGGATGCTCTATAGGGTCTAGG - Intronic
1157718409 18:49905248-49905270 CTGGACCCACTGTAGGCACTGGG + Intronic
1159464431 18:68762893-68762915 AGGCATCCACTGGAGGGGCTTGG + Intronic
1161452611 19:4354884-4354906 CTGGCTCCAGTGTTGGGGCAGGG + Intronic
1165327997 19:35125323-35125345 CTGGAGCCACTGCAGGAGCTGGG - Exonic
1166531299 19:43545106-43545128 CTGATGCCACTTTAGGGGCTTGG + Intronic
1167658621 19:50782726-50782748 CTGAACCCACAGTTGGGGCTTGG - Intergenic
938854875 2:135299176-135299198 CTGCATCCACTGTGGGGGCTTGG + Intronic
940420672 2:153477200-153477222 GTGGATCCCCTGGAGGGGCGAGG - Intergenic
944485381 2:200199881-200199903 CTGCAGCTGCTGTAGGGGCTGGG - Intergenic
944912622 2:204325237-204325259 GTGGATCTACTGTATGGGATAGG + Intergenic
946767320 2:223052803-223052825 CTGCCTCCACAGCAGGGGCTGGG - Exonic
947382303 2:229556829-229556851 ATTGATCCACTTTAGGGGATTGG - Intronic
1170875301 20:20244535-20244557 CTGGGTGCAGTGTAGGGACTTGG - Intronic
1174335183 20:49854602-49854624 CTGTATCTACTGTTGGGGGTAGG + Intronic
1175516691 20:59574679-59574701 CTGGATTCCTTGCAGGGGCTGGG + Intergenic
1175883195 20:62272237-62272259 CTGCATCCTCTCCAGGGGCTGGG - Exonic
1176021893 20:62966410-62966432 GTGGAGCCACGGGAGGGGCTGGG - Intronic
1180001032 21:44995702-44995724 ATGGGTCCCCTGTAGGGGGTGGG - Intergenic
1180721788 22:17914911-17914933 CTCCATCCATTGTAGGAGCTTGG + Intronic
1181601879 22:23957713-23957735 CAGGATCCCCTGAAGGGTCTGGG - Exonic
1181606630 22:23983594-23983616 CAGGATCCCCTGAAGGGTCTGGG + Exonic
1181629897 22:24145255-24145277 CTGAATGCACTGGAGGGGCTGGG + Intronic
1181992479 22:26847918-26847940 CAGGATCCAATGTAGGGCCTTGG + Intergenic
1183323309 22:37178080-37178102 CTGGATCCATTTCATGGGCTAGG - Intergenic
1183499180 22:38168226-38168248 CTGGAGACACTGGAGGTGCTTGG + Intronic
1184702632 22:46186801-46186823 AGGTATCCACTGTGGGGGCTTGG - Intronic
1185176404 22:49329742-49329764 CTGGATCCACTGGCTGGACTTGG - Intergenic
953916079 3:46922089-46922111 CAGCATCCACTGCAGAGGCTAGG + Exonic
954099497 3:48358299-48358321 CTGGAAGCCCTGTAGGGGATGGG + Intergenic
959727535 3:109560990-109561012 CTGCAGCCACTGTGGGGGATGGG + Intergenic
961584171 3:127908558-127908580 CTGGAGCCACTTTAGAGCCTTGG + Intergenic
964612265 3:158627193-158627215 CTGGTTCTACAGTAGGGGCAGGG + Intergenic
968612574 4:1563882-1563904 CTGCCTCCACCGTAGGGGCTGGG - Intergenic
969043888 4:4322641-4322663 ATGGATGCACTGTAGGTGCTGGG - Intergenic
969437653 4:7198036-7198058 CTGGAGGCACTGTGGGGGATGGG + Intronic
976022502 4:80646134-80646156 CTGGAGGCACTGTTGTGGCTTGG - Intronic
979434605 4:120673703-120673725 CTGCAGCCACTGTGGGGGATGGG - Intergenic
984915281 4:184718135-184718157 CTGGATCCACTGCAGCAGCTGGG + Intronic
985795974 5:1962446-1962468 CTGCATCAATTGTAGGGGATGGG - Intergenic
988886384 5:35563066-35563088 CTGTGTGCACTGTAGGGACTTGG + Intergenic
992715871 5:79510870-79510892 CTGAAGCCTCTGTAGGGGCCTGG - Intronic
993705705 5:91167558-91167580 CTGAGTCCACTGCAGGGGCCAGG - Intergenic
995256270 5:110050292-110050314 TTGCATCCACTGTACAGGCTGGG + Intergenic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
1004888238 6:20072263-20072285 CAGGCTCCATTCTAGGGGCTGGG + Intergenic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1011588947 6:88952239-88952261 CTGTAGCCACTGTAGGGGATGGG - Intronic
1012230603 6:96756974-96756996 GTGGCTTCACTGTAGGGGTTTGG - Intergenic
1014750074 6:125245583-125245605 CTGCAGCCACTGTGGGGGTTGGG + Intronic
1019719678 7:2560449-2560471 CTGCACCCGCAGTAGGGGCTTGG + Intronic
1020015492 7:4829146-4829168 CAGGTGCCACTGTAGGGGCCCGG + Intronic
1022142960 7:27509148-27509170 CTGGATCAGCTCGAGGGGCTGGG - Intergenic
1022783494 7:33611063-33611085 CTGGAGCCAATGAAGCGGCTGGG - Intergenic
1023566718 7:41530573-41530595 CTGGAACCACTGGAGTGGATGGG - Intergenic
1023859976 7:44212749-44212771 CTGGGGCCACTGTTGGGGGTGGG + Exonic
1026461849 7:70621294-70621316 CTGTATTCACTGTGGGGGCAGGG + Intronic
1027129286 7:75579777-75579799 CAGGACCCACTCTTGGGGCTTGG - Intronic
1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG + Intronic
1027521694 7:79216554-79216576 CTGGACCCACAGTAGTGTCTAGG - Intronic
1034186594 7:149182655-149182677 CTGGATCCACTCTAAGGGAATGG - Intronic
1038429274 8:27486621-27486643 CTGCTCCCACTGTAAGGGCTGGG + Intergenic
1040602884 8:48901822-48901844 CTGGATCCCCAGCATGGGCTGGG + Intergenic
1040626937 8:49160165-49160187 CAGTATCCACTGGAGGGACTTGG + Intergenic
1041763710 8:61394503-61394525 CTGCAGCCACTGTGGGGGATTGG + Intronic
1046846551 8:118922476-118922498 CTGGAGCCTCTGTAGGGAGTGGG - Intergenic
1048276030 8:133066856-133066878 CTAGATCCCGTGCAGGGGCTGGG + Intronic
1051212061 9:14755489-14755511 CTGAATCAAATGTGGGGGCTTGG - Intronic
1057030080 9:91768833-91768855 CTGGAGCCACTGAATGGTCTTGG - Intronic
1059926366 9:119213325-119213347 CTTCATCCACTTTAGGAGCTTGG + Intronic
1060738408 9:126081268-126081290 CTGGATCCACTGTGGGTTCTGGG + Intergenic
1060782476 9:126422957-126422979 CTGGCTCCACTGCAGGAGCCAGG + Intronic
1060827572 9:126695585-126695607 CTGGATCCCCTGGAGGGGCGGGG + Intronic
1062101350 9:134730273-134730295 CTGAAACCAGTGAAGGGGCTGGG + Exonic
1062567573 9:137170091-137170113 CTGGATCCACGCTTGGGGCGGGG + Intronic
1186463437 X:9765935-9765957 CTGGCTCTACTGCAGGCGCTGGG - Exonic
1186760644 X:12718465-12718487 CTGCATCCACTGAAGAGCCTTGG - Exonic
1191713561 X:64178088-64178110 CTGGTTCCACCTTTGGGGCTGGG - Intergenic
1194553797 X:95332927-95332949 CTGGAGCCACTGTTGGGGGCTGG - Intergenic
1195329697 X:103786810-103786832 CTGGGTCCTCTCTAGGGGCCTGG + Intronic
1196971184 X:121110132-121110154 CTGCAGCCACTGTGGGGGATGGG - Intergenic
1199143277 X:144335673-144335695 CTGACTCCACTGCAGTGGCTAGG + Intergenic
1199303659 X:146241703-146241725 CTGGATACACTGGAGGTGCAAGG + Intergenic