ID: 1112677732

View in Genome Browser
Species Human (GRCh38)
Location 13:101722935-101722957
Sequence CATCATGCAAAGATGGTTCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112677726_1112677732 2 Left 1112677726 13:101722910-101722932 CCAGGCTTCGGGACCGTTTCCCC 0: 1
1: 0
2: 0
3: 2
4: 67
Right 1112677732 13:101722935-101722957 CATCATGCAAAGATGGTTCTCGG 0: 1
1: 0
2: 0
3: 16
4: 154
1112677724_1112677732 4 Left 1112677724 13:101722908-101722930 CCCCAGGCTTCGGGACCGTTTCC 0: 1
1: 0
2: 0
3: 2
4: 52
Right 1112677732 13:101722935-101722957 CATCATGCAAAGATGGTTCTCGG 0: 1
1: 0
2: 0
3: 16
4: 154
1112677725_1112677732 3 Left 1112677725 13:101722909-101722931 CCCAGGCTTCGGGACCGTTTCCC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1112677732 13:101722935-101722957 CATCATGCAAAGATGGTTCTCGG 0: 1
1: 0
2: 0
3: 16
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112677732 Original CRISPR CATCATGCAAAGATGGTTCT CGG Exonic
900320585 1:2081573-2081595 CATCATGCCAAGGTGGTGCTGGG + Intronic
900716567 1:4148838-4148860 CACCATGCACAGCTGGGTCTTGG - Intergenic
902089276 1:13890359-13890381 CATAAGGAAAAGATGGTTTTGGG + Intergenic
903636625 1:24822804-24822826 CATCATGCAGAATTGTTTCTAGG + Intronic
904261788 1:29291732-29291754 CAGCATCCAGAGATGCTTCTAGG + Intronic
905470628 1:38189005-38189027 CAGCCTGCTAAGATGGTCCTGGG + Intergenic
908111634 1:60904001-60904023 CATCATCAAAAGTTGGTTTTAGG - Intronic
911359514 1:96859362-96859384 CAAAATGAAAAGTTGGTTCTTGG - Intergenic
911571086 1:99517683-99517705 CATCATCCAAAGAAGGATCATGG - Intergenic
913678993 1:121170697-121170719 CATCTTGCATAGGTGGTTCAAGG + Intronic
914030825 1:143958343-143958365 CATCTTGCATAGGTGGTTCAAGG + Intronic
914158624 1:145109619-145109641 CATCTTGCATAGGTGGTTCAAGG - Intronic
915090508 1:153420930-153420952 CAACAGGGGAAGATGGTTCTGGG - Exonic
915923152 1:159993318-159993340 CATCCTCCAAAGATAGATCTAGG + Intergenic
916352333 1:163864982-163865004 CATGATGCAGCGATGGTTATTGG - Intergenic
916692377 1:167202704-167202726 CATATTGAAAAGATGCTTCTGGG - Intergenic
917056757 1:170990980-170991002 CATCTTACAAAGATCTTTCTAGG - Intronic
919709288 1:200710340-200710362 TAACATGCAAGGATGGTTTTAGG + Intergenic
920466292 1:206189235-206189257 CATCTTGCATAGGTGGTTCAAGG + Intronic
921051200 1:211513038-211513060 AATCAGGCAAAGATGATTCTGGG - Intergenic
922188873 1:223299605-223299627 CATCAATCAAACATGATTCTAGG + Intronic
922992257 1:229924388-229924410 CAACATCGAAAGATGGTACTGGG + Intergenic
1063309516 10:4939094-4939116 CATCATGCAAAGTAGGTTTAGGG + Intronic
1063400568 10:5740634-5740656 CATCAAGCAAACATGTTTCCTGG + Intronic
1063916431 10:10887546-10887568 TATCATGCAAACATGGGTTTTGG - Intergenic
1064664205 10:17633035-17633057 AATCGTGCAAATTTGGTTCTAGG + Intergenic
1068390713 10:56392682-56392704 CATGATACAAAAATGGTTGTAGG - Intergenic
1069795495 10:71049340-71049362 GATTATGCAAAGACTGTTCTGGG + Intergenic
1071113864 10:82194251-82194273 CAGCATGCACAGATGATTTTTGG + Intronic
1073969455 10:109030866-109030888 GCTCATGCCAAGATGGTTCTTGG - Intergenic
1075012839 10:118889505-118889527 CATCATCATAAGAGGGTTCTTGG + Intergenic
1075688993 10:124383015-124383037 CATCATGTGAAGTTGGTGCTAGG + Intergenic
1078791082 11:14542803-14542825 CAACCTGCAAAGATGGTTTCTGG - Intronic
1078932686 11:15924875-15924897 CATCTTAGATAGATGGTTCTAGG + Intergenic
1079050947 11:17158701-17158723 CTTCAGGGAAAGATGATTCTTGG - Intronic
1079870227 11:25788857-25788879 CATATAGCAAAGATGGTTCTGGG + Intergenic
1080962444 11:37176171-37176193 CATCATGCTAGGATGTTTATTGG + Intergenic
1083471270 11:62885650-62885672 CATCTTACAATGATGATTCTGGG + Intronic
1085680341 11:78568310-78568332 CATCATGCAAAAGTCATTCTTGG + Intronic
1085713871 11:78854479-78854501 CACCATGAAAAAATGGGTCTGGG - Intronic
1089075486 11:115735185-115735207 CTTCATGGAAAGGTGTTTCTGGG + Intergenic
1090672335 11:128957397-128957419 CATCAAGCAAAGGTGGTGTTGGG - Intergenic
1092708488 12:11309211-11309233 CTTCATGCAAACTTGATTCTGGG - Intronic
1095650855 12:44607242-44607264 CATTTTGCAAAGATGGCTGTAGG - Exonic
1100045810 12:90379289-90379311 CATCATTGAAAGATGATTTTCGG - Intergenic
1102219051 12:111182081-111182103 CTTGATGCAAAGATGTTTCAGGG + Intronic
1103249963 12:119491138-119491160 CATCATGGAAAGATGCCTATTGG - Intronic
1103959670 12:124601170-124601192 TAACATACATAGATGGTTCTAGG - Intergenic
1104227748 12:126852435-126852457 CATCATGCAAAGACTTTGCTAGG + Intergenic
1105272129 13:18887252-18887274 CATCATGGAAAGTTTGTTATAGG + Intergenic
1105476758 13:20734717-20734739 CATCATTTAAAGATGATACTCGG - Intronic
1106633604 13:31503924-31503946 CACCATGTAAAGAAGGTCCTTGG + Intergenic
1108359889 13:49659402-49659424 CATCATGCCTAGCTGGTTGTTGG + Intergenic
1109507575 13:63325789-63325811 CATTTTGCAAAGATTTTTCTGGG - Intergenic
1110466112 13:75803910-75803932 CAACATGCAAAAATAATTCTGGG - Intronic
1110722267 13:78776845-78776867 AATCATGCATAGCTGGTACTAGG + Intergenic
1111109551 13:83688928-83688950 GATCATGAAAAGATGTATCTAGG + Intergenic
1112432201 13:99359849-99359871 CACCATGCAGGGAAGGTTCTGGG - Intronic
1112465638 13:99642300-99642322 CATCAGCCAAAGCTGGTTGTAGG + Intronic
1112677732 13:101722935-101722957 CATCATGCAAAGATGGTTCTCGG + Exonic
1117838897 14:59836726-59836748 CAACAGGCAAAGATGGGTCAAGG + Intronic
1117902611 14:60550924-60550946 CAGCATGCATAGTTGTTTCTCGG + Intergenic
1120784755 14:88522917-88522939 CATCAGGCAAAGATTTTTCCTGG + Intronic
1121366572 14:93317674-93317696 CTGCATGCAAAGATGGCCCTTGG + Intronic
1121848989 14:97202159-97202181 CATCATCCAAAGGAGTTTCTGGG - Intergenic
1121993286 14:98582064-98582086 AATCAGGCAAAGATGGTTCAGGG - Intergenic
1124459761 15:29878621-29878643 CACCTTTCAAAGATGCTTCTGGG - Intronic
1129115078 15:73361049-73361071 CAACATGAAAATATGGCTCTCGG - Intronic
1130069818 15:80636945-80636967 CAGCAGGCAAGGCTGGTTCTGGG - Intergenic
1134228104 16:12407824-12407846 CATCATGCACAGCTGCTTTTAGG - Intronic
1136041599 16:27583818-27583840 CATCAGGCATGGATGGATCTAGG + Intronic
1136057359 16:27700358-27700380 AACCAAGCAAAGATGGTCCTGGG - Intronic
1139336244 16:66233592-66233614 CAGCATGCAAAGCTGGTGCAAGG - Intergenic
1142976730 17:3649130-3649152 CCTGAGGCAAAAATGGTTCTGGG + Intronic
1144867521 17:18346277-18346299 GAACATGAAAAGATGGTTCCGGG + Intronic
1147930230 17:43975187-43975209 CATTAAGAACAGATGGTTCTGGG - Intronic
1149072883 17:52563992-52564014 CATCATCAGAAGATGGTTCAAGG - Intergenic
1151109844 17:71663471-71663493 CATCATGTAAAAATGTTTCTGGG + Intergenic
1156102414 18:33613200-33613222 CATCATGGCCAGATGGTTCTGGG + Intronic
1156952372 18:42918037-42918059 CACAATGCAAAAATGGTACTAGG - Intronic
1158957562 18:62554876-62554898 TATCATGCAAAATTGCTTCTTGG - Intronic
1159005437 18:63006114-63006136 CATCATGCAGAGATGGTACAAGG - Intergenic
1162522270 19:11188678-11188700 CTTCATTCAAAGATGCTCCTTGG + Intronic
1165729154 19:38133293-38133315 CGTCATGAAATGATGGATCTAGG - Intronic
1166016721 19:39986189-39986211 CAAAATGAAAAGTTGGTTCTTGG + Intronic
929281059 2:40079261-40079283 CATCTGGAAAAGATAGTTCTGGG + Intergenic
929748053 2:44679764-44679786 CAACATGCACAGTTGGTTCATGG + Intronic
929808318 2:45168234-45168256 CATCATTCAAAAATAGTTGTTGG - Intergenic
930016182 2:46972067-46972089 CTTCAGGCAAAGCTGGATCTAGG + Intronic
932704508 2:74012648-74012670 CAACATGCAAAGACGGTCCTAGG - Intronic
933186150 2:79281137-79281159 GATCATGTAAGGATGGTTCTTGG - Intronic
938294073 2:130166439-130166461 CATGATGCCCAGATGGCTCTTGG - Intronic
938462573 2:131507447-131507469 CATGATGCCCAGATGGCTCTTGG + Intergenic
942458748 2:176155376-176155398 CCTCATGAAAACATGTTTCTTGG - Intronic
943146235 2:184049318-184049340 GAACATGAAAAGATGGTTCCTGG - Intergenic
943815152 2:192244836-192244858 CATCAGGCAGATATTGTTCTAGG - Intergenic
944386197 2:199167689-199167711 CAGCTTGCAGAGAGGGTTCTGGG - Intergenic
944691097 2:202159191-202159213 CATCATCCAAAGATGGAGCAGGG + Intronic
946507232 2:220314710-220314732 CAGCATGCAAAAGTGTTTCTTGG + Intergenic
947317545 2:228877892-228877914 CAGCATGTAAAGATGGTATTTGG - Intronic
1173455634 20:43199154-43199176 CTTCAGGCAAAGCTGGATCTAGG + Intergenic
1174114126 20:48215150-48215172 CATCATGCAATGATCATTCTTGG + Intergenic
1174789855 20:53467819-53467841 CCTCATGGAAAGGTGGTTCTTGG - Intronic
1175117589 20:56694048-56694070 CTTCAGGCACAGATGGATCTAGG + Intergenic
1176665611 21:9684380-9684402 CATCCTGCAACCATGTTTCTAGG + Intergenic
1177428216 21:20953830-20953852 AATCAAGTAAAGATGGTTATTGG + Intergenic
1179336904 21:40465037-40465059 CATGGTTCAAAGATGGTTCTGGG - Intronic
1179915139 21:44472419-44472441 CATCATGCAGAGATAGTTGATGG + Intergenic
1179955078 21:44734047-44734069 CAACATGCAAAAATAGATCTTGG + Intergenic
1182381453 22:29892518-29892540 CATCATGGAAAGTTTGTTATAGG - Intronic
1185057383 22:48588046-48588068 CATTATGCACAGATGGAGCTTGG - Intronic
949607501 3:5670386-5670408 CTGCATGTAAAGATGGTTTTTGG - Intergenic
950782384 3:15403094-15403116 CATTTTGCAAAGGTGGTTCCAGG + Intronic
950941083 3:16892248-16892270 CTTCATTTAAAGATGGATCTAGG + Intronic
951388881 3:22077680-22077702 CCTCATACAGAGATGCTTCTCGG + Intronic
955081188 3:55659325-55659347 CATCATGCAAATATTATTCTGGG - Intronic
956575078 3:70743662-70743684 CATCATTAAAAAATGGTTCAAGG - Intergenic
957192798 3:77031319-77031341 GATGATGGGAAGATGGTTCTTGG + Intronic
957866157 3:86026247-86026269 AAACATGGAAAGATGGTACTAGG + Intronic
958026129 3:88050991-88051013 CATGATGCAAGGATACTTCTGGG - Intergenic
958430571 3:94035635-94035657 AATCATGGAAAGATAGTTCATGG - Intronic
962168903 3:133079889-133079911 CATCATGTAAAGGAGCTTCTGGG + Intronic
963037296 3:141042788-141042810 AATCATACAAAGAGGGTGCTCGG + Intergenic
970902198 4:21172909-21172931 CATCATACTCAGATGATTCTTGG + Intronic
971392258 4:26197286-26197308 CATGATGGAAAGGTGGTCCTGGG - Intronic
973839391 4:54845420-54845442 CATCATAAAGAGAGGGTTCTGGG - Intergenic
974169931 4:58252808-58252830 AATGATGCAAAGCTGGGTCTGGG + Intergenic
974646849 4:64705447-64705469 CACCATGCCCAGAGGGTTCTAGG - Intergenic
974828256 4:67156526-67156548 CAATATGCAAAGTTGGCTCTTGG - Intergenic
975111469 4:70632956-70632978 AGTCAAGAAAAGATGGTTCTGGG + Intronic
975525767 4:75348961-75348983 CTTCATACATAGATGGTTCATGG - Intergenic
975644719 4:76534924-76534946 TATCATGCAAAAATGGATCTGGG - Intronic
977281345 4:95043643-95043665 CATCAGACAAAGATGCTTCATGG - Intronic
985052154 4:186001641-186001663 CATCATACACAGAAGGTGCTGGG + Intergenic
985309446 4:188580858-188580880 CCTCACCCACAGATGGTTCTGGG + Intergenic
986837443 5:11654950-11654972 AATCATGAAAAGATGTTTCATGG + Intronic
991141390 5:63248100-63248122 CATCAAGAAAAGATGGTGTTTGG - Intergenic
998695071 5:144629708-144629730 CAGAAGGCAAAGATGATTCTGGG - Intergenic
998970906 5:147591360-147591382 GATCAAGCAAAGATGTGTCTTGG - Exonic
999642257 5:153683270-153683292 CATCATGGAATGGTGTTTCTGGG + Intronic
1000325116 5:160166114-160166136 CATCATTTAAAGCTGGATCTAGG - Intergenic
1000651580 5:163824555-163824577 CATCATATAAAGTAGGTTCTTGG + Intergenic
1000770403 5:165346293-165346315 GAAGATGGAAAGATGGTTCTGGG + Intergenic
1003251018 6:4429310-4429332 GCTCATGCAAAGATGGTATTAGG - Intergenic
1003293868 6:4806346-4806368 CATTTTGGAAAGATGGCTCTGGG - Intronic
1007994704 6:46294193-46294215 CAACATGCATAGATGATTCACGG + Intronic
1014728546 6:125003495-125003517 CGTCATCCAAAGATGATTGTAGG + Intronic
1016632693 6:146250465-146250487 CATCATGGAAGGATGGTTAGTGG - Intronic
1018446122 6:163860590-163860612 CATCACTCACAGAAGGTTCTGGG - Intergenic
1021636281 7:22697199-22697221 CCCTATACAAAGATGGTTCTAGG + Intergenic
1027488261 7:78788799-78788821 CATCATATAAAGATGTTTCAAGG - Intronic
1027856573 7:83519343-83519365 GATTCTGGAAAGATGGTTCTAGG - Intronic
1031594111 7:123627851-123627873 CACCATGAGAAGATGGTTTTAGG + Intronic
1032851745 7:135801306-135801328 CAACATGCAAAGAGAGTTCAGGG - Intergenic
1035664209 8:1368833-1368855 CATCAGGAATAGATGGTTCCAGG - Intergenic
1038690696 8:29760488-29760510 CTCAATGAAAAGATGGTTCTGGG - Intergenic
1043008536 8:74852041-74852063 CAGCATGCAACAATGGTGCTAGG + Exonic
1045271515 8:100666021-100666043 CATCATGCATACATGAATCTGGG + Intergenic
1047176933 8:122550607-122550629 CATAAAGTAAAGATGGTTATGGG + Intergenic
1058727357 9:107817017-107817039 CATCATTCAAGGTTGGTTCTAGG + Intergenic
1059735450 9:117095335-117095357 CATCAGGGAACGATGGATCTTGG + Intronic
1061297973 9:129687260-129687282 CAACATGCACAGATGCTTCATGG + Intronic
1203660492 Un_KI270753v1:37381-37403 CATCCTGCAACCATGTTTCTAGG - Intergenic
1188232743 X:27685488-27685510 CCTCTTTCATAGATGGTTCTGGG + Intronic
1188416039 X:29935782-29935804 CAAAATGCAAATATGGTTGTTGG - Intronic
1191737024 X:64397824-64397846 CATCAAGCAAATTTGGTTTTGGG - Intergenic
1194961401 X:100240457-100240479 CATCATCGTAACATGGTTCTGGG - Intergenic
1197183130 X:123558375-123558397 AATCATGCTCAGATGCTTCTTGG - Intergenic
1198416261 X:136422879-136422901 CATCATGCTCAGTTGGTTGTGGG + Intergenic
1199071838 X:143485952-143485974 CACTATGCAAAGATGTATCTGGG + Intergenic
1200282550 X:154790107-154790129 CAAAATGTAAAGATGGTTGTTGG - Intronic