ID: 1112677909

View in Genome Browser
Species Human (GRCh38)
Location 13:101725125-101725147
Sequence GAGTGAAAAGAGATAAAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 728
Summary {0: 1, 1: 1, 2: 3, 3: 68, 4: 655}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112677909 Original CRISPR GAGTGAAAAGAGATAAAGCA CGG Intronic
901261104 1:7871532-7871554 GAGTGAAGATAAATAAAACAAGG - Intergenic
902083454 1:13837670-13837692 GAGAGAAAGGAGAGAAAGGAGGG - Intergenic
902464691 1:16608784-16608806 GAGATAAAAGAGAGAAATCAAGG + Intronic
902568947 1:17334113-17334135 GACTGAGTAGAGAAAAAGCATGG + Intronic
903094138 1:20953350-20953372 GAGTGAAAAGAGTTTAAGGGAGG + Intronic
903156112 1:21444921-21444943 GAGATAAAAGAGAGAAATCAAGG - Intronic
904706565 1:32395201-32395223 GAGGGAAAAGAGATGAAGGGGGG - Intergenic
905608381 1:39325704-39325726 GAGGGAAAGGAGATTAAGAAAGG + Intronic
905788200 1:40774642-40774664 GAGTGAAAAGAAACAAAGCTGGG - Intergenic
906106268 1:43294635-43294657 GAGTGACCTGAGCTAAAGCAAGG + Intergenic
906320944 1:44815021-44815043 GTGTGAAGAGCGATAAGGCAAGG - Intronic
906868087 1:49445441-49445463 GAGGGAAAAGAGACAAAGAGAGG - Intronic
906993819 1:50768182-50768204 GATTAAAAAAAGATAAAGAAGGG + Intronic
907169516 1:52449108-52449130 GAGAGAACAGAGAGACAGCAGGG - Intronic
907313593 1:53553810-53553832 GTGGGAAAAGAGACAGAGCAAGG + Intronic
907695464 1:56722716-56722738 GAGTGGCAAGAGATAAAGCCAGG + Intronic
908166131 1:61461237-61461259 GTGTGAAGACAGATCAAGCATGG - Intronic
908383602 1:63619517-63619539 GAGTGGAAAAAGATTAACCAAGG - Intronic
908844626 1:68312173-68312195 GAGAGAAAAGAAAGAAAGGAAGG - Intergenic
910568999 1:88679373-88679395 GAAGGAAAAGTGGTAAAGCATGG - Intergenic
910778756 1:90903439-90903461 GAGGGAAAAGATTTAAAGAATGG + Intergenic
910964813 1:92797755-92797777 GAGATAAAAGAGAGAACGCAAGG + Intergenic
911571066 1:99517561-99517583 GAGTAGAAAGGGATAAAGCAGGG - Intergenic
912304941 1:108557843-108557865 GAATGAAAAGAGAGAGAGAATGG - Intergenic
912572067 1:110632040-110632062 AACTGAAAAGAGATACTGCAGGG + Intergenic
913105012 1:115606076-115606098 GAGAGAAAAGAGATGAGGCAAGG - Intergenic
913368628 1:118071289-118071311 GAGGAAAAAGAGATAATTCATGG + Intronic
913520154 1:119637977-119637999 GAGAGAAAAGAGAGAGAGAAAGG + Intronic
913600766 1:120419823-120419845 GAGATAAAAGAGAGAAATCATGG - Intergenic
914086291 1:144456810-144456832 GAGATAAAAGAGAGAAATCATGG + Intronic
914192185 1:145420761-145420783 GAGATAAAAGAGAGAAATCATGG + Intergenic
914361908 1:146943264-146943286 GAGATAAAAGAGAGAAATCAAGG - Intronic
914489717 1:148143691-148143713 GAGATAAAAGAGAGAAATCAAGG + Intronic
914590092 1:149098711-149098733 GAGATAAAAGAGAGAAATCATGG + Intronic
914942762 1:152037186-152037208 GAGGGAAAAGAGGGAAAGGAGGG - Intronic
915051805 1:153083594-153083616 GGCTGAAAAGAGAGAAAGCTGGG + Intergenic
915790252 1:158662007-158662029 GAGGGAAAAGAGATAAAGCATGG - Intronic
915930240 1:160056057-160056079 GAGGGGGAAGAGAGAAAGCAGGG - Intronic
916526636 1:165616693-165616715 GTCTGAAGAGAAATAAAGCAAGG + Intergenic
916667884 1:166983371-166983393 GAGTGAAGAGAGAGAAAAAAAGG - Intronic
916750402 1:167718500-167718522 AAGGGAAAAGAGAGAGAGCAGGG - Intergenic
916784069 1:168070907-168070929 GAATGTCAAGAGATAATGCAGGG - Intronic
917166047 1:172114350-172114372 GAGTGGAAAGAGATTAGGCTGGG + Intronic
917304288 1:173610949-173610971 GAGAGAAGAGAGATTAAGTACGG - Intronic
917379903 1:174394343-174394365 GAATGAAAAGATAAAAACCAAGG - Intronic
917448330 1:175125681-175125703 GAGAAAAAAGAGAGAAAGAAAGG - Intronic
917646509 1:177033924-177033946 GAGTGAATAGAGATTGTGCACGG - Intronic
917781291 1:178399927-178399949 GAGCTAAAAGACATTAAGCAAGG - Intronic
917920933 1:179749234-179749256 GAGAGAAAAAAGGAAAAGCATGG + Intronic
918376488 1:183914283-183914305 GAGACAAAAAAGATGAAGCAAGG - Intronic
918615936 1:186543520-186543542 GAGTGCAAAGAGACAAAGAAAGG + Intergenic
918653335 1:186993409-186993431 GAGTGAAGAAAGATAAAAGAGGG - Intergenic
920128548 1:203712945-203712967 GAGGAAAAAGAAAAAAAGCAGGG + Intronic
920780933 1:208990456-208990478 GTGTGAACGTAGATAAAGCATGG - Intergenic
920902562 1:210125892-210125914 TAGTGGAAAGAGGTAAAGAAAGG + Intronic
920951286 1:210573895-210573917 GAGGCAAAAGAGATGAACCAGGG + Intronic
921005237 1:211086543-211086565 GAGAGAAAAAAGATAAAGGAGGG + Intronic
921132224 1:212229671-212229693 GAGGGAAAAGAAAGAAAGCAAGG - Intergenic
921316034 1:213891941-213891963 GAGTGAAAAGAGATAGCTCAAGG + Intergenic
921684871 1:218078256-218078278 AAGGGAAAAGAGAGAAAGCACGG + Intergenic
921781572 1:219171718-219171740 GAGTGCACAGAAATGAAGCAAGG - Intergenic
922182910 1:223249866-223249888 CAGTGAAAAGAGAGGAAGAAAGG + Intronic
922370786 1:224908781-224908803 GAGTAAAAAGAGATAGAAAAAGG - Intronic
922545739 1:226455507-226455529 GAGTGACTAGAGATACAGCTGGG - Intergenic
923057726 1:230440117-230440139 GAGAGAAAAGAAAGAAAGCAAGG - Intergenic
923368802 1:233289688-233289710 GAGTCAAAGGAAAGAAAGCATGG + Intronic
924108751 1:240676288-240676310 GAGTTAAAGGGGATAAAACAGGG + Intergenic
924159505 1:241216321-241216343 GAATAAAAAGAGGTAAAACATGG + Intronic
924603771 1:245514860-245514882 GAATTAAATGAGATAATGCATGG + Intronic
1063266211 10:4453946-4453968 GAGAGAAAAGGAATAAAGAATGG + Intergenic
1063773052 10:9226357-9226379 GAGTGAAGAGAAAGAAAGTAGGG - Intergenic
1063824435 10:9878330-9878352 GAGAGAAAAGAGAGAAAGATGGG - Intergenic
1064140902 10:12789379-12789401 GAGTGAAAAGAGCTGCAACAAGG + Intronic
1064188152 10:13181551-13181573 TAGGGAAAAGAGCTAATGCATGG + Intronic
1064906218 10:20348780-20348802 GAGCCTAAAAAGATAAAGCAGGG + Intergenic
1065254156 10:23848437-23848459 GGTTGAAAAGAGATAAAGAAGGG - Intronic
1065482517 10:26210097-26210119 GAGCGAAAAGAGAGAGAGAAGGG + Intronic
1065638317 10:27753311-27753333 GAGGGAAAAGAGAGAGAGGAAGG - Intergenic
1065916019 10:30355607-30355629 GACTGAAATGAGAGAAAGCTGGG - Intronic
1066257416 10:33694131-33694153 GAAAGAAAAGAAAAAAAGCAGGG - Intergenic
1066528393 10:36307854-36307876 GGTTCAAAAGAGATCAAGCAAGG + Intergenic
1066626814 10:37415509-37415531 GAAGAAAAAGAGATAAAGGAGGG + Intergenic
1067330287 10:45309369-45309391 GGATGAAATGAGATCAAGCAGGG - Intronic
1067950909 10:50738167-50738189 GAGGGAAAAGTCATAAAGGAAGG + Intergenic
1067979073 10:51062151-51062173 GATTGAACAGATATAAAGCAGGG + Intronic
1068023531 10:51615430-51615452 GAGAGAAAAGAGAAAATGAAAGG - Intronic
1068258525 10:54545541-54545563 GAAAGAAAGGAGAGAAAGCAAGG + Intronic
1069282626 10:66674674-66674696 GAGAGAATAGGGATAAAGCTGGG - Intronic
1069366204 10:67696418-67696440 AAGTGAAAAATGATAAAGCAGGG + Intergenic
1070886262 10:79903381-79903403 GAGGGAAAAGTCATAAAGGAAGG + Intergenic
1071366366 10:84904490-84904512 GAGAGAAAAGAGAAAAATGAAGG - Intergenic
1071406394 10:85337595-85337617 GAGAGGAAAGAGATAAAGTGTGG - Intergenic
1071472592 10:85994316-85994338 GAGTGGACAGAGGTAAGGCAGGG + Intronic
1071944294 10:90624141-90624163 GAAGGAAAAGAGAAAAAACAGGG - Intergenic
1072411955 10:95210991-95211013 GAGGGAAAAGAGGAAGAGCAGGG + Intronic
1072775196 10:98184258-98184280 GTGAGCAAAGAGCTAAAGCATGG - Intronic
1073525367 10:104176676-104176698 GACTCAAATGAGATCAAGCAAGG + Intronic
1073891620 10:108109351-108109373 GAGAGAAAAGAGAAACTGCAGGG - Intergenic
1074278894 10:112032291-112032313 GAGTAGAGAGAGATAAAGAAGGG + Intergenic
1074300733 10:112231394-112231416 GATTTAAAGGATATAAAGCAGGG + Intergenic
1074795253 10:116936919-116936941 AGATGAAAAGAGATAAAGAAGGG - Intronic
1075625075 10:123958186-123958208 GGCTGAAAAGAGAAAAAGAAAGG - Intergenic
1076506410 10:130976120-130976142 CAGTGAAAAGGAATAAAGTAAGG - Intergenic
1076854690 10:133110096-133110118 GAGGGAAAAGACATCCAGCAGGG + Intronic
1077755172 11:5020804-5020826 GAATGAGAAGAGAGAAAGAAAGG - Intergenic
1077796450 11:5497664-5497686 GACTGACAAGAGAAAAAGGAAGG - Intronic
1077881144 11:6351388-6351410 GAGTGGGAAGAGCTAATGCAAGG - Intergenic
1077898322 11:6470753-6470775 GAGGGTAAAGAGAGAAAGGAGGG + Intronic
1078654600 11:13226427-13226449 GAGTAGAAAGAGATAAAGATTGG + Intergenic
1078797913 11:14611769-14611791 GAGAGAAGAGAGAGAGAGCATGG - Intronic
1079079212 11:17402393-17402415 GCATGAAAAGAGACAAAGCTGGG - Intronic
1079399053 11:20091134-20091156 GACTGAAAAGAGATAAAGGCTGG - Intronic
1080599467 11:33808316-33808338 GGATGAAAAGAGAAAAAGAAAGG - Intergenic
1080786825 11:35482998-35483020 CAGTCAAAAGAAATAGAGCATGG - Intronic
1080826328 11:35852185-35852207 GAGTGAAATGGGATTGAGCAAGG - Intergenic
1080969764 11:37258544-37258566 GAGAGAAAAGAGGGAAAGTAAGG + Intergenic
1081027567 11:38034926-38034948 GAGTGAAAACAGAGACAGAAAGG + Intergenic
1081852911 11:46285994-46286016 GAGGGAAATGAGGTAAAGAAGGG - Intronic
1083129419 11:60610426-60610448 AAGTGAAAAGAGAACAAACATGG + Intergenic
1083324006 11:61864164-61864186 CAGTGACAAGAGGTGAAGCAAGG - Intronic
1083377170 11:62233538-62233560 GAATGAAAAGAAATGAAGAAAGG - Intergenic
1084073561 11:66754249-66754271 GAAAGAAAAGAGAGAATGCAAGG - Intronic
1084522253 11:69670834-69670856 GAATGAAGATAGATAAAGCAGGG + Intronic
1085069528 11:73530593-73530615 GAGGGAAAAGTGAAAAAGGAAGG - Intronic
1085225456 11:74916255-74916277 GAAGGAGAAGAGAGAAAGCACGG - Intronic
1085737576 11:79052596-79052618 GAGTAAAAAGAAATAAAGAAAGG + Intronic
1085785472 11:79444648-79444670 GATTGAAAAGGGATAAAGTCAGG - Intergenic
1085880346 11:80460057-80460079 GAGTGAGAAAAGATAAAAGAAGG - Intergenic
1085970578 11:81585476-81585498 GAGTGAAAAGTGACAAAGAGCGG + Intergenic
1086435355 11:86774762-86774784 GATTTAAATGAGATAATGCATGG + Intergenic
1086588728 11:88485901-88485923 GAGTGAAGAGAGAGAGAGCAGGG - Intergenic
1086812639 11:91329659-91329681 GAGAGAAAAGAGATAAATTTAGG - Intergenic
1086875137 11:92086740-92086762 GAAGGGAAAGAGAAAAAGCAAGG + Intergenic
1087182438 11:95153074-95153096 GAGTGAGTAGAGACATAGCAGGG + Intergenic
1087646977 11:100819357-100819379 GAGTGAAAATAGAAATGGCAGGG + Intronic
1087824843 11:102753571-102753593 GAGACAAAAGAGCTATAGCAAGG + Intergenic
1088053475 11:105547576-105547598 AATTGAAGAGAGAGAAAGCAAGG + Intergenic
1088258699 11:107925246-107925268 GAGGGAAAAGAGATGAAGGAAGG + Intronic
1088988104 11:114927700-114927722 GAGAGAGAAGATATACAGCATGG + Intergenic
1089367512 11:117930100-117930122 GAGTCAAAAGAAGTAAAGGAAGG + Intergenic
1089568154 11:119383458-119383480 GAGTGAAGAGAGAGAAAGATAGG + Intergenic
1089755956 11:120687259-120687281 GAGTGAAAAGACCCAAGGCATGG - Intronic
1089849901 11:121486986-121487008 GGGGGAAAAGAGATATAGCATGG - Intronic
1089873836 11:121701088-121701110 GCCTTGAAAGAGATAAAGCATGG - Intergenic
1090090101 11:123688697-123688719 GAGTGGAGAGTGATAAAGCTGGG - Intergenic
1090565531 11:127987941-127987963 GAGTGAAAACATAGAAAGAAAGG + Intergenic
1090656890 11:128852967-128852989 GAGTGAAAAGAAACAAGGAAAGG - Intronic
1090684144 11:129096810-129096832 GAGGAAAAAGAGAAAAATCAAGG - Intronic
1090718447 11:129451440-129451462 AAGGGAAAAGAGAGAAGGCAGGG + Exonic
1090749018 11:129729780-129729802 GAGGGAAATGACGTAAAGCATGG + Intergenic
1090947471 11:131444276-131444298 GAATGAAATGAGAAAAAGCAGGG + Intronic
1090989752 11:131805387-131805409 GAATGAAAACAGATCAAACAAGG - Intronic
1091159462 11:133406680-133406702 GTGTGCAGAGAGATAAAGCCAGG + Intronic
1092398341 12:8148396-8148418 AAGTCAAAAGAGACAAAGAAGGG + Intronic
1092402523 12:8188798-8188820 AAGTGAACAGAGAGGAAGCAGGG + Intergenic
1092489142 12:8929408-8929430 GAATGGAAAGAAATAAAGCAAGG - Intronic
1092719375 12:11425586-11425608 GAATGAAAAGAGATGATCCATGG - Intronic
1093080798 12:14808394-14808416 GAGAGAAAAGAGAGAAAAAATGG + Intronic
1093400610 12:18742140-18742162 GAGAGAAAAGAGAGAGAGCGAGG - Intergenic
1093621936 12:21302149-21302171 TAGTGAAAGGAGAGAAAGCAGGG - Intronic
1093664220 12:21793308-21793330 GATTAAAAAAAGATAAAGAAGGG - Intergenic
1095517341 12:43021161-43021183 GAGAAAAAAGAGAGAAAACAAGG - Intergenic
1095701686 12:45197009-45197031 GAGTGAAAAGAGATGAAGGCAGG + Intergenic
1095756156 12:45769493-45769515 GTGTGAAGAGAAAAAAAGCATGG + Intronic
1095900400 12:47321860-47321882 GAGTGAATAAAGAAAATGCATGG + Intergenic
1096300210 12:50420569-50420591 GAGTAAAGAGAGATTAAGAATGG + Intronic
1096617645 12:52843069-52843091 GAAAGAAAAGAGATGAAGCTGGG + Intronic
1096858507 12:54504787-54504809 GAATTAAATGAGATAATGCATGG + Intronic
1097675435 12:62597289-62597311 GAATTAAAAGAGAAAAATCAGGG - Exonic
1098164674 12:67681956-67681978 TAGTGCAAAAAGATAAAGGATGG + Intergenic
1098496628 12:71143247-71143269 GAGAGAAAAGAATAAAAGCACGG + Intronic
1099085002 12:78235115-78235137 GTTAGAAAAGAAATAAAGCAGGG + Intergenic
1099801351 12:87460654-87460676 GAGTGAAGGGAGAAAATGCAAGG + Intergenic
1099830877 12:87840972-87840994 AAGAGAAAACAGAAAAAGCAAGG - Intergenic
1100680910 12:96919540-96919562 TAGAGAAAAGAGAAAAATCATGG - Intronic
1100745021 12:97636132-97636154 GAGAGAAAAGAGAAAAAGAAAGG - Intergenic
1101170202 12:102084338-102084360 GAATCAACAGAGAAAAAGCATGG + Intronic
1101375983 12:104172112-104172134 GAGTGTAAAGAGACAAAACGAGG - Intergenic
1102374537 12:112411002-112411024 GAATTAAATGAAATAAAGCAAGG - Intronic
1102579742 12:113878791-113878813 GAGTGAAAAGAAAAAAAGCCAGG + Intronic
1102660055 12:114518468-114518490 AAAAGAAAAGAGTTAAAGCAAGG + Intergenic
1103041503 12:117699310-117699332 GAATTAAATGAGATAATGCATGG - Intronic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1105737142 13:23283440-23283462 AATGGAAAAAAGATAAAGCAGGG - Intronic
1107132376 13:36910593-36910615 GAGTGAAAAGAGATGAGGCTGGG - Intronic
1107155360 13:37160343-37160365 CAGTAAAAAGAGACAAAGAAGGG - Intergenic
1107603553 13:42038001-42038023 GAGTGAAATGAGATAACGCATGG + Intergenic
1108008656 13:45979871-45979893 GAGACAACAGAGATCAAGCAAGG - Exonic
1108096004 13:46901952-46901974 GAGTGAGTGGAGATAAAGAAGGG + Intergenic
1108190235 13:47930838-47930860 AAGAGAAAAGAGAGAAAGGAAGG + Intergenic
1108228217 13:48312343-48312365 GAGAGAAAAGATATAAATAATGG - Intronic
1108343597 13:49522055-49522077 GAGTGAAAAGAAAAAGAGGAAGG + Exonic
1108446525 13:50514442-50514464 GAAAGAAAAGAGAGAAAGAAAGG + Intronic
1108606993 13:52049554-52049576 GAATGCAAAGAGGTACAGCAGGG + Intronic
1109486682 13:63031633-63031655 TAATGGAAAGAAATAAAGCATGG - Intergenic
1109852514 13:68085666-68085688 GATTGAAAGGAGATAAAGAATGG + Intergenic
1110419274 13:75287205-75287227 CAGTGAGAAGAGATGAAGCATGG - Intronic
1111603032 13:90498509-90498531 GAGAGAAAAGAGAGAAAGACAGG - Intergenic
1112081124 13:95972063-95972085 GAGTGACCATTGATAAAGCAAGG + Intronic
1112544144 13:100348811-100348833 GAGAGAAAAGAAAGAAAGGAAGG - Intronic
1112677909 13:101725125-101725147 GAGTGAAAAGAGATAAAGCACGG + Intronic
1113001880 13:105648562-105648584 GAGTAAAAAGAGAAAAACAAAGG - Intergenic
1114135685 14:19846699-19846721 GAATGAAAAGAATTAAAGGAAGG + Intergenic
1114342700 14:21761516-21761538 GAGTGAAAAGAAATGAAAAAAGG + Intergenic
1114357333 14:21925701-21925723 CTGTAACAAGAGATAAAGCATGG + Intergenic
1115498757 14:34031137-34031159 GAGGGAGAAGAGACAAAGCTGGG + Intronic
1115590287 14:34857718-34857740 GATTGAAACGAGGTCAAGCATGG - Intronic
1115696578 14:35905713-35905735 GAGTAAAAAGAGAAGAAGTATGG - Intronic
1115840629 14:37465983-37466005 GAGTTAAATTAGATAAAACAAGG + Intronic
1115913701 14:38285875-38285897 GAGAGAAGAGAGAGAAAGGAAGG + Intergenic
1116592970 14:46803525-46803547 GAGAGGAAAGAGATAAACAATGG + Intergenic
1116678105 14:47931615-47931637 GGATTAAATGAGATAAAGCATGG + Intergenic
1116969678 14:51051303-51051325 GATTGAAAAGAGAGCAAGGAAGG + Intronic
1117376721 14:55124307-55124329 GAGTGAAAGGAGACAAAGGCTGG + Intronic
1117587166 14:57221230-57221252 AAGTGCAAAGAGACTAAGCAAGG + Intronic
1118111259 14:62722445-62722467 CAGTGAAGAGTGACAAAGCAGGG + Intronic
1118221627 14:63859894-63859916 GAAAGAAAAGAGAGAAAGGAGGG - Intronic
1118592988 14:67414741-67414763 GAGTGGAAAAGGATAAATCATGG + Intergenic
1118672798 14:68147776-68147798 GAACCAAAAAAGATAAAGCAAGG + Intronic
1119830558 14:77698251-77698273 GAGAGGAAAGAAATAGAGCAAGG + Intronic
1119978941 14:79057933-79057955 GAGTGATAATTGATGAAGCAAGG + Intronic
1120100991 14:80445565-80445587 GTGTGAAAACAGTTAAAGCTCGG - Intergenic
1120147339 14:80993044-80993066 GAGTTAAAAGAGCTCAAGTAGGG + Intronic
1120554750 14:85915974-85915996 CAGAGAAGAGAGATAAAGAAAGG - Intergenic
1120823355 14:88933188-88933210 GAGGGAAGAGAGAGACAGCAGGG + Intergenic
1121146685 14:91590121-91590143 GAATTAAATGAGATAAATCACGG + Intronic
1121797679 14:96748697-96748719 GAGTAAAATCAGATCAAGCAGGG - Intergenic
1121804766 14:96808061-96808083 GATTGAAAAGAGATTGAGTATGG + Intronic
1122132988 14:99616629-99616651 GGGTGGAGAGAGATAAGGCAGGG + Intergenic
1122445487 14:101764495-101764517 GATAGAAAAGAGAGAATGCAGGG - Intronic
1202937450 14_KI270725v1_random:104357-104379 GAGAAAAAAGAAAGAAAGCAAGG - Intergenic
1124866691 15:33499233-33499255 GAGCGAAAAGAGGTAAAGAGGGG - Intronic
1125069758 15:35539774-35539796 GAATGAAAAGTGATAGTGCAAGG + Intronic
1125299953 15:38244788-38244810 TAGAGAAAAGAGGGAAAGCAGGG + Intergenic
1125536638 15:40444520-40444542 GTTTGAGAAGAGATAAAACATGG - Intronic
1125990931 15:44107182-44107204 AAATGAAAAGATATAAAGGAAGG + Intronic
1127429962 15:58895429-58895451 TAGTTAAGAGAGACAAAGCAGGG + Intronic
1127495219 15:59504919-59504941 AAGTAAAAATACATAAAGCATGG - Intronic
1127537566 15:59904325-59904347 AAAGGAAAAGAGATAAAGAAAGG + Intergenic
1128334269 15:66776051-66776073 GAGAGAATGGAGCTAAAGCAGGG + Intronic
1129186215 15:73908578-73908600 GACTGAAAGGAGGTAAAGAATGG + Intergenic
1129479320 15:75810540-75810562 GACTGAAATGAGAGAAAGCTGGG + Intergenic
1129798263 15:78394454-78394476 GAGAGCTAAGAGACAAAGCAGGG + Intergenic
1129969477 15:79765128-79765150 GAGTGACAAGAGAAAAAGAATGG - Intergenic
1130114612 15:80996005-80996027 AGGTGAACAGAGAGAAAGCATGG + Intergenic
1130158354 15:81373685-81373707 GAGTGAACATAGAGAAAACAGGG + Intronic
1130446198 15:84004115-84004137 GAATGAAAAGAAAAAAAACAGGG - Intronic
1130630678 15:85565755-85565777 GAGTGGACAGAGAGAGAGCAGGG + Intronic
1130816247 15:87437060-87437082 GAATGAAAGGAAATAAAGAAAGG + Intergenic
1131688608 15:94800708-94800730 GAAAGAAAAGATACAAAGCAAGG - Intergenic
1132952646 16:2572744-2572766 GAGAAAAAAAAAATAAAGCACGG + Intronic
1132961705 16:2627426-2627448 GAGAAAAAAAAAATAAAGCACGG - Intergenic
1133503773 16:6390548-6390570 GAGTGAGAAAAAAAAAAGCATGG + Intronic
1133522091 16:6568436-6568458 GAGAGAAAAGGGAGAAAGAAGGG + Intronic
1134407236 16:13971401-13971423 AAGTGAAAAGAAATAAACAAAGG - Intergenic
1135393879 16:22116299-22116321 GAGAGAAAAAAGAGAAAGGAAGG + Intronic
1135963577 16:27017657-27017679 GAGAGAAAAGAAAGAAAGAAAGG + Intergenic
1137754195 16:50888452-50888474 GAGTGAAATGAGTTAACACATGG + Intergenic
1138713546 16:58996420-58996442 GAGAGAAAAGATAGAATGCATGG + Intergenic
1138828114 16:60345780-60345802 GAGTGAGAGGAGAAAAAGGAGGG - Intergenic
1139001255 16:62512769-62512791 TAGTAAGAAAAGATAAAGCATGG - Intergenic
1139075181 16:63437415-63437437 GAGAAAAAAGCTATAAAGCATGG - Intergenic
1139210028 16:65068010-65068032 GAGAGAGAAGAGGGAAAGCAGGG + Intronic
1139616063 16:68093123-68093145 GACTGAAAAGAGATGAATAAAGG - Intronic
1140957645 16:79880444-79880466 GAGTCAATACAGGTAAAGCATGG - Intergenic
1141641303 16:85343168-85343190 CAATGAAAAGAAACAAAGCATGG + Intergenic
1143909002 17:10232130-10232152 GACTGAAAAGGAACAAAGCATGG + Intergenic
1143971943 17:10802334-10802356 GATCGAAAAGAGATAAGGCAGGG - Intergenic
1144175701 17:12704843-12704865 GAGTGTAGAGAGAGAGAGCATGG + Intronic
1146438594 17:32874244-32874266 GAGAGAAAAGAAAAAAAGAAAGG - Intronic
1146619580 17:34387022-34387044 GAGTCAAATAAGATAATGCACGG + Intergenic
1146911036 17:36648717-36648739 GAGTGCCAGGAGACAAAGCAGGG - Intergenic
1147343349 17:39769143-39769165 CACTGAAAAAAGATAATGCATGG + Intronic
1147413742 17:40273436-40273458 GAGGGGTAAGAGACAAAGCAAGG + Intronic
1147848915 17:43426083-43426105 GGGTAAAAGGAGATAAAGCAAGG + Intergenic
1148327208 17:46790184-46790206 GAGAGGACAGAGCTAAAGCAAGG - Intronic
1148696161 17:49560029-49560051 AAGTGAAACGTAATAAAGCAAGG - Intergenic
1148733598 17:49852051-49852073 GAGGAACAGGAGATAAAGCAGGG + Intergenic
1150235957 17:63592902-63592924 AAGAGAAAAGAGAAAAAGGAGGG - Exonic
1150901851 17:69287754-69287776 GTGTGAAAAGAGGTGAAGAAGGG + Intronic
1150959832 17:69901167-69901189 GACTCAAAAGAGATGGAGCAAGG - Intergenic
1150987732 17:70217684-70217706 AAAAGAAAAGAGAGAAAGCAAGG - Intergenic
1151093397 17:71468027-71468049 AAGTGAAAAGAAAGAAAGAAAGG + Intergenic
1151449283 17:74187879-74187901 GAGTTTAAAGAAATAAAGGAGGG + Intergenic
1152440265 17:80304220-80304242 AATGGAAAAGAAATAAAGCAAGG - Intronic
1153591079 18:6674684-6674706 TAGTGGAAGGAGATAAAGCCTGG - Intergenic
1153978437 18:10289554-10289576 GAGTGGAGAGAGATAAGGTATGG + Intergenic
1154309060 18:13253721-13253743 TAATGAAAAGAAATAAAACATGG - Intronic
1155258316 18:24017423-24017445 GAATGAAAAGAAATAATCCATGG + Intronic
1155558014 18:27043196-27043218 GTGAGAAAAGAGACAAGGCAAGG - Intronic
1156272427 18:35548250-35548272 GAATGAAAAGAGAAAAAGAATGG + Intergenic
1156558391 18:38093116-38093138 GAGAGAAAAGAAAGAAAGAAGGG + Intergenic
1156640845 18:39096058-39096080 GAATAAAGAGAGAGAAAGCATGG - Intergenic
1156927038 18:42594919-42594941 CAGTAAAAAGAGACAAAGAAGGG - Intergenic
1157119294 18:44894065-44894087 GAGTGAAAAGAGATGACTGAGGG + Intronic
1157334149 18:46725044-46725066 GAAGGAAAAGAGAGAAAGAAAGG + Intronic
1157633203 18:49121446-49121468 GAAGGAAAAGAGAGAAAGAATGG + Intronic
1157655521 18:49384026-49384048 GAATGAAAAGAGAGCAAGCCAGG + Intronic
1158015123 18:52774960-52774982 GAGAGAAAAGAGAGAAAGTCTGG + Intronic
1158124919 18:54090547-54090569 GAGGGAAGAGAGAGAAAGCATGG + Intergenic
1158268017 18:55681536-55681558 GAGTGGAAAGAAATAAGGAAAGG - Intergenic
1158293596 18:55969488-55969510 GAGTGAAAACCACTAAAGCATGG + Intergenic
1158412514 18:57220774-57220796 GAGAGAAAGGAGAAAAAGCAAGG - Intergenic
1158625288 18:59066099-59066121 TAGTGAATAAAGATAAAGCAGGG + Intergenic
1158963752 18:62606502-62606524 AAATGAAAAGAGAAAAAGCCAGG - Intergenic
1159545946 18:69839479-69839501 GAGTTAAGAGAGTTAAAGGATGG - Intronic
1159753722 18:72336427-72336449 GAGGGAAACAAGATAAAGCAAGG - Intergenic
1160057935 18:75503220-75503242 GAGTGAAAAGAGGGAAAGGAAGG + Intergenic
1161377518 19:3947525-3947547 GAGAGAAAAGAGAGGAAGGAAGG - Intergenic
1161899874 19:7110403-7110425 GAGGGAAAAGAGATGAAGGCAGG - Intergenic
1162104712 19:8363463-8363485 GAGAGAAAAGAGAGAGAGAAAGG - Intronic
1162774455 19:12970661-12970683 GAGAGAAAAGAAAGAAAGAAAGG - Intronic
1164250061 19:23468323-23468345 GAAAGAAAAGAGAAAAAGGAGGG - Intergenic
1164383912 19:27757503-27757525 GAAAGAAAAGAGAAAAAGTATGG - Intergenic
1166197229 19:41215133-41215155 CAGTGAAGAAAAATAAAGCAAGG - Intergenic
1166935490 19:46329995-46330017 GAGTGAAGAGAGAGGAAGGAAGG + Intronic
1167675198 19:50879681-50879703 GAGTTCAAACAGATACAGCATGG + Exonic
1167706479 19:51084135-51084157 GAGTCGAAAGTGAGAAAGCAAGG - Exonic
925223354 2:2160806-2160828 AAGTCACAAGACATAAAGCAGGG + Intronic
925923109 2:8651161-8651183 GTGTGGAAAGAGAAAAAGCCTGG + Intergenic
926720987 2:15959945-15959967 TAGAGGAAAGAGAGAAAGCACGG - Intergenic
927804002 2:26128885-26128907 GAGTGAATAGGTATAATGCATGG + Intronic
927979081 2:27361964-27361986 GAGTGAAATGATATAATGCTTGG + Intergenic
928406326 2:31017798-31017820 AATTTAAAAGAGATTAAGCAGGG + Intronic
928877739 2:36060475-36060497 CAGTGAGAGGAGATAAACCAAGG + Intergenic
928953697 2:36839229-36839251 GAGGGAAAAAAAATAGAGCAGGG - Intergenic
929319446 2:40524693-40524715 GTGTAAAAAGATATAAAGAAAGG - Intronic
929688853 2:44058076-44058098 GGGTGATGAGAGATAAAGCTGGG + Intergenic
930087182 2:47505988-47506010 GAATCAAAAGAGACAAATCATGG - Intronic
931613667 2:64132092-64132114 TAGTGGAAAGAGAAAAAGGAGGG - Intronic
931958410 2:67453885-67453907 TAGTGAAAAGAGAGAAATCAAGG - Intergenic
932772587 2:74508712-74508734 GAGTGGTAATAGAAAAAGCAGGG + Intergenic
932921859 2:75925105-75925127 TAGTGAAAAGAGAAAATGCTTGG - Intergenic
933615625 2:84479689-84479711 TACTGAAAAGAGAGAAAGTAGGG + Intergenic
933989801 2:87625960-87625982 GAGTGGACAGATATCAAGCACGG - Intergenic
935024331 2:99261716-99261738 CAGTGCAAAGAGAGGAAGCAGGG + Intronic
935115926 2:100136257-100136279 GAGCGAATGCAGATAAAGCAGGG + Intronic
935400320 2:102653601-102653623 CAGGGAAAAGAGAGAAAGGAAGG - Intronic
935799824 2:106683966-106683988 AACGAAAAAGAGATAAAGCAAGG - Intergenic
935846492 2:107171412-107171434 GAGAGAGAAGAGAGAAAGAAAGG - Intergenic
936304043 2:111324866-111324888 GAGTGGACAGATATCAAGCACGG + Intergenic
936482593 2:112898796-112898818 GAGCGAGAAGAGATAGAGCCAGG + Intergenic
937022333 2:118668980-118669002 GAACAAAAAGAGATAAAGAAAGG + Intergenic
937192096 2:120112113-120112135 GAGTGAGAAAAAATAAAGCAGGG - Intronic
937350140 2:121155464-121155486 GAGGGAAGAGAGAGAAAGAAGGG + Intergenic
937931743 2:127210684-127210706 AAGTGAAAAAAAAAAAAGCAGGG + Intronic
939039559 2:137171839-137171861 GATTGAAAAGAAATGAAGAAAGG - Intronic
939693894 2:145299881-145299903 AAGTGAGAAGAGACAAATCAAGG + Intergenic
939772639 2:146341046-146341068 AGGTGAATAGAGATAAAGAATGG - Intergenic
939790164 2:146562400-146562422 AAGTGAAAAGAGAAAAAAGAAGG + Intergenic
939827299 2:147030121-147030143 GAGTGAAGGAAGAGAAAGCAGGG + Intergenic
939902827 2:147870666-147870688 GAATGAAATGAGATAAATCAGGG - Intronic
939955085 2:148521110-148521132 AAATGAAAAGAGATAATACATGG + Intergenic
940509724 2:154598193-154598215 GAGAGAAAAAAAAGAAAGCAAGG - Intergenic
940527101 2:154830098-154830120 AAGTGAAAATAGATAAGGCCAGG + Intronic
940695938 2:156978651-156978673 GAAAGAAAAGAGAAAAAGAAAGG - Intergenic
941753023 2:169153281-169153303 GAATGTATAGAGATAAACCAGGG + Intronic
942597466 2:177605456-177605478 GATGGAAAAGAGATGAAGAAAGG - Intergenic
942837000 2:180312475-180312497 GAGTGAAAAGAGGTTAACTAAGG + Intergenic
942887161 2:180939674-180939696 GTGAGAAAAGAGATGAGGCATGG - Intergenic
942888090 2:180953204-180953226 AAAAGAAAAGAGAAAAAGCATGG + Intergenic
944145696 2:196504899-196504921 GAGTGCAGAGAGATTAAGCAAGG + Intronic
944928935 2:204496192-204496214 GAGATAAAAGAGATGGAGCAGGG - Intergenic
944994229 2:205275884-205275906 GAGAGAAAAGAAATTTAGCAGGG + Intronic
945204070 2:207313097-207313119 GAATGAGAAGAAATAAAACACGG + Intergenic
946732622 2:222723910-222723932 CAGTGAAAAGAGCCAAGGCATGG + Intergenic
946978148 2:225176012-225176034 GAGTGAAAAGAAATGGAGGATGG + Intergenic
947035981 2:225856245-225856267 GAGTGAAAAGAGGAAAAATATGG - Intergenic
947250967 2:228103366-228103388 TAGAGAAAACAAATAAAGCAAGG - Intronic
947367956 2:229416154-229416176 GAGTGAAAAGACAGGAAACATGG - Intronic
947479418 2:230484674-230484696 CAGTTAAAAGATATAATGCAAGG - Intronic
947531203 2:230909611-230909633 GAGAGAAAAGAGGTAAAGGAGGG - Exonic
948518318 2:238520030-238520052 GTTTGAAAAGACACAAAGCAGGG + Intergenic
948541510 2:238694267-238694289 GAGGGAAAAGAGAAACAGAAGGG + Intergenic
1169620131 20:7496885-7496907 GAGTGGAAAGAGAAATTGCATGG - Intergenic
1169898700 20:10531972-10531994 GAGTTATAGGAGATGAAGCAGGG - Intronic
1170656602 20:18292623-18292645 GCATGAAGAGAAATAAAGCAGGG - Intronic
1171321916 20:24253443-24253465 AAGGGAAGAGAGATAAAGCTGGG + Intergenic
1171948972 20:31404117-31404139 GAATGGAAAGAGATGGAGCAAGG + Intergenic
1172653405 20:36521731-36521753 CAATGGAAAGAGATAAAACAGGG - Intronic
1172657212 20:36544473-36544495 GGATTAAAGGAGATAAAGCATGG + Intronic
1177369341 21:20181104-20181126 GAAAGAAAAGAGATAAAAGAGGG - Intergenic
1177467150 21:21500228-21500250 GAGAAAAAAGAGAAAAATCATGG - Intronic
1178458324 21:32776803-32776825 GCGAGAAATAAGATAAAGCAGGG + Intergenic
1178845656 21:36172141-36172163 GAGTGACCAGAGATACAGCAGGG + Intronic
1179393953 21:41020951-41020973 GAGAGAAAAGAAAGAAAGGAAGG + Intergenic
1180072225 21:45442259-45442281 GATTTAAAGGAGAAAAAGCAAGG - Intronic
1181656751 22:24307448-24307470 GAGAGAAGAGAGCGAAAGCAAGG - Intronic
1182032021 22:27166885-27166907 ACGTGAAAAAATATAAAGCAAGG + Intergenic
1182222178 22:28767394-28767416 GAGAGAGAAGAGAGGAAGCATGG - Intergenic
1182819563 22:33203596-33203618 GAGGGAAATGAGATGAAGCTAGG + Intronic
1182981200 22:34673146-34673168 GAGTAGAAAGAAATAAAGTATGG + Intergenic
1183738140 22:39655149-39655171 GATTGAGAGGAGATAATGCATGG + Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
949114952 3:309402-309424 GGAAGAAAAGAGAGAAAGCAAGG - Intronic
949131686 3:509940-509962 AAGGGAAAACAGAAAAAGCAGGG - Intergenic
949162882 3:901848-901870 GAGGGAGAAGATATAAAGAAAGG + Intergenic
949266800 3:2166339-2166361 AAGTGAAAAGATAACAAGCAAGG + Intronic
950200648 3:11040669-11040691 CAGTGAAATGAGTTAAAACAAGG + Intergenic
950314585 3:11989345-11989367 GAGTTAAAAGAGTTAAAACCAGG - Intergenic
950582117 3:13869348-13869370 GAAGGAAAAGAGAGAAAGGAAGG + Intronic
951103751 3:18719412-18719434 GATAGAAATGAGATAAACCATGG + Intergenic
951120603 3:18922870-18922892 CAGTTTAAAGAGACAAAGCAAGG + Intergenic
951265373 3:20559457-20559479 GAGTGAGATGAAATAAGGCATGG - Intergenic
951277763 3:20710650-20710672 GAATGAAAATAAATAAAACAAGG + Intergenic
951436018 3:22665761-22665783 CAGTGAAAAATGATAATGCAGGG - Intergenic
951758284 3:26117417-26117439 GACTGAAGAGAGAGAAAGCTGGG + Intergenic
952062473 3:29526885-29526907 GCATGAAAAGAGATAAAGGGAGG - Intronic
952145647 3:30529060-30529082 GAGAGATAAGAGAAGAAGCAGGG - Intergenic
952915179 3:38232462-38232484 GAATAAAAAGAGATCAAGCACGG + Intronic
953335089 3:42087731-42087753 GAGTGCAAAGAGAGAAGGAAGGG - Intronic
953569533 3:44060081-44060103 AAGTGAAAAGAGAGGCAGCAAGG - Intergenic
953654042 3:44834031-44834053 AAGAAAAAAGAGAGAAAGCAAGG - Intronic
953813048 3:46130825-46130847 GTGTGAAAAGGGAACAAGCATGG + Intergenic
954987564 3:54809263-54809285 GAGAAGAAAGAGATAAAGGAAGG - Intronic
955443711 3:58984712-58984734 GAGTGAAAAGAAAACCAGCATGG + Intronic
955820013 3:62886892-62886914 GAGAGAAAATATTTAAAGCACGG - Intergenic
955832616 3:63020436-63020458 GAGAGAAGAGAGAGAAAGAAAGG + Intergenic
955879674 3:63530143-63530165 GACTGGAAGGAGATAAAGGAAGG + Intronic
956530232 3:70211064-70211086 GAGTCAAATGAGAGAAAACATGG - Intergenic
956637808 3:71383622-71383644 GAGTGGAGGGAGAAAAAGCAGGG + Intronic
956762447 3:72455914-72455936 GTGTAAAGAAAGATAAAGCAGGG - Intergenic
956823819 3:72978398-72978420 GAGGGAAGAGAGAAAAGGCAGGG - Intronic
957396583 3:79646913-79646935 GAGGGAAAGGGGATAAAGAAAGG + Intronic
957441283 3:80251358-80251380 TAGGGAAAAGAGTTAATGCATGG + Intergenic
957803038 3:85110130-85110152 GAGAGAAAAGAGATTTAGGAAGG + Intronic
958786836 3:98605515-98605537 GAGTGGAAAGAGAAAAAGTTTGG - Intergenic
959775677 3:110159454-110159476 GGGTGAAAAGAGGGAAAGCAAGG + Intergenic
960308720 3:116094308-116094330 GTGTGAAAAGAACTAAAGCTAGG - Intronic
960654135 3:119983527-119983549 GAGAGAAAAAAAAAAAAGCAGGG + Intronic
961958128 3:130825412-130825434 GAGAGAAAGGAGAGAAAGGAAGG + Intergenic
963230364 3:142903570-142903592 GAGGGAAGAGAGATAAATGAGGG - Intergenic
963271601 3:143290942-143290964 CACTGGGAAGAGATAAAGCATGG - Intronic
964146266 3:153467335-153467357 GATAGAACAGAGATAAAGCTGGG - Intergenic
964821310 3:160773371-160773393 GAGTGAAAAGAGAGAAAAAAAGG + Intronic
965125927 3:164628904-164628926 GATTGAAAAGGGATATATCAAGG - Intergenic
965427247 3:168542217-168542239 AAGATAAAAGAGAGAAAGCAGGG - Intergenic
965876688 3:173331691-173331713 CAGTGAAGAGAGAGGAAGCAAGG + Intergenic
967289312 3:187903672-187903694 GAGTGAAAAGAGCACAGGCATGG + Intergenic
967402369 3:189078055-189078077 GAGAGAAAGGAGAGAAAGGAAGG - Intronic
967412072 3:189176848-189176870 CAGGGAAAAGTGATAATGCAGGG + Intronic
968425561 4:520711-520733 GAGTGGAAAGAGACAGAACAGGG + Intronic
968709208 4:2100732-2100754 GAGTAAAAATAGATAAATCAGGG + Intronic
969481395 4:7448820-7448842 GAGGGAAAAGAGAGAAAGGGAGG - Intronic
969835861 4:9840914-9840936 GAGGACAAAGAGAGAAAGCAGGG + Intronic
970044654 4:11838127-11838149 GAGTGAAAAGACCAAATGCAAGG - Intergenic
970825315 4:20265954-20265976 GAGTTCAAAGACATAAAGCTAGG - Intronic
971216333 4:24665545-24665567 GAGGGAAAAGAGAAAGAACAAGG - Intergenic
972144824 4:36010310-36010332 CATTGAAAAGAAATAAAGAAAGG + Intronic
972179377 4:36444490-36444512 GAGTGAAAAGGGAAAAAGAGAGG + Intergenic
972454906 4:39244631-39244653 GAATGGACAGAGAGAAAGCATGG - Intronic
972608839 4:40638406-40638428 GAGAGAAAAGAAAGAAAGGAAGG + Intergenic
972659055 4:41096074-41096096 GAGTGAGAAGACAGAAAGTAGGG - Intronic
972823555 4:42730376-42730398 GAGTCAAAAATGACAAAGCATGG - Intergenic
973846885 4:54921887-54921909 CAGAGAAAACAGCTAAAGCAAGG - Intergenic
974859598 4:67503439-67503461 GAGAGTAGAGAAATAAAGCATGG - Intronic
974919051 4:68214400-68214422 GAGTGAGAAGAGATAGTGGAGGG - Intergenic
975201394 4:71594051-71594073 TAGGGAAAATAGATAAAACAAGG - Intergenic
975283332 4:72588586-72588608 TAATGAAAAGAGATTAAGCATGG - Intergenic
975963991 4:79946935-79946957 CAGTAAGAAAAGATAAAGCATGG - Intronic
976527021 4:86104815-86104837 GAGTAAAAAGTAATAAAACAAGG - Intronic
977167602 4:93720421-93720443 GAATGAAAAGAGAAAATGAAAGG - Intronic
977190314 4:93992118-93992140 AAATGGAAAGACATAAAGCAGGG + Intergenic
977490569 4:97704535-97704557 GAAGGAAAAGAATTAAAGCAAGG + Intronic
978399557 4:108316247-108316269 GAGAGAAATGAGACAAATCATGG - Intergenic
978404654 4:108366307-108366329 GAGTAAAAAGAGACGAGGCAAGG - Intergenic
978730999 4:112026127-112026149 GAGGGGAAAGGGATAAGGCAAGG + Intergenic
979098396 4:116581402-116581424 GAGTAGAAAGAGAAAAAGGAAGG - Intergenic
979150530 4:117308757-117308779 GAGTAAAAAAGGATAAAGAAAGG - Intergenic
979422692 4:120525796-120525818 GAGAGTAAAGAGATAAGGTAGGG + Intergenic
979424857 4:120551715-120551737 GAGAGAAAAGAGAGAAAGGAAGG - Intergenic
979612891 4:122707972-122707994 GAGAGAAAAGAAAGAAAGAAAGG - Intergenic
979803600 4:124942903-124942925 GAGTGACAAGACATAAACCAGGG + Intergenic
979844205 4:125488076-125488098 TAGTGAAAAAAGAGAAAGGAAGG + Intronic
980121186 4:128730198-128730220 AAGTAAAAAGAAATAAAGGAAGG - Intergenic
980151415 4:129053486-129053508 AGGTCAAAAGAGATAAAGAAGGG - Intronic
980520985 4:133934114-133934136 TAGAGAAAAGAGAGAAAGAAAGG + Intergenic
980787941 4:137578944-137578966 GAGAGAAAGGAGAGCAAGCATGG + Intergenic
981201055 4:141979898-141979920 GAAGGAAAAGAGAATAAGCAAGG - Intergenic
981892357 4:149753563-149753585 CAATGAAAAGATATAAAGGAGGG + Intergenic
982369573 4:154620220-154620242 GAGTGAGCTGAGCTAAAGCATGG - Intergenic
982778539 4:159466389-159466411 GAGGGAAAAGAAAGAAAGGAAGG - Intergenic
983352451 4:166609105-166609127 GAGAGTAAGGAGATAAACCATGG + Intergenic
984112012 4:175628444-175628466 CAATAAAAAGAGAAAAAGCAGGG + Intergenic
984160667 4:176248887-176248909 GATTGAAAAGAGATACATGAAGG + Intronic
984381546 4:178998992-178999014 GAAAAAAAAGAGAAAAAGCAGGG - Intergenic
985147145 4:186905293-186905315 GAAAGAAAAGAGAGAAAGGAAGG - Intergenic
985156346 4:186991837-186991859 GAGTAAACAGACATAAAGAATGG - Intergenic
985858569 5:2450621-2450643 TAGTGAAATAAAATAAAGCAGGG + Intergenic
986365233 5:7022475-7022497 GAGAGAAAAGAGACAAAGTCTGG + Intergenic
987801449 5:22701934-22701956 AAATGGAAAGAAATAAAGCAGGG - Intronic
989104084 5:37844501-37844523 AAGTGAAAAGAAAAAAAGAAAGG + Intergenic
989117066 5:37965344-37965366 GAGTGGGAAGAGACAAAGAAGGG + Intergenic
989433287 5:41380585-41380607 GAATGAAAGGAGATAAAGCTTGG - Intronic
989481363 5:41934132-41934154 GAAAGGAAAGAGATAGAGCAAGG + Exonic
989788740 5:45364942-45364964 GTGTGAAAAGAGCCAATGCATGG - Intronic
990063230 5:51678449-51678471 AATAGAAAAGAGGTAAAGCACGG + Intergenic
991034250 5:62112345-62112367 GAGAGAAAAGAATGAAAGCAGGG - Intergenic
991041007 5:62175526-62175548 GAGTGAAAAGAAAAGTAGCATGG - Intergenic
992345012 5:75867736-75867758 GAGTGAGAAGAGACAATGAAGGG - Intergenic
992370678 5:76140806-76140828 GAGGACAAAGAGATCAAGCAGGG - Intronic
992401045 5:76411814-76411836 CACTGACTAGAGATAAAGCAAGG + Intronic
992928232 5:81613899-81613921 GAGAAAAAGTAGATAAAGCAGGG - Intronic
993284271 5:85970369-85970391 CAGTAAAAAAAGATAAAGGAGGG - Intergenic
993335662 5:86655104-86655126 GAGTAAACAGAGAAAAAGAAAGG - Intergenic
993516065 5:88836472-88836494 GTGGAAAAAGAGATAAAGAAAGG - Intronic
993693660 5:91034619-91034641 GAGTGGAGAGAGATAATACAGGG - Intronic
994025994 5:95084438-95084460 GACAGAAAAGAGAAAAAGAAAGG + Intronic
994288413 5:97997463-97997485 GAGAGAAAAAAGAAAAAGCATGG + Intergenic
994623998 5:102195413-102195435 GAGTGAAAAGAAATGAACAAAGG - Intergenic
994891861 5:105646880-105646902 GAGAGAAAAGAAAGAAAGGAAGG + Intergenic
994948334 5:106425323-106425345 GTGTAAAAAGAGACAAAGAAGGG - Intergenic
995893145 5:116979957-116979979 AAGTGAAAAGTGTGAAAGCATGG - Intergenic
997121483 5:131177809-131177831 GAGAGAAAAGAGAAAAGGGAGGG - Intronic
997174447 5:131760087-131760109 GAGGGAAGAGGGAAAAAGCATGG + Intronic
997405189 5:133640122-133640144 GAGTGAAAAGCCTTAAAGAATGG - Intergenic
998328704 5:141304628-141304650 GAGAGAAAAGAAAAGAAGCAGGG - Intergenic
998420483 5:141980608-141980630 GAGGCAGAAGAAATAAAGCAAGG + Intronic
999110084 5:149111821-149111843 GAAAGAAAAGAGAGAAAGAAAGG + Intergenic
999195692 5:149780062-149780084 GAGTGTAAGGAGAGAAAGCTGGG + Intronic
999329110 5:150660757-150660779 GACTGAAAATAAATAAGGCAGGG - Intergenic
999382762 5:151133019-151133041 AAAAGAAAAGAGATAAAGAAAGG + Intronic
999474227 5:151883701-151883723 GAGTATTAAGAGATAAAGCATGG - Intronic
999939841 5:156530539-156530561 AAAAGAAAAGAAATAAAGCATGG - Intronic
1000407761 5:160906833-160906855 GAGAGGAAAGACAGAAAGCATGG + Intergenic
1000717139 5:164658931-164658953 GAGTGAAAAGAATGACAGCAAGG - Intergenic
1000789864 5:165592509-165592531 GAGGGAAAAGAGAGAAAGAAAGG + Intergenic
1001098628 5:168795939-168795961 GAGTAAAAAGAGATGGACCATGG + Intronic
1001555198 5:172632373-172632395 GAATGAAATGAGATGAAGCTTGG - Intergenic
1001580606 5:172795607-172795629 GAGTGAAAAGAGCTCAACTATGG - Intergenic
1001671352 5:173476935-173476957 GAGGGAAAAGAAAGAAAGAAAGG - Intergenic
1002842869 6:921353-921375 GAGAGAAAAGAGACAAAGTCTGG - Intergenic
1004342761 6:14822025-14822047 GAGAGAAAAGAGAACTAGCAAGG - Intergenic
1004573344 6:16869287-16869309 GAGGGAAATGAGATAAGGGAGGG + Intergenic
1004783350 6:18937392-18937414 GAGAGAGATGAGATAAAGAAAGG - Intergenic
1004786896 6:18978201-18978223 GTGTAAAAATAAATAAAGCATGG + Intergenic
1004822931 6:19387769-19387791 CTGTGTAAAGAGATAAACCAAGG + Intergenic
1005041496 6:21604416-21604438 GAATGGGAAGAGAGAAAGCAGGG - Intergenic
1005134501 6:22552258-22552280 GAGTTAAAAGAGATAATGCAGGG - Intergenic
1005261625 6:24067384-24067406 AAGAGAAAAGAGATAAATCAAGG + Intergenic
1005420941 6:25650355-25650377 TAGTGGAAAAAGATAAAACAAGG - Intergenic
1005704741 6:28440232-28440254 AAGTAACAGGAGATAAAGCAGGG + Intronic
1007067253 6:39003335-39003357 AAGTTAACAGAGATAAATCAGGG - Intronic
1007684519 6:43657392-43657414 GATTAAAATGAGATAAGGCATGG - Intronic
1007982804 6:46176333-46176355 AAGTGAAAACAGAAAAAGGAAGG + Intergenic
1008391865 6:50961390-50961412 GAGTGAAAAGTAAGAAAGGAAGG - Intergenic
1008447947 6:51615159-51615181 GACTGATAAGAGATAATGTATGG + Intergenic
1008645743 6:53512534-53512556 CACTGAAGAGATATAAAGCAGGG + Intronic
1009350971 6:62678306-62678328 GACTGGAAGGAGATAAAGCTGGG + Intergenic
1009837376 6:69019816-69019838 GAGTAAAAAGAGACAAAAGATGG + Intronic
1010174265 6:73008499-73008521 AAGTTATAAGAGATAAAGAAGGG + Intronic
1010600102 6:77814314-77814336 GAGTCCAGAGAGATAAAACAGGG + Intronic
1012491094 6:99783175-99783197 GAGGAAAAAGAGATAGTGCAGGG + Intergenic
1012676376 6:102118233-102118255 GAGAGAAAAGAGAAAAAGAAAGG + Intergenic
1013172032 6:107645450-107645472 GAGAGAAAAGAAAAAAAGTAGGG + Intronic
1013209379 6:107973145-107973167 GAGAGAAAAGAGAAAAAGGGGGG + Intergenic
1013757919 6:113482625-113482647 GAGAGAAAATAGACAAAACATGG + Intergenic
1013983658 6:116164340-116164362 GAGTAAAAAAAGACAAAGAAGGG - Intronic
1014002339 6:116378552-116378574 GGGAGAAAACAGATTAAGCAGGG - Intronic
1014296951 6:119630123-119630145 GAGTGGAGAGAGATAAAGAAAGG + Intergenic
1014717434 6:124882730-124882752 GAGAGAAAAAAGAAAAAGGAAGG + Intergenic
1014958384 6:127650976-127650998 AAGTGAAAAGAAATAATACAGGG - Intergenic
1015544784 6:134350657-134350679 GAGTGAAATGAGAAAAAGGGAGG + Intergenic
1015859265 6:137658464-137658486 CAGTGAATAGAGATTTAGCATGG + Intergenic
1016419203 6:143866881-143866903 GAGTGAAATGAAATCAAGGATGG - Intronic
1016668472 6:146672356-146672378 GAGGGAAAAGAAATAAAGGATGG + Exonic
1016894030 6:149035333-149035355 GAGCAAATAGAGATAAAGCGGGG - Intronic
1017193834 6:151680184-151680206 AAGAGAAAAGAAAAAAAGCAAGG - Intronic
1017394746 6:153984648-153984670 GAGAGAAAAGAAAGAAAGGAAGG + Intergenic
1017445380 6:154502830-154502852 GAGAGGAAAGAGAGAAAGCAAGG + Intronic
1020042038 7:5011599-5011621 GAGTAAAAAAAGAAAAAGGAAGG + Intronic
1020527832 7:9286391-9286413 AAGTGACAAGAGATTAAGCATGG + Intergenic
1020533693 7:9366647-9366669 AAGTAAAAAGAGATAAAGAAGGG + Intergenic
1020538861 7:9436006-9436028 GGGTGAAAAGAGATAAAGATGGG - Intergenic
1020719217 7:11720446-11720468 CAGTAGAAAGAGATTAAGCATGG - Intronic
1020872409 7:13648439-13648461 AAGAAAAAAGAGAGAAAGCAGGG - Intergenic
1021036617 7:15807887-15807909 GAGAGAAAAAAGAAAAAGAATGG - Intergenic
1021796440 7:24259285-24259307 GAATGCCAAGAGATGAAGCAGGG - Intergenic
1022797833 7:33746286-33746308 GGGTGTAAAGAGATAAAATATGG - Intergenic
1023159317 7:37282273-37282295 GAGTGAGAAGAGACAGAGCCAGG - Intronic
1023719441 7:43077832-43077854 GGGTGAAAAGGGAAAAAACAGGG + Intergenic
1023791577 7:43757839-43757861 GAGTGCAAAGAGAGAAGGCTTGG - Intergenic
1024727904 7:52220428-52220450 GACTGAGAAGGGATAGAGCAGGG + Intergenic
1024745156 7:52398001-52398023 CAGTTAAAAGAGACAAAGAAGGG - Intergenic
1026582723 7:71631659-71631681 GAGTGAGAGGAGATAAGGGAAGG + Intronic
1026682996 7:72483782-72483804 GAGAGAAAAGAGAGAAAACAAGG - Intergenic
1027607170 7:80314827-80314849 GAGTCAAAAGAGATGAAAGAAGG - Intergenic
1027701913 7:81479894-81479916 GAGTGAAAAGAAATGAACAAAGG + Intergenic
1027853484 7:83479216-83479238 GAGTGAGAACAGAGAAAGCAGGG - Intronic
1028015412 7:85704912-85704934 GAGTCAAAAAAGAAACAGCATGG + Intergenic
1028121566 7:87060864-87060886 GAGTTAAAAAAAAAAAAGCAAGG - Intergenic
1028204693 7:88003054-88003076 GAATAAAAAGAGTTGAAGCAGGG + Intronic
1028344059 7:89758665-89758687 GGGTGATAAGATATTAAGCATGG + Intergenic
1029542029 7:101189275-101189297 CAGTGAAAAGACAGAAAGAAAGG + Intergenic
1029860328 7:103564571-103564593 GAGAGATAAGGGATAAATCAGGG - Intronic
1030151134 7:106406390-106406412 AAGTGAAACGAAATAAAACAAGG + Intergenic
1030480620 7:110099222-110099244 GAGGAAAGAGAGATAAAGAAGGG + Intergenic
1030623520 7:111818167-111818189 GACTGAAAAGAGAAAAAGACAGG - Intronic
1031460283 7:122040203-122040225 GAGTGAAACAAGAAAAAGAAAGG + Intronic
1031547607 7:123068976-123068998 GACTGAAGAGAGAGAAAGCTGGG - Intergenic
1031789861 7:126088543-126088565 GAGTGAAAAAAGAGAGAGAACGG + Intergenic
1032380161 7:131470933-131470955 GAGACAAAAGAGGTAAAGAAAGG + Exonic
1032521382 7:132548093-132548115 GAGTGAAAAGAGACAAAGCCTGG + Intronic
1032540434 7:132698529-132698551 GAGAGAAAGGAGAGAAAGAAAGG + Intronic
1032751562 7:134846606-134846628 GAGAGAAGAAACATAAAGCAAGG - Intronic
1033532719 7:142281581-142281603 GAGGGAAAAAATATAAAGAATGG - Intergenic
1034009413 7:147512096-147512118 GGGTGAAAACATATACAGCATGG + Intronic
1034327164 7:150247168-150247190 GAGTGGAAGGAGATTAACCAGGG - Intronic
1034717564 7:153257348-153257370 GAGTGGAAAGAAAGCAAGCAAGG - Intergenic
1034766049 7:153722289-153722311 GAGTGGAAGGAGATTAACCAGGG + Intergenic
1034935282 7:155195229-155195251 AATTGAAAACAGAAAAAGCAGGG + Intergenic
1035267750 7:157701078-157701100 GAGTGAAAGGAAATAAAATATGG - Intronic
1035689532 8:1550715-1550737 GAGTGAAATCACATAAAACAGGG - Intronic
1035848675 8:2891967-2891989 GAATGAGAATAGATAAAGAAGGG + Intergenic
1036345775 8:7961559-7961581 AAGTGAACAGAGAGGAAGCAGGG + Intergenic
1036862910 8:12368565-12368587 AAGTGAACAGAGAGGAAGCAGGG + Intergenic
1037215248 8:16443149-16443171 TACTGGAAAGAGAGAAAGCATGG + Intronic
1037597981 8:20370400-20370422 CAGTGAATAGAGATACAGAAAGG - Intergenic
1038815250 8:30896333-30896355 GAGTGAAAATAGATGAAAAATGG - Intergenic
1039347184 8:36719057-36719079 GAAAGAAAAGAGAAAAAGGAAGG - Intergenic
1039744014 8:40407506-40407528 GAGAGACAAGAGAGAAAGCAAGG - Intergenic
1039978406 8:42386348-42386370 CATTGAAAAAAGATAAAGGAGGG - Intergenic
1039988597 8:42468601-42468623 CAGAGGAAAGAGATGAAGCATGG + Intronic
1040436197 8:47393917-47393939 GAGTGAGAAGAAAGGAAGCAGGG - Intronic
1040924251 8:52660204-52660226 GTGTGAAAAGAAATATAGAAGGG + Intronic
1040946294 8:52888211-52888233 GAGAGAAGGGAGATAAATCAGGG - Intergenic
1041023679 8:53662237-53662259 GAGAGACAAAAGTTAAAGCAAGG + Intergenic
1041135295 8:54751607-54751629 CAGTGCAAAGACATAAACCAAGG + Intergenic
1042209646 8:66367010-66367032 AAGTGCAAAGGGATAAGGCAGGG - Intergenic
1042841298 8:73126568-73126590 GCCTTAAAGGAGATAAAGCAGGG + Intergenic
1043271355 8:78338110-78338132 GAGAGAAATATGATAAAGCAGGG + Intergenic
1043272060 8:78347044-78347066 AATTAAAAATAGATAAAGCATGG + Intergenic
1043658591 8:82705397-82705419 GAAAGAAAAGAGAGAAAGAAAGG + Intergenic
1043722282 8:83559762-83559784 GAGAGAAAAGAAAAAAAGGAAGG - Intergenic
1043755076 8:83993473-83993495 GGGTGGAAAGAGCTAAAGAAAGG - Intergenic
1043854059 8:85245083-85245105 GAGTGAGAAGAGGTAAGGAAAGG + Intronic
1044048273 8:87465247-87465269 GAGAGAAAAAAAAGAAAGCAGGG - Intronic
1044539046 8:93389844-93389866 GTGTTAAAAGAGGTAAATCAGGG - Intergenic
1044728061 8:95208853-95208875 GAGGGAGAAGAGAGAAAGAAGGG - Intergenic
1044794086 8:95878613-95878635 GAGAGAAAGGAGAGAAAGAAAGG + Intergenic
1044794087 8:95878635-95878657 GAGAGACAAGAGAGAAAGAAAGG + Intergenic
1044856182 8:96478229-96478251 GAGTGAAAAAAAAAAAAGAATGG + Intergenic
1045181095 8:99783476-99783498 GAGTGATAAAAGAGTAAGCAAGG + Intronic
1045735439 8:105290815-105290837 AATTGTAAATAGATAAAGCATGG + Intronic
1047115796 8:121840855-121840877 TGGTGAGAAGAGATAAAGAAAGG - Intergenic
1048074254 8:131052039-131052061 GAGAGGAAAGAAATAAAGAAAGG + Intergenic
1048236866 8:132699519-132699541 GAGTGAAAAGAGGGAAGGCCAGG + Intronic
1049136985 8:140911342-140911364 GATTGAAAAGATTTAAAACATGG - Intronic
1049304379 8:141892921-141892943 GAGTGAAAACAAGTAAGGCATGG + Intergenic
1051806673 9:21001478-21001500 GAAGGAAAAGAGAGAAAGAAAGG + Exonic
1052473545 9:28930071-28930093 GTGTGAAAAGGGGTAGAGCAGGG - Intergenic
1052534077 9:29726134-29726156 GGGTGAAAGGAGAGAAAGCTGGG + Intergenic
1052578624 9:30323855-30323877 GAGACAAAAGAGACGAAGCATGG + Intergenic
1052735233 9:32334989-32335011 GAGAGAAAAGATAAAGAGCATGG - Intergenic
1053022578 9:34705579-34705601 GCGTGTAAAGGCATAAAGCAAGG - Intergenic
1053393046 9:37750062-37750084 GAGTGATAGGAGATGAAGCTGGG + Intronic
1053485508 9:38451749-38451771 GAGGGATAAGAGATAAACAAAGG - Intergenic
1054287070 9:63187515-63187537 AAGTGAAAAAAGACAAAGAAGGG + Intergenic
1054289717 9:63272919-63272941 AAGTGAAAAAAGACAAAGAAGGG - Intergenic
1054387748 9:64577459-64577481 AAGTGAAAAAAGACAAAGAAGGG - Intergenic
1054507973 9:65938909-65938931 AAGTGAAAAAAGACAAAGAAGGG + Intergenic
1055108151 9:72533775-72533797 GAGAGAAAAGAGAGAGAGGAAGG - Intronic
1055227873 9:74022607-74022629 AAGAGAAAAGAAATAAAACAAGG + Intergenic
1055372631 9:75616817-75616839 GAGTGGAAAGAGAATAAGAAGGG + Intergenic
1056675253 9:88671259-88671281 GAGTTAAATGAGACAAGGCAGGG - Intergenic
1057163616 9:92908825-92908847 GAAAGTAAAGAGATAAAGAATGG + Intergenic
1057527743 9:95817513-95817535 GAGAGAAACAAGATAAGGCACGG - Intergenic
1057694746 9:97315124-97315146 TATTGAAAAGAGAGATAGCAAGG - Intronic
1058010726 9:99973854-99973876 GAGTTTCAAGAGATAAAGCTGGG - Intergenic
1058305928 9:103440347-103440369 GTGTGAAAAAAGTTAACGCATGG - Intergenic
1058414650 9:104775008-104775030 CAGTGAAAGGAGAGAAGGCAGGG - Intronic
1059050083 9:110914737-110914759 AAGTGAAAAGAGATAAAAAGAGG - Intronic
1059720969 9:116959797-116959819 GGGAGAAGAGAGAAAAAGCAAGG + Intronic
1059785903 9:117583882-117583904 GAGTGATTAGAGAAATAGCAGGG - Intergenic
1059835902 9:118152001-118152023 GATTGAATTTAGATAAAGCAGGG + Intergenic
1060000905 9:119957904-119957926 GAGTTAAATGAAATAACGCACGG + Intergenic
1060132455 9:121117320-121117342 GACTGAAAAGAAATAAAATATGG - Intronic
1061532067 9:131222202-131222224 CAGTGAAATGAGAAAAATCATGG - Intronic
1062679806 9:137772854-137772876 GGGAAAAAAGAGATAAAACAAGG - Intronic
1062712113 9:137981359-137981381 GAGAGGAGAGAGATAAACCAAGG - Intronic
1186054086 X:5630237-5630259 GAGAGAAAAAAGACAAAGTAAGG + Intergenic
1186099931 X:6145164-6145186 GAGTAAGAAGAGATAAAACTGGG - Intronic
1186145616 X:6621540-6621562 GATTTAAAAGAGAGAAAGGAAGG + Intergenic
1186351714 X:8746690-8746712 GAGTGAAAAACTATAAAGAAAGG - Intergenic
1186375220 X:8991378-8991400 GAGAAAAGAGAGAGAAAGCACGG - Intergenic
1186433354 X:9523150-9523172 GAGGGAGAAAAGCTAAAGCAGGG - Intronic
1186556386 X:10564113-10564135 GTGAGAACACAGATAAAGCATGG - Intronic
1186843127 X:13505261-13505283 GAATGACAAGGGAGAAAGCAGGG - Intergenic
1186988422 X:15041081-15041103 GAGAAAAAAGAGAAAAAGGATGG - Intergenic
1187304055 X:18079067-18079089 GAGTGAAAGGGGACCAAGCAGGG - Intergenic
1187542455 X:20210776-20210798 GAATTAAAGGAGATAATGCATGG - Intronic
1187619853 X:21040082-21040104 GAGTGGCTAGAGATAAAGCTGGG - Intergenic
1187734635 X:22291219-22291241 GAGGGAAAAGAGAGCAAGCATGG - Intergenic
1187818898 X:23264202-23264224 GAGGGAAAAAAGAGAAAGCCTGG + Intergenic
1188144937 X:26599986-26600008 TTGGGAAAAGAGACAAAGCAAGG - Intergenic
1188650099 X:32621773-32621795 TAATGAAGAGAGAAAAAGCAGGG - Intronic
1188862797 X:35276584-35276606 GAGTGAAAAGGGAAAAAAAAAGG + Intergenic
1189189043 X:39080908-39080930 CATTGAAAACAGAAAAAGCAGGG - Intergenic
1189233202 X:39468269-39468291 GAGTGAGAGGAGAAAAAGAAAGG - Intergenic
1189578193 X:42377635-42377657 GAGTACAATGAGATAAATCAAGG - Intergenic
1190023615 X:46902396-46902418 GAGAGAAAGGAGAAAAAGGAAGG + Intergenic
1190112127 X:47597585-47597607 GAGAGAAAAGAGAGAAAAAAAGG + Intronic
1190515093 X:51215634-51215656 GAGTGAAAGGAGATCATACAGGG - Intergenic
1190934138 X:54979511-54979533 GATTTAAAACAAATAAAGCATGG + Intronic
1191185307 X:57605463-57605485 AGGTCAAAAGAGATAAAGAAGGG - Intergenic
1191744852 X:64475772-64475794 GAGAGAAAAAAAAAAAAGCAGGG - Intergenic
1191970492 X:66809868-66809890 GAGTTTAAGGAGATGAAGCAAGG - Intergenic
1191979652 X:66911957-66911979 AGGTGAAAATAGATAAAGTATGG - Intergenic
1192329230 X:70161053-70161075 CAGTGAATAGAGCAAAAGCAGGG - Intronic
1193342252 X:80362597-80362619 GACAGAAAGGAGATATAGCAAGG - Intronic
1194593099 X:95824920-95824942 GAGTGAAAAGAAGGAAAGAAAGG + Intergenic
1194820677 X:98502870-98502892 GAGTGAAAAGGGAAAAGTCAAGG - Intergenic
1194898915 X:99482531-99482553 TTGTGAAAAGAAATAAACCATGG - Intergenic
1195620192 X:106945244-106945266 GAGTAATGAGAGATAAAGCTGGG - Intronic
1195735744 X:108010789-108010811 GAGAGAGTAGAGACAAAGCAGGG - Intergenic
1196421094 X:115522103-115522125 GAGAGGAAAGAGATAAAGCCAGG - Intergenic
1197966893 X:132073736-132073758 CACTGAGAAGAGATATAGCAGGG - Intergenic
1197973690 X:132141918-132141940 GAGTGAAAAGAAATAATGCTTGG - Intergenic
1198670221 X:139072033-139072055 GAGAGAAAAGAGAAAAATAAAGG - Intronic
1199094328 X:143722419-143722441 GACTGAAAATAGAGAAGGCATGG + Intergenic
1199098531 X:143770013-143770035 GAATGAAAAAAGAAAAAGAAGGG + Intergenic
1199288074 X:146075983-146076005 CCGTGAAAAGAAATCAAGCATGG - Intergenic
1199776545 X:151016668-151016690 GAGAGAAAAGAAAGAAAGGAAGG - Intergenic
1199921294 X:152406363-152406385 GAATGAAAAGAAAAAAAGGATGG + Intronic
1200984271 Y:9289455-9289477 AAGAGAAAAGAGAAAAAACATGG + Intergenic
1201340255 Y:12925773-12925795 GAGAGAAAAGAGACAAAGTCGGG + Intergenic
1201781755 Y:17730729-17730751 CAGTGAAAAGATTTAAAGTATGG - Intergenic
1201819798 Y:18175261-18175283 CAGTGAAAAGATTTAAAGTATGG + Intergenic