ID: 1112681981

View in Genome Browser
Species Human (GRCh38)
Location 13:101777387-101777409
Sequence TTACCAAGACTGCTCAACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 110}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112681981_1112681982 21 Left 1112681981 13:101777387-101777409 CCTTTGTTGAGCAGTCTTGGTAA 0: 1
1: 0
2: 1
3: 7
4: 110
Right 1112681982 13:101777431-101777453 GAAGCTGATGTGAGAGTTCCAGG 0: 1
1: 0
2: 1
3: 19
4: 197
1112681981_1112681983 22 Left 1112681981 13:101777387-101777409 CCTTTGTTGAGCAGTCTTGGTAA 0: 1
1: 0
2: 1
3: 7
4: 110
Right 1112681983 13:101777432-101777454 AAGCTGATGTGAGAGTTCCAGGG 0: 1
1: 0
2: 0
3: 18
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112681981 Original CRISPR TTACCAAGACTGCTCAACAA AGG (reversed) Intronic
901290619 1:8121426-8121448 TTGCCAAGGCTACTGAACAAAGG - Intergenic
901443843 1:9294981-9295003 TTACCCAGACTGCACAGCCAGGG + Intronic
908196101 1:61747114-61747136 TTACCAAGTTGGCTCACCAAGGG - Intronic
908337935 1:63146537-63146559 TCACCAACACTGATCACCAAGGG + Intergenic
916697554 1:167254783-167254805 TTAGCTAGAATGCTCAAAAATGG + Intronic
918123725 1:181563413-181563435 TTTCCCAGACTGCCCAAAAAAGG + Intronic
919786076 1:201259578-201259600 TTACCAGGACAGCTCAGCAGGGG + Intergenic
921565476 1:216712306-216712328 GTGCCAAGACTGCACAATAATGG + Intronic
923546755 1:234928933-234928955 TTACAGAGACTGCTGAAGAAGGG + Intergenic
1064098527 10:12442777-12442799 TTTCCTAAAATGCTCAACAATGG - Intronic
1069782369 10:70964960-70964982 CAACCAAGACTGCCCAGCAAAGG - Intergenic
1070970966 10:80566776-80566798 TTACCAATCCTGCTAAGCAAGGG - Intronic
1071356556 10:84802181-84802203 TGGCCAAGACAGATCAACAAAGG - Intergenic
1072051384 10:91707100-91707122 TTAAATAGACTGCTCAAGAAAGG - Intergenic
1077385331 11:2267005-2267027 GCACAGAGACTGCTCAACAAAGG + Intergenic
1082096786 11:48137544-48137566 TTACCTAGAGTGCTCAGGAAAGG + Intronic
1085023548 11:73223616-73223638 TCACCAAGACTGCACAGCACAGG + Intronic
1085889047 11:80556137-80556159 TTACCAAGCCTGCTAAACCTAGG - Intergenic
1087632569 11:100667939-100667961 TTAGAAAGACTGATGAACAAAGG + Intergenic
1087836819 11:102883366-102883388 TTGCCAAATCTGCTCAACTAGGG + Intergenic
1087905577 11:103693045-103693067 TTACCAAGAGTTCTCAACCTTGG + Intergenic
1090433801 11:126669043-126669065 TTACCAAGAATTGTCAAAAAGGG - Intronic
1093539012 12:20258312-20258334 TATCCAAGACTGCTTAAGAAAGG - Intergenic
1096208402 12:49742326-49742348 TTTCTAAGTCTGCTCAGCAAGGG + Intronic
1097906724 12:64927569-64927591 TTAGCAAGACTAGTCAAGAAAGG - Intergenic
1104233822 12:126911983-126912005 TTGCCCAGACTGGGCAACAATGG - Intergenic
1108499989 13:51061031-51061053 TGGCCAAGACTGCACAGCAAGGG - Intergenic
1108704059 13:52969069-52969091 TTGCCAAGCCCCCTCAACAATGG - Intergenic
1108899058 13:55375494-55375516 ATACCAACACTGCCCAAGAAAGG - Intergenic
1112681981 13:101777387-101777409 TTACCAAGACTGCTCAACAAAGG - Intronic
1116996533 14:51330571-51330593 TTCCCATGACTGCTCAAGACAGG - Intergenic
1120420471 14:84279296-84279318 TTACCAATACTGCTATACAGAGG - Intergenic
1124430991 15:29608450-29608472 TTCCCAAGACTGATCAGGAAGGG - Intergenic
1128405877 15:67338019-67338041 TCACAAAGATTGCTGAACAATGG - Intronic
1133852015 16:9514134-9514156 TGACCAAAACTGCTCAACTCCGG + Intergenic
1140340397 16:74153489-74153511 TTAAAAAGACTGCTCAATATAGG + Intergenic
1141362926 16:83413462-83413484 TTATGAAGAATGCTCAGCAAAGG - Intronic
1150551867 17:66218123-66218145 CTACCATGACTGCCCAACAGTGG + Intronic
1153782499 18:8506645-8506667 TTACCCATAGTGCTCAAGAAAGG + Intergenic
1156338939 18:36193467-36193489 ATACCAAGACTATTCAACGAGGG + Intronic
1156684130 18:39623615-39623637 TTACTATGACTGATCAATAAAGG + Intergenic
1156767066 18:40670147-40670169 TTAGCAATACTGCTCAATGATGG - Intergenic
1158132990 18:54173728-54173750 TTACTAATACTGCTCCACCATGG - Intronic
1166723759 19:45012695-45012717 TTACCCAGACTGCTATGCAATGG - Intronic
1168036547 19:53724048-53724070 TTACCGTGGCTGCTCCACAAAGG - Intergenic
1168563336 19:57402160-57402182 GTGCCAAGACTACTCAACAGAGG - Intronic
926243481 2:11105194-11105216 TTCCCAAGGCTGCTCATCAATGG - Intergenic
927550511 2:23994956-23994978 TTACCAAGACTCCTCCACATTGG + Intronic
930797245 2:55406354-55406376 TTACCAAGACTGGTTTAAAAGGG - Intronic
937022749 2:118673183-118673205 TTACCAAGACTGCAACCCAAGGG + Intergenic
937588714 2:123588317-123588339 TCACAAAGACTGCACAACAGTGG + Intergenic
938583368 2:132668190-132668212 TTACCAAGGCTTCTCCCCAAGGG - Intronic
938710131 2:133969048-133969070 ATACTAAAACTGCCCAACAATGG + Intergenic
938814271 2:134883695-134883717 TTGCCCAGACTGGTCAACATAGG + Intronic
940148114 2:150569096-150569118 TTAAAAAGATTGGTCAACAAAGG - Intergenic
942643454 2:178085633-178085655 TTAACAAGACTGTACAAGAAGGG + Intronic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1170105551 20:12751134-12751156 TTGCCAAGCCTGGGCAACAAGGG - Intergenic
1170359763 20:15533282-15533304 TTAAAAAGATTGCTCTACAATGG - Intronic
1171833187 20:30095792-30095814 TTTTCAAAACTGCTCATCAAAGG - Intergenic
1176839873 21:13830310-13830332 TTATCAGGACTGCTCAACTGAGG + Intergenic
1177747912 21:25243354-25243376 TTACCAAGACTGGAAAAAAAGGG + Intergenic
949517131 3:4818033-4818055 TTACCAAGGCTGCTCAGCTGGGG + Intronic
950037499 3:9897650-9897672 AAGCCAACACTGCTCAACAAGGG - Intergenic
955091217 3:55752503-55752525 TTGCCAAGACTGCTGAACAAGGG + Intronic
959996826 3:112689480-112689502 TTACCAGGAATGTTCATCAAGGG + Intergenic
960003111 3:112753212-112753234 CTAGCAGGACTGCTAAACAAGGG - Intronic
962062539 3:131945508-131945530 GAACAAAGACTGCTCATCAAAGG - Intronic
963996820 3:151719119-151719141 TTACCAAATTTGCACAACAAAGG - Intergenic
969919159 4:10521382-10521404 TTATCAAGACTGTTCATCAGTGG + Intronic
971124227 4:23735089-23735111 TTACCAATACTGGTCATCAAGGG - Intergenic
972440641 4:39087291-39087313 TTACCAAAACTGCTAATAAAAGG + Intronic
974313448 4:60244396-60244418 TTAATAAAACTACTCAACAAGGG - Intergenic
979059115 4:116032763-116032785 TTACCAATATTACTGAACAAAGG + Intergenic
985938884 5:3118392-3118414 TTCCCAACACTGCCAAACAACGG + Intergenic
989265474 5:39468616-39468638 TTAGCAAGATTGCTGAAAAAAGG + Intergenic
992416201 5:76554087-76554109 GTGCCAAGACAGTTCAACAAAGG + Intronic
993522676 5:88922921-88922943 TTAGAAAGACTGCTTAACATGGG - Intergenic
994429269 5:99635519-99635541 TTACCAAAACTGGGCAATAAAGG - Intergenic
995519204 5:112985080-112985102 TTACCAAAAATGCTTAACATTGG + Intronic
996089050 5:119332608-119332630 TTACCAAGAAAGGTCAACCAAGG + Intronic
997256552 5:132433080-132433102 TTACCAACAGTACTCACCAATGG - Intronic
997371509 5:133364176-133364198 TTTCCAACACTGCTCAGCAAGGG + Intronic
998387131 5:141763880-141763902 TTACCAAGACAGGTCACAAAGGG + Intergenic
999354336 5:150910443-150910465 TTAACAAAACTGCAGAACAATGG + Intergenic
1000580383 5:163028470-163028492 TTACCAACATCGCTCAACAGTGG + Intergenic
1001416125 5:171545737-171545759 TCCCCAAGGCCGCTCAACAAGGG - Intergenic
1003572377 6:7264211-7264233 ATACCAAGACAGGCCAACAAGGG - Intergenic
1006828259 6:36952565-36952587 GTACCAAGACCGTTCAACGAGGG - Intronic
1007863744 6:44944243-44944265 TTACCATGACTACTGAAAAAAGG + Intronic
1010090702 6:71977604-71977626 TTAGAAAGACTGCTCAAGGAAGG + Intronic
1011970594 6:93218088-93218110 TTACCAAAAATGCTCAATAATGG + Intergenic
1012855437 6:104495820-104495842 TTACCAAGCCTGCTCCATAGAGG + Intergenic
1016404260 6:143713865-143713887 TTACCAAGACTACCCAAGATGGG + Intronic
1020433453 7:8136765-8136787 TTACATAGAGTGCTCAAAAAAGG + Intronic
1020499510 7:8898679-8898701 TAACCTAGAATGCTCAATAATGG - Intergenic
1020817959 7:12929157-12929179 TTACAAAGACTTCACAACTATGG + Intergenic
1025085096 7:56017171-56017193 TTACCCAGAATACTGAACAATGG + Intronic
1027555924 7:79664792-79664814 TTCCCAAAGCAGCTCAACAATGG - Intergenic
1028682544 7:93553296-93553318 TTTCCAGAGCTGCTCAACAAGGG + Intronic
1032762168 7:134953589-134953611 TTACCAAGACTGTTCAAGGAAGG - Intronic
1034609566 7:152353531-152353553 TTACCCAGACTGGTGAACAGTGG + Intronic
1035222448 7:157414201-157414223 TTACCAAGACCCCAGAACAAAGG - Intronic
1036146625 8:6260263-6260285 TTACCAAGACTGTTGTACGATGG + Intergenic
1039019310 8:33187494-33187516 TGACCATGACTGCTCACCAAAGG - Intergenic
1039443976 8:37615388-37615410 CTACCAAGCCTGCATAACAAAGG + Intergenic
1039447003 8:37641095-37641117 TTACCAAGTGTGCTCATGAATGG + Intergenic
1045738557 8:105324633-105324655 TAACCAGGACAGATCAACAATGG + Intronic
1048343899 8:133561937-133561959 TCACCAAGAGTGATCCACAATGG + Intronic
1053093454 9:35301994-35302016 TGACCAAGACTTCTAAAAAATGG - Intronic
1058370232 9:104258108-104258130 TTCACCAGACTGCTCAAAAAGGG - Intergenic
1187489034 X:19732786-19732808 TTAGCAAGAGTGTTCCACAAGGG + Intronic
1193022136 X:76802105-76802127 TTACCAAGGCTGGTCCCCAATGG + Intergenic
1193558846 X:82992198-82992220 TTAGCAAGGTTGCTGAACAAAGG - Intergenic
1193683230 X:84547371-84547393 TTAAAAAGTCTGCTCAGCAAAGG - Intergenic
1194181569 X:90716544-90716566 TCACCAGGACTGTTCCACAAAGG - Intergenic
1197263321 X:124338880-124338902 TCACCAAGACTGCAAAATAAGGG + Intronic
1197981299 X:132219687-132219709 TTGCCACGATTGCTCAACACTGG - Intergenic
1199501147 X:148507616-148507638 TTATCATGACTGTTAAACAAAGG + Intronic