ID: 1112683874

View in Genome Browser
Species Human (GRCh38)
Location 13:101800023-101800045
Sequence GTGTCTGTGGAGAAGTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 462
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 420}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112683874_1112683878 4 Left 1112683874 13:101800023-101800045 CCTACCTACTTCTCCACAGACAC 0: 1
1: 0
2: 1
3: 40
4: 420
Right 1112683878 13:101800050-101800072 CCATAGAGACATAAAAAAAATGG 0: 1
1: 0
2: 3
3: 57
4: 742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112683874 Original CRISPR GTGTCTGTGGAGAAGTAGGT AGG (reversed) Intronic
900841105 1:5049304-5049326 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
901535162 1:9877960-9877982 GTGGCTGGGCAGAAGTAGGAAGG + Exonic
901680710 1:10911113-10911135 GTGTGTGTGATGAAGAAGGTTGG - Intergenic
902201477 1:14836662-14836684 GTGGCTGGGGAGCAGGAGGTGGG - Intronic
902615609 1:17621967-17621989 GTCTCTGGGGAGAAGCAGGGAGG + Intronic
902970055 1:20041789-20041811 GTTTCAGTGGGGGAGTAGGTGGG + Intronic
904269310 1:29338991-29339013 GTGTCTGTGTAGAAAGAAGTAGG - Intergenic
904392073 1:30192546-30192568 GTGGCTGTGGAGAAGCAGAAAGG - Intergenic
905816224 1:40953040-40953062 GTTTCTCTGGAGGAGAAGGTGGG - Intergenic
907706133 1:56834314-56834336 GTGTCTGTGAACAAGGATGTGGG + Intergenic
908524212 1:64972158-64972180 GTGCATGTGGAAGAGTAGGTAGG - Intergenic
908714619 1:67055989-67056011 GTGCCTCTGGAGATGTGGGTAGG - Intergenic
909077827 1:71074059-71074081 CTGTTTGTGGAGAAGTAATTAGG - Intronic
910002459 1:82356347-82356369 GTTTCAGTGGGGAAGTAGGTGGG + Intergenic
910049698 1:82959783-82959805 GTTTCAGTGGGGAAGTAGGTGGG - Intergenic
911984182 1:104600611-104600633 GTTTCAGTGGGGAAGTAGGTGGG - Intergenic
912939211 1:114030308-114030330 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
912941096 1:114045575-114045597 GTTTTTGAGGAGAAGGAGGTAGG + Intergenic
914040711 1:144047254-144047276 GTTTCTGGGGAGGAGTAGTTTGG + Intergenic
914137378 1:144913225-144913247 GTTTCTGGGGAGGAGTAGTTTGG - Intronic
914198516 1:145463978-145464000 GTTTCTGGGGAGAAGTTGTTGGG - Intergenic
914477624 1:148037107-148037129 GTTTCTGGGGAGAAGTTGTTGGG - Intergenic
914511106 1:148332858-148332880 GTTTCTGGGGAGAAGTTGTTGGG - Intergenic
915240990 1:154521578-154521600 CTGACTGTGGAGAAGAAGGCAGG + Intronic
915480518 1:156181493-156181515 GTGTCTGTGTAGAAATAAGTAGG + Intergenic
915803502 1:158819351-158819373 GTCACTGTGGAGATGTAGATTGG + Intergenic
916078009 1:161214168-161214190 TTGTATTTGGAGAAGTAGATCGG + Exonic
916270809 1:162939354-162939376 GTGAATGTGGAGAAGTAGGAAGG + Intergenic
916329114 1:163595014-163595036 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
917473704 1:175349817-175349839 CTGGCTGTGGAGAAGGAGGTAGG - Intronic
919977686 1:202623402-202623424 GAGTCTCTGGAGAAGGAGGTGGG - Intronic
920306657 1:205022463-205022485 GTGTGTGTGGATATGTAGGAAGG - Exonic
920381688 1:205538257-205538279 CTGCTTGTGGAGAAGTGGGTGGG - Intergenic
920426999 1:205886351-205886373 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
920487578 1:206385519-206385541 GTTTCTGGGGAGGAGTAGTTTGG + Intronic
922131505 1:222784229-222784251 GTATCTGTGGAGAATTAAATTGG + Intergenic
922547439 1:226468819-226468841 GTGGTTGTGGAGGAGAAGGTGGG + Intergenic
923073534 1:230588629-230588651 AGGTGTGTGGATAAGTAGGTGGG + Intergenic
924318732 1:242825626-242825648 GTGTCTAGGGAGAAGAAGCTTGG - Intergenic
1063033660 10:2262688-2262710 GTCTCTGTGGAGAAGCAAGTAGG - Intergenic
1063733846 10:8730009-8730031 GTGTCTGGGGAGGAGTAAATGGG + Intergenic
1064470703 10:15632575-15632597 GTGACTGGGCAGAAGCAGGTCGG + Intronic
1064681554 10:17815482-17815504 CTAGCTGTGGAGAAGTAGGAGGG + Intronic
1065437969 10:25721119-25721141 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1066108980 10:32179784-32179806 GTGTGTGTGCAGATGTGGGTGGG + Intergenic
1066587538 10:36952905-36952927 CTGTATATGGAGAAGGAGGTGGG + Intergenic
1067360669 10:45575281-45575303 GTTTCAGTGGGGGAGTAGGTGGG - Intronic
1067829997 10:49606126-49606148 ATTTCTGTGGAGAAGCAGGCTGG - Intergenic
1068657952 10:59593709-59593731 GTGTCTGTGATGAGGTGGGTAGG - Intergenic
1068956865 10:62826220-62826242 GGGGCTGTGGATAAGCAGGTAGG + Intronic
1069083593 10:64114489-64114511 GTGTGTGTGTATAAGTAAGTGGG + Intergenic
1070893780 10:79964466-79964488 GTTTCAGTGGGGGAGTAGGTGGG - Intronic
1072011024 10:91303012-91303034 GTTTCAGTGGGGAAGTAGGTGGG + Intergenic
1072480789 10:95809114-95809136 GTGTCTGTGTAGAAAGAAGTAGG - Intronic
1074681026 10:115907884-115907906 GTGTGTACAGAGAAGTAGGTAGG - Intronic
1074865487 10:117542319-117542341 GTGGCTGAGGGGGAGTAGGTGGG + Intergenic
1075034943 10:119057245-119057267 GAGTCTGGGTAGATGTAGGTTGG - Intronic
1075201444 10:120408122-120408144 GTGTGTGTGAAGAAGTGGGGAGG - Intergenic
1075446786 10:122518880-122518902 GTCTTTGTGGGGAAGTAGGGAGG + Intergenic
1075835774 10:125451487-125451509 GTGTGTGTGGAGGAGGCGGTGGG - Intergenic
1076485218 10:130811331-130811353 GTGTCAGTGGATAGGCAGGTGGG - Intergenic
1076585759 10:131546434-131546456 GTGCCTGTGGAGAAGGTGGAGGG - Intergenic
1076778389 10:132710568-132710590 GTGTGGGTGGACAGGTAGGTGGG + Intronic
1077226188 11:1440051-1440073 GTGGCTGTGGTGATGTAGGGGGG - Intronic
1078523134 11:12079381-12079403 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1078663775 11:13307773-13307795 CTGCCAGTGGAGAAATAGGTTGG + Intronic
1078789370 11:14527287-14527309 GTTTCAGTGGGGCAGTAGGTGGG - Intronic
1079230868 11:18647708-18647730 GTTTCAATGGAGGAGTAGGTGGG - Intergenic
1080106635 11:28518063-28518085 TTGACTGGGAAGAAGTAGGTGGG + Intergenic
1080387612 11:31819085-31819107 GTGTGTGTGTAGAAGCAGGGAGG + Intronic
1081280206 11:41200552-41200574 CTGTTTTTGCAGAAGTAGGTAGG - Intronic
1081546828 11:44077712-44077734 GAGTCTCTGGAAAAGCAGGTGGG - Intronic
1081915976 11:46730484-46730506 TTGTCTGGGGAGCAGTAGGGAGG + Intronic
1082124710 11:48418502-48418524 GTGTCTGCAGGGAAGTAGGAAGG + Intergenic
1082197430 11:49322693-49322715 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1083190860 11:61051375-61051397 GTGTCTGTGCAGAAGGGGGTGGG - Intergenic
1083751232 11:64761793-64761815 GTGTCTGTGGAGGTGTATTTTGG - Intergenic
1083752148 11:64766682-64766704 GTGTCTGGGGAGAGGTTCGTGGG - Intronic
1084946329 11:72640858-72640880 GTGGCTGTGGAGTGGTAGCTGGG - Intronic
1085716858 11:78880057-78880079 GTGTCTGTGTAGAAAGAAGTTGG + Intronic
1085824713 11:79832743-79832765 GGGGCTGTGGTGAAGTAGGCAGG + Intergenic
1086658386 11:89385431-89385453 GTTTCAGTGGGGGAGTAGGTGGG - Intronic
1086895093 11:92302955-92302977 GTGCCTGTGGAAAAATAGGTTGG + Intergenic
1087197230 11:95313963-95313985 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1088636997 11:111831334-111831356 GTCTCTATGGAGAATTAGGCTGG - Intronic
1089360267 11:117881124-117881146 ATGAATGTGGAGAAGTTGGTTGG - Intergenic
1089792173 11:120953223-120953245 GGGTCTGGGGAGAAGTGGGAGGG - Intronic
1090379689 11:126317773-126317795 CTGTGTGTGGAGAAGTGGGGGGG + Intronic
1090413963 11:126528148-126528170 GGGTCTGTAGAGCAGGAGGTAGG - Intronic
1092085631 12:5756844-5756866 GGGTCTGTGGGAAAGTGGGTGGG + Intronic
1092976498 12:13750057-13750079 GCTTTAGTGGAGAAGTAGGTAGG + Intronic
1094401021 12:30060643-30060665 GTTTCAGCGGAGGAGTAGGTGGG - Intergenic
1095065496 12:37766984-37767006 GAGGATGTGGAGAAATAGGTGGG + Intergenic
1095381564 12:41600644-41600666 GTGTCTGTCGAAAGGTAAGTGGG - Intergenic
1095806409 12:46324989-46325011 GTTTCAGCAGAGAAGTAGGTGGG + Intergenic
1095867435 12:46988005-46988027 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
1096906944 12:54944660-54944682 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1096961340 12:55581110-55581132 GTGTCTGTCTAGAAGTTGGTTGG + Intergenic
1097131322 12:56812658-56812680 GTGTGTGTGGATAGGTAGGTAGG - Intergenic
1097592681 12:61591318-61591340 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1097614734 12:61870619-61870641 GTGTGTGTGGAGAAAAAGATGGG - Intronic
1098021007 12:66156543-66156565 GAGTGTGTGGAGAAATAGGTGGG - Intronic
1098920264 12:76296280-76296302 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1099135937 12:78901703-78901725 GTGTCTGAGGAGAATTGGATTGG - Intronic
1100543598 12:95580636-95580658 GTGTCTATGTATATGTAGGTGGG + Intergenic
1101299526 12:103464203-103464225 GAGGCTGTGGAGAAATAGGAAGG - Intronic
1105409809 13:20161686-20161708 GTGTCTGAAGAGAAGCAGGATGG - Intergenic
1105760847 13:23512872-23512894 GTGTTTGGTGAGAATTAGGTTGG - Intergenic
1105767047 13:23570564-23570586 GAGTCTGTGGACTAGGAGGTGGG + Intronic
1106808099 13:33332180-33332202 GTGTCTGTGGATAGGTGGGGAGG - Intronic
1108270833 13:48757869-48757891 GTGTCTGGGGAGAAGGAGTGAGG - Intergenic
1108702958 13:52959198-52959220 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1109597641 13:64577539-64577561 GTAGCTGTGGAGAAATAGGAAGG + Intergenic
1111644985 13:91021521-91021543 GTGTCTGTGGTGATGGTGGTGGG - Intergenic
1112077158 13:95928056-95928078 GTGTCTGTGTAGAAAGAAGTGGG - Intronic
1112683874 13:101800023-101800045 GTGTCTGTGGAGAAGTAGGTAGG - Intronic
1113353063 13:109548524-109548546 GTGTCTGTGCTGACGTTGGTTGG - Intergenic
1113468710 13:110530122-110530144 GTGTCTGTGTAGAGGTGGGGTGG - Intronic
1113468727 13:110530169-110530191 GTGTCTGTGTAGAGGTGGGGTGG - Intronic
1113468832 13:110530457-110530479 GTGTCTGTGTAGAGGTGGGGCGG - Intronic
1113468847 13:110530505-110530527 GTGTCTGTGTAGAGGTGGGGCGG - Intronic
1113468862 13:110530553-110530575 GTGTCTGTGTAGAGGTGGGGCGG - Intronic
1113468892 13:110530647-110530669 GTGTCTGTGTAGAGGTGGGGCGG - Intronic
1113468935 13:110530791-110530813 GTGTCTGTGTAGAGGTGGGGTGG - Intronic
1113504490 13:110805793-110805815 GTGGCTGTGCAGAAGTAACTGGG - Intergenic
1113535237 13:111061312-111061334 GTGTTTGTGGAGAAAGAGGGAGG + Intergenic
1114499716 14:23159544-23159566 GTGTCTGGGGAGGAGCAGTTTGG + Intronic
1114609728 14:24031213-24031235 GAGGATGTGGAGAAGTAGGAAGG + Intergenic
1115369829 14:32600754-32600776 GTGTCTGTGGAGGATGAGGAAGG + Exonic
1115445516 14:33485057-33485079 GTACCTTTGGAGAGGTAGGTAGG + Intronic
1118130573 14:62958402-62958424 GTGTCTGAGGAGAAGTAGAAAGG - Intronic
1119167635 14:72508259-72508281 GTGTTGGTGAAGAAGTAGTTGGG + Intronic
1120352778 14:83384297-83384319 GTCTCTGTGATGAAGTAGGTTGG - Intergenic
1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG + Intergenic
1121037142 14:90715781-90715803 GGGTCTTGGGAGAAGTGGGTGGG - Intronic
1121980289 14:98448529-98448551 GTTTCAGTGGGGAAGTAAGTGGG + Intergenic
1122018256 14:98815438-98815460 GTTTCTTTGGTGAAGTATGTTGG - Intergenic
1122117323 14:99534418-99534440 GTTCCTGTGGAGAAGTGGGTTGG - Intronic
1122225393 14:100273862-100273884 GATTCAGTGGAGAAGCAGGTAGG + Intronic
1122412646 14:101533854-101533876 GTGTCTGTGCAGATGTGGGGTGG - Intergenic
1122507996 14:102244284-102244306 GTTTCAGTGGTGGAGTAGGTGGG - Intronic
1123754801 15:23388879-23388901 GTGTGTGTGGAGGAGGAAGTGGG - Intergenic
1124140389 15:27072313-27072335 GTGTCCATGGAGAAGGAGGTAGG - Intronic
1124493334 15:30171766-30171788 GAGTCTCTGGAGAAGGAGGTGGG - Intergenic
1124567850 15:30832975-30832997 GTGTCTATGGAGACACAGGTGGG - Intergenic
1124750200 15:32366559-32366581 GAGTCTCTGGAGAAGGAGGTGGG + Intergenic
1127034507 15:54900517-54900539 GAGTCTGTGGAGAAATAGGAAGG + Intergenic
1127559085 15:60118100-60118122 GTGTGGGTGGGGAGGTAGGTGGG + Intergenic
1127679018 15:61274850-61274872 GTGACCTTGGAGAAGTATGTAGG + Intergenic
1128693727 15:69744749-69744771 GTGTCTGTGGGCAAGTTGCTTGG + Intergenic
1128744322 15:70103021-70103043 GTGTCTATGCAGAATAAGGTTGG - Intergenic
1130116680 15:81011363-81011385 GTGACTGGGGAGTAGTATGTAGG + Intronic
1130334946 15:82950776-82950798 TTGTTTGTGGAGAAGCAGGGAGG - Intronic
1130848792 15:87773389-87773411 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
1131535433 15:93233369-93233391 GAGTCTGTGGAGTTCTAGGTTGG - Intergenic
1131812324 15:96185493-96185515 GTGGCTGTGGAGAAGTGGAGAGG - Intergenic
1132070424 15:98771885-98771907 ATGTCAGTGGAGAAGAAGGAAGG - Intronic
1132761116 16:1509102-1509124 GAGTCTCTGGGGAAGGAGGTGGG - Intronic
1134020812 16:10920184-10920206 GTGTGAATGGAAAAGTAGGTGGG + Intronic
1134252732 16:12585897-12585919 GTGTGGGTGGAGAAGTGTGTTGG - Intergenic
1134323085 16:13181504-13181526 ATGTGTCTGGAGAAGTTGGTAGG + Intronic
1134461568 16:14434101-14434123 GTGTGTGTGGAGGAGGAAGTGGG + Intergenic
1137937456 16:52648109-52648131 GTGCCTGGGGAGAAGTAATTAGG + Intergenic
1137961300 16:52884600-52884622 ATGTGGCTGGAGAAGTAGGTGGG + Intergenic
1138100180 16:54246107-54246129 GTGTGTGTGTACAAGTGGGTGGG + Intronic
1138576726 16:57912118-57912140 GTGTGTGTGGAGGAGCAGGGAGG + Intronic
1140963180 16:79937097-79937119 GTGTCTTTGGAGAAATAATTTGG + Intergenic
1141697085 16:85625220-85625242 GTGTGTGCGGAGAAGCAGGCCGG - Intronic
1142309775 16:89305742-89305764 GTGTCTGCGGAGTGGGAGGTAGG - Intronic
1142309801 16:89305875-89305897 GTGTCTGCGGAGTGGGAGGTGGG - Intronic
1142309808 16:89305904-89305926 GTGTCTGCGGAGTGGGAGGTGGG - Intronic
1142309815 16:89305933-89305955 GTGTCTGCGGAGTGGGAGGTGGG - Intronic
1142309822 16:89305962-89305984 GTGTCTGCGGAGTGGGAGGTGGG - Intronic
1142309829 16:89305991-89306013 GTGTCTGCGGAGTGGGAGGTGGG - Intronic
1142309836 16:89306020-89306042 GTGTCTGCGGAGTGGGAGGTGGG - Intronic
1142309843 16:89306049-89306071 GTGTCTGCGGAGTGGGAGGTGGG - Intronic
1142309870 16:89306184-89306206 GTGTCTGCGGAGTGGGAGGTAGG - Intronic
1142309876 16:89306213-89306235 GTGTCTGCGGAGTGGGAGGTAGG - Intronic
1142309894 16:89306296-89306318 GTGTCTGCGGAGGGGGAGGTAGG - Intronic
1142309907 16:89306350-89306372 GTGTCTGCGGAGTGGGAGGTAGG - Intronic
1142309928 16:89306462-89306484 GTGTCTGCGGAGTGGGAGGTGGG - Intronic
1142309940 16:89306516-89306538 GTGTCTGCGGAGTGGGAGGTGGG - Intronic
1142309962 16:89306624-89306646 GTGTCTGCGGAGTGGGAGGTAGG - Intronic
1142309982 16:89306728-89306750 GTGTCTGCGGAGTGGGAGGTGGG - Intronic
1142309994 16:89306786-89306808 GTGTCTGCGGAGTGGGAGGTAGG - Intronic
1142310015 16:89306894-89306916 GTGTCTGCGGAGTGGGAGGTAGG - Intronic
1143276009 17:5711395-5711417 GTGTCTTTCCAGAGGTAGGTGGG - Intergenic
1144429886 17:15181571-15181593 GTGTCTGGTGAGTAGTACGTGGG - Intergenic
1146708797 17:35022708-35022730 GTGTCGATGGAGCAGTGGGTGGG - Intronic
1146945606 17:36871000-36871022 GAGCCTATGGAGAAGTGGGTGGG - Intergenic
1147436233 17:40417865-40417887 GCGTCTGTGGAGAAGCGGCTTGG - Exonic
1148767244 17:50046525-50046547 GGGTCTGTGGAAATGTAGATAGG - Intergenic
1150001835 17:61445168-61445190 AGGTCTGTGGCCAAGTAGGTGGG + Intergenic
1150591143 17:66563801-66563823 CTGTCTGTGCAGAGGTACGTTGG + Intronic
1151140134 17:71983798-71983820 GTGTTTCTGGAGAAGGAGTTGGG - Intergenic
1151432168 17:74071021-74071043 GTGACTGGGGAGGAGTGGGTAGG - Intergenic
1151734587 17:75931183-75931205 GTTTCTGGGGATAAGTAGGGAGG + Intronic
1152519589 17:80847408-80847430 GTGTTTGTGGGGAAGTGTGTGGG + Intronic
1153466110 18:5389525-5389547 CTGTGGCTGGAGAAGTAGGTGGG + Intergenic
1153585108 18:6612793-6612815 CTCTCTGTGGAGAAGGAGGCAGG - Intergenic
1155603522 18:27576692-27576714 CTATCTCTGGAAAAGTAGGTAGG - Intergenic
1156345075 18:36249615-36249637 GTGCCTGTGGAGCAGTTGGAAGG + Intronic
1156965537 18:43086783-43086805 ATGGCTGTGGAGAAGGAAGTGGG + Intronic
1157913832 18:51645065-51645087 GTATCTTTGGAGAAGGAGGGTGG + Intergenic
1158403418 18:57140911-57140933 GTGTCAGTGAAGAAGGAGGAAGG + Intergenic
1158494857 18:57945721-57945743 CTGTCTGTGGATAACAAGGTGGG + Intergenic
1158647794 18:59263521-59263543 GTGTCTGTGGTGAAGTAATGAGG + Intergenic
1162386151 19:10361719-10361741 GTGTCTGTGGAGGAGGTGGCCGG - Intronic
1163750763 19:19076026-19076048 GTCACTGTGGAGAAGAAAGTGGG - Intronic
1163899839 19:20091499-20091521 GTTTCCGTGGGGGAGTAGGTGGG + Intronic
1163944137 19:20520309-20520331 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1164153291 19:22572695-22572717 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1164202165 19:23027899-23027921 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1164208573 19:23077774-23077796 GTGTCTGTGTAGAAAGAAGTAGG + Intronic
1165839968 19:38782704-38782726 CAGTCTCTGGAGTAGTAGGTAGG - Intergenic
1166303473 19:41924832-41924854 GTTTCTGGAGAGAAGCAGGTTGG + Intronic
1166312619 19:41971261-41971283 GTTTATGTGGAAAGGTAGGTGGG - Intronic
1166823144 19:45592739-45592761 GAGTGTGGGGAGAAGAAGGTTGG - Intronic
1168211803 19:54896087-54896109 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1168248575 19:55127474-55127496 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
925433517 2:3817075-3817097 GTTTCAGTGGGGAAGCAGGTGGG + Intronic
926715061 2:15917852-15917874 GGGTCTAAGGAGAAGTAGATGGG - Intergenic
926965097 2:18401222-18401244 TTAGCTGTGGAGAAGTAGATGGG + Intergenic
927134465 2:20086673-20086695 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
930271285 2:49260549-49260571 GTTTCTGTGGAGAGGTAGGTAGG + Intergenic
930307382 2:49692481-49692503 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
931925142 2:67064334-67064356 TTCTCTGTCCAGAAGTAGGTGGG - Intergenic
931996222 2:67841816-67841838 GTGTCTGTGGAGAGTGAGGGTGG - Intergenic
932738375 2:74272186-74272208 GTGTGTCTGGGGTAGTAGGTGGG + Intronic
932789322 2:74639916-74639938 CTGTGTGTGGAGAAGTAGTGCGG + Intronic
935222446 2:101027212-101027234 GTTTCTGGGTAGAAGCAGGTAGG + Intronic
935316873 2:101843547-101843569 GTGGCAGTGGAGAAGTAACTCGG + Intronic
938446505 2:131384472-131384494 GTGTCAGTGGAGATATTGGTAGG + Intergenic
938781015 2:134584952-134584974 GTGTCTGTGGAGTAGTTGGCAGG - Intronic
938997502 2:136696115-136696137 GTGCCTGTGGATATCTAGGTCGG + Intergenic
940496483 2:154435422-154435444 GTGTCTGTGGAGTAGTGAGATGG + Intronic
940508506 2:154584723-154584745 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
941455821 2:165711377-165711399 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
943061869 2:183048228-183048250 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
943263220 2:185693100-185693122 GGGTCTGTGTAGGAGTAGGTTGG - Intergenic
943640378 2:190351467-190351489 GTGTCCTTGGAGAAGAAGGTGGG - Intronic
943750895 2:191508457-191508479 GTGTTTGTGGAGAAAGAGGGAGG + Intergenic
945220812 2:207482061-207482083 ATGACTGTGGAGAAGCAGGAAGG + Intergenic
945734355 2:213580258-213580280 GTATTTGTGGAGAAGTATGATGG - Intronic
945999092 2:216465857-216465879 GAGGGTGTGGAGAGGTAGGTGGG - Intronic
947842474 2:233216904-233216926 GTTTCAGTGGGGGAGTAGGTGGG + Intronic
948026616 2:234783140-234783162 GTGTGTGTGAAATAGTAGGTGGG - Intergenic
948920164 2:241062578-241062600 GTGTCTGTGAAGCAGCAGGGCGG - Intronic
1168942962 20:1729017-1729039 GTTTCAGTGGCGGAGTAGGTGGG + Intergenic
1171266996 20:23779610-23779632 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1171276716 20:23862385-23862407 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1171280164 20:23889623-23889645 GTGTCTGAGGGGAACTAAGTGGG + Intergenic
1171283477 20:23919874-23919896 GTGCCTGTGGAGATGCATGTGGG - Intergenic
1172433692 20:34913537-34913559 GGGGCTCTGGAGAAGTAGGTTGG + Intronic
1173182597 20:40816029-40816051 GTGTCTGTGGAGGACTAGTTTGG - Intergenic
1173265159 20:41472459-41472481 GGGTATGTGGTGAAGAAGGTGGG - Intronic
1174482015 20:50837957-50837979 GTGTGTGTGTAGAGGTGGGTGGG - Intronic
1174991713 20:55518090-55518112 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1175480781 20:59309184-59309206 GTGTCTGTGAAATAGGAGGTAGG + Intronic
1175907695 20:62389418-62389440 GTGGCTGTGGAAAAGGAGGAGGG + Exonic
1176161141 20:63649453-63649475 GTGTCTGTGGAGAGGTGGCCTGG - Intronic
1176412072 21:6454524-6454546 GTTTCAGTGGAGAAGCTGGTTGG + Intergenic
1177628967 21:23701890-23701912 GTGTCTGTGCAAAGGTAGGATGG - Intergenic
1178153968 21:29830294-29830316 GTGTGTGTGGGGAGGTGGGTGGG - Intronic
1178575729 21:33788270-33788292 GTGTGTGTGTGGAAGGAGGTGGG - Intronic
1178792474 21:35712990-35713012 TTGTCTGGGGAGAAGTAGGGAGG - Intronic
1179687566 21:43062846-43062868 GTTTCAGTGGAGAAGCTGGTTGG + Intronic
1180244863 21:46540145-46540167 GTTTGTGTGGAGAATTGGGTAGG + Intronic
1180671195 22:17554873-17554895 GTGTTTGTGCAGAAGCAGGGAGG + Intronic
1180818223 22:18806478-18806500 GTGTGTGGGGAGAAGTGGGGAGG + Intergenic
1181044597 22:20208590-20208612 GTGGCTGTGGGGACGGAGGTGGG + Intergenic
1181204446 22:21240933-21240955 GTGTGTGGGGAGAAGTGGGGAGG + Intergenic
1182584287 22:31334942-31334964 GTGTCTGTGCTAAAGGAGGTTGG - Intronic
1183538992 22:38418840-38418862 ATGTCTGTGGGGAAGCAGCTGGG - Intergenic
1183635282 22:39058355-39058377 GTTTCGGTGGGGGAGTAGGTGGG + Intronic
1203222479 22_KI270731v1_random:54482-54504 GTGTGTGGGGAGAAGTGGGGAGG - Intergenic
1203268353 22_KI270734v1_random:32332-32354 GTGTGTGGGGAGAAGTGGGGAGG + Intergenic
950573518 3:13816816-13816838 GTGTGGATGGATAAGTAGGTGGG - Exonic
951129211 3:19022011-19022033 GTGTATTTGGAGAAGCAGGTAGG - Intergenic
951894930 3:27601588-27601610 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
952276693 3:31883971-31883993 TTCTCTGTGGATAAGTTGGTAGG - Intronic
952492513 3:33885782-33885804 GTGTTGGTGGAGTGGTAGGTCGG + Intergenic
953656181 3:44856565-44856587 GTTTCAGTGGGAAAGTAGGTGGG + Intronic
953786067 3:45912222-45912244 GTGTATCTGGAGGAGAAGGTGGG + Intronic
953849653 3:46455933-46455955 GTGGCTGTGGTGAAGAAGGGCGG - Exonic
954218271 3:49136352-49136374 TTGTCTGTGGGGAAGAGGGTAGG + Intergenic
955909356 3:63844197-63844219 GTGGCTAGGGAGAAGGAGGTTGG + Intronic
956233203 3:67040038-67040060 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
956570728 3:70691377-70691399 GAGGATGTGGAGAAGTAGGAAGG - Intergenic
957181320 3:76881915-76881937 GTGTCTGTTGGGTGGTAGGTTGG + Intronic
957181325 3:76881954-76881976 GTGTCTGTTGGGTGGTAGGTTGG + Intronic
957181340 3:76882063-76882085 GTGTCTGTTGGGTCGTAGGTTGG + Intronic
957451764 3:80389319-80389341 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
957755268 3:84477100-84477122 GTGTTTGTGGAGAATTAGTCTGG + Intergenic
960471003 3:118065166-118065188 AGTTCTGTAGAGAAGTAGGTAGG - Intergenic
961296702 3:125890493-125890515 GTGTCTGTGTAGAAAGAAGTAGG + Intergenic
962025116 3:131539685-131539707 GTGTGTGTGGGGAAGTGGGGAGG + Intronic
962523610 3:136218994-136219016 GTTTCAGTGGGAAAGTAGGTGGG + Intergenic
962738520 3:138346618-138346640 GGGTCTTTGGAGCAGCAGGTGGG + Intergenic
962785963 3:138768587-138768609 GTTTCTGGGTGGAAGTAGGTTGG - Intronic
963634596 3:147778203-147778225 GCTTCTGTGGAGAAACAGGTTGG - Intergenic
963887770 3:150600961-150600983 GTTTCAGTGGGGGAGTAGGTGGG - Intronic
964105705 3:153037092-153037114 ATGGCTGGGGAGAAGAAGGTGGG + Intergenic
964128883 3:153265841-153265863 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
964629549 3:158795328-158795350 GTGTCTGGGTAGAGGTATGTGGG - Intronic
965335473 3:167427430-167427452 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
965615554 3:170588427-170588449 ATGTCAGTGGAGAGGTAGGCAGG - Intronic
966397300 3:179516771-179516793 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
967012666 3:185451305-185451327 GTGTCTGCCGAAAAGAAGGTCGG - Exonic
967323090 3:188213158-188213180 ATGTCTGTGGACATGTAGGGAGG + Intronic
967630084 3:191735579-191735601 GTGGATGTGGAGAAATAGGAAGG + Intergenic
968666916 4:1827681-1827703 GTGTCTGTGTAGAAAGAAGTAGG - Intronic
968692726 4:2003240-2003262 GAGGCTGTGGAGAAATAGGAAGG + Intronic
968882768 4:3309833-3309855 GTGTCTGCTGAGAACTGGGTGGG + Intronic
968919561 4:3515520-3515542 GTGTCTGTTGGGAGGGAGGTGGG - Intronic
969044196 4:4324714-4324736 GTGTCTGTGAAGACGCTGGTAGG - Intergenic
973070153 4:45848789-45848811 GTGTCTGTTGAGTTGTAGGCTGG + Intergenic
974920668 4:68235322-68235344 TTGTCTGTAGGTAAGTAGGTTGG + Intronic
976719251 4:88154100-88154122 GTTTCAGTGGGGGAGTAGGTGGG + Intronic
977782139 4:100993126-100993148 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
977815850 4:101413099-101413121 GAGGCTGTGGAGAAATAGGAAGG + Intronic
978308687 4:107361537-107361559 GGGTCTGTGGTGAAGATGGTTGG + Intergenic
978963403 4:114711845-114711867 GGGAGTGTGGAGAAGTAAGTCGG - Intergenic
980928206 4:139159464-139159486 GTTTCAATGGAGGAGTAGGTGGG + Intronic
981214229 4:142145236-142145258 TTTTCTGTGGAGAGATAGGTGGG - Intronic
981585850 4:146301389-146301411 GTGGCACTGGAGAAGCAGGTTGG + Intronic
983056306 4:163102127-163102149 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
983543876 4:168941695-168941717 GCGACTGTGGAGAAATAGGAAGG - Intronic
984412077 4:179407817-179407839 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
985426852 4:189839736-189839758 GTCTCTGTGGAGAGGGAGTTTGG - Intergenic
985493006 5:190115-190137 GTGTGTGTGAAGAGGTGGGTGGG - Intergenic
985693580 5:1327088-1327110 GTGTCTGTCGAGGAGGAGCTGGG - Intronic
985693665 5:1327639-1327661 GTGTCTGTAGAGGAGGAGCTGGG - Intronic
985693690 5:1327784-1327806 GTGTCTGTAGAGGAGGAGCTGGG - Intronic
985756548 5:1722949-1722971 GTGTCTGTGGCGGAGGACGTTGG - Intergenic
986151225 5:5132457-5132479 GTGTGTGTGCAGGAGTAGTTTGG - Intergenic
987147466 5:15006193-15006215 ATGAGTGTGGAGAAGTAGGCAGG - Intergenic
987263401 5:16226517-16226539 GTGTCTGTGGCAAAGGAGATGGG + Intergenic
987342256 5:16949431-16949453 GTGTCAGTGCAGAATTAGATAGG - Intergenic
987645331 5:20663940-20663962 GTGTCTTTGGACAAGTAATTTGG - Intergenic
988636882 5:32994539-32994561 GTGTGTGTAGAGAGGGAGGTAGG - Intergenic
988638504 5:33015047-33015069 GTGTCTGTGGACCAGTTGGGAGG + Intergenic
989619645 5:43371718-43371740 GTGTCTGTGGATAAGGAATTTGG - Intergenic
989646104 5:43634169-43634191 ATGTCTCTGGAGAATTGGGTGGG + Intronic
989992104 5:50779164-50779186 GTGTATGTGTGGTAGTAGGTAGG - Intronic
992090760 5:73314144-73314166 GTGGATGTGGAGGAGGAGGTGGG - Intergenic
992177033 5:74159464-74159486 CTGTTGGTGGAGATGTAGGTTGG + Intergenic
994125786 5:96168144-96168166 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
994313254 5:98301725-98301747 ATCTCTGTGGAGAAGAAAGTGGG + Intergenic
996109835 5:119552312-119552334 GAGGCTGTGGAGAAATAGGAAGG - Intronic
996917977 5:128733782-128733804 GTTTCAGTGGGAAAGTAGGTGGG - Intronic
997678488 5:135732779-135732801 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
999174982 5:149625748-149625770 GTGTGTGTGGAGAGGTGGGAGGG - Intronic
999551238 5:152689447-152689469 GTGTCTCTGCAGCAGTTGGTGGG - Intergenic
999679933 5:154047338-154047360 ATGTCTATGGGGCAGTAGGTAGG + Intronic
1000053521 5:157582315-157582337 GTTCCTGTGGATAAGTAGGGAGG - Intergenic
1003288130 6:4752854-4752876 GTGTTTGTAGATAGGTAGGTAGG + Intronic
1004066457 6:12249871-12249893 GTGTCTGGAGAGAAAAAGGTAGG - Intergenic
1004542158 6:16561381-16561403 GTATCTGTGGAGAGGTGGGTGGG - Intronic
1004845176 6:19633892-19633914 GTGTGTGTGGAAAGGGAGGTGGG + Intergenic
1005227537 6:23659838-23659860 GTTTGTGTGGAGAAGTGGGCTGG - Intergenic
1005524602 6:26633569-26633591 GTGTCTCTGGTGAAGTAGACAGG - Intergenic
1006303485 6:33206267-33206289 GTGTCTGTGGAGAGGTTTGTGGG + Intronic
1007421629 6:41723319-41723341 GTGTCTTTGGGGAGGTGGGTGGG - Intronic
1007755695 6:44097803-44097825 GTGTCTGTGGACAAGTTACTTGG + Intergenic
1009270113 6:61604406-61604428 GTTTCAGTGGTGGAGTAGGTGGG - Intergenic
1009749942 6:67869919-67869941 GTTTCAGTGGGGAAGTAGGTGGG + Intergenic
1011615262 6:89192288-89192310 GTGTATGTGGAGAGGACGGTGGG - Intronic
1012096640 6:94970862-94970884 GTGTATGTGGAGAAGGAAGAGGG + Intergenic
1012515101 6:100050154-100050176 GGGTCTGTCGAGAGGTAGGGGGG - Intergenic
1013638123 6:112047957-112047979 GTGTCTGTGTAGAAAGAAGTAGG + Intergenic
1014244578 6:119053923-119053945 GTGCCTGCTGAGAAGTAGATTGG - Intronic
1014514822 6:122365686-122365708 GGGTCTGTGGAGACACAGGTTGG + Intergenic
1014550331 6:122782783-122782805 GTTTCTGTGGAGATGGAGGTGGG + Intronic
1015788832 6:136945825-136945847 GTGAGTGTGGAGGAGTAGGGTGG + Intergenic
1015991206 6:138945315-138945337 ATGTGTGTGGAGAAGTTGGTGGG + Exonic
1016273430 6:142318807-142318829 GGGTCTCTGCAGAAGAAGGTAGG + Intronic
1016487843 6:144562832-144562854 GAGGCTGTGGAGAAATAGGAAGG - Intronic
1016730808 6:147425567-147425589 GAGGATGTGGAGAAGTAGGAAGG - Intergenic
1016751184 6:147632049-147632071 GTTTCAGTGGGGGAGTAGGTGGG + Intronic
1017573445 6:155773809-155773831 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1018719676 6:166563219-166563241 GTGTCTCTGGAGAAGGAAGATGG + Intronic
1018735330 6:166683654-166683676 ATGTCTCTGGATAACTAGGTAGG + Intronic
1018750341 6:166798765-166798787 CTGTCTGTGGAGAAGGGGGCAGG - Intronic
1018776700 6:167023739-167023761 GTGTCTGTGGAGGTGGCGGTAGG + Intronic
1018925294 6:168201684-168201706 GGGCCTGTGGAGAAGAAGTTTGG - Intergenic
1019868141 7:3732166-3732188 TTCTCTGTGTTGAAGTAGGTAGG + Intronic
1020360937 7:7325902-7325924 TTCTCTGTGTAGGAGTAGGTTGG - Intergenic
1020525739 7:9256357-9256379 GAGGCTGTGGAGAAATAGGAAGG + Intergenic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022600139 7:31750155-31750177 TTGTGTGTGGAGAAGGAGATAGG + Intergenic
1022942795 7:35255825-35255847 GTGTCTGGGGAGAGACAGGTTGG - Intergenic
1024702847 7:51923577-51923599 ATGTCTTAGGAGAAGTAGTTAGG + Intergenic
1026670747 7:72388745-72388767 GTGTCTGTGGTCATGTATGTGGG - Intronic
1027331034 7:77093342-77093364 GTGGCTTGGGTGAAGTAGGTTGG - Intergenic
1028858565 7:95620796-95620818 GAGTCTGTGGAAAAGTAAGCGGG - Intergenic
1029784740 7:102777986-102778008 GTGGCTTGGGTGAAGTAGGTTGG + Intronic
1029796142 7:102896385-102896407 GTGGCTGTGGAGATGGTGGTTGG + Intronic
1030163260 7:106529489-106529511 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1030462903 7:109863005-109863027 GAGTATGTGGAGAAATAGGAAGG + Intergenic
1031397193 7:121287248-121287270 GTGTCTGTGTGGCAGGAGGTTGG - Intronic
1032156756 7:129475955-129475977 GTGTCTGTGTAGAAAGAGGCGGG - Intronic
1032432283 7:131871791-131871813 CTGTCTGTGGAGGAGGTGGTGGG + Intergenic
1032576399 7:133059603-133059625 GAGTCTGTGGAGGAGTGGCTAGG - Intronic
1033620553 7:143058479-143058501 GTGTCTGTGGAGGAGAGGGAAGG - Intergenic
1033653028 7:143356291-143356313 GTGGCTGTGGAGAAGGACCTGGG - Exonic
1034352890 7:150428745-150428767 GTGTCTGTGGAGAGTGTGGTTGG - Intergenic
1034561743 7:151884743-151884765 GTATCTGTGAAGGAGTGGGTGGG + Intergenic
1035581426 8:741959-741981 CTGTCTGTGGAGGAGAAGGGCGG + Intergenic
1037436472 8:18869148-18869170 GTGAGTGTGGAGAGGTAGGGAGG - Intronic
1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG + Intergenic
1037911986 8:22748978-22749000 GGGTCTGTGGAGAATTTGGGGGG + Intronic
1038093108 8:24276569-24276591 GTGAATATGGAGAAGTAGCTTGG - Intergenic
1039317070 8:36385532-36385554 GTGTCTGGGGAGAAGGATGGAGG - Intergenic
1040533346 8:48283619-48283641 TTGTCTGTGGAGTAGGATGTGGG - Intergenic
1040648351 8:49424193-49424215 GTTTCAGTGGGAAAGTAGGTGGG - Intergenic
1041646235 8:60255271-60255293 GTGTCTGTCCAGAATTAGGCGGG - Intronic
1041651496 8:60307540-60307562 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1042044385 8:64632165-64632187 GTGTCAGTGGACATTTAGGTTGG - Intronic
1042781278 8:72493847-72493869 GGGTCCGTGGAGAAGTGAGTGGG - Intergenic
1042813957 8:72857483-72857505 GTGAGGCTGGAGAAGTAGGTTGG + Intronic
1043288920 8:78571370-78571392 GTGTAGGGGGAGATGTAGGTGGG - Intronic
1043599206 8:81918116-81918138 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1045533130 8:103003078-103003100 GTTTCAGTGGGGAAGTAAGTGGG - Intergenic
1046031223 8:108785944-108785966 GTGTGTGTGGAGGAGTGGGTTGG - Intronic
1047370247 8:124250271-124250293 GTGTGGGTGGATGAGTAGGTGGG - Intergenic
1048034069 8:130660427-130660449 TAGTCTGTGAAGAAGAAGGTAGG + Intergenic
1048296426 8:133217923-133217945 GTGTGTGTGGAGAAGGGAGTGGG - Intronic
1048308291 8:133298467-133298489 GTGTCTGTGGAGGCGCAGGGAGG - Intronic
1048448297 8:134509614-134509636 GTGACTGTGGTTAAGCAGGTAGG - Exonic
1050643887 9:7697931-7697953 GTTTCTGTGAAGAACTATGTTGG + Intergenic
1051537352 9:18175317-18175339 GTGTTTGTGGAGAACTGGGAAGG - Intergenic
1051800485 9:20927663-20927685 GTGTCTTTGTAGAAGTATTTTGG + Intronic
1052163420 9:25292344-25292366 GTTTCAGCGGAGGAGTAGGTGGG - Intergenic
1053059665 9:35021061-35021083 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1054928622 9:70613681-70613703 CTGCCTGTGGAGAAGAAGCTTGG + Intronic
1055472660 9:76628827-76628849 GTGTGTTTGGAGAAGTGGGTTGG - Intronic
1055734166 9:79310007-79310029 GTGTCAGTGGAGAAGAATGAAGG + Intergenic
1056076746 9:83049334-83049356 TTGACTGTGGAGATGTAGCTTGG - Intronic
1056324205 9:85463102-85463124 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1056363378 9:85880703-85880725 GTTTCTGTGGGGGAGTAGGTGGG + Intergenic
1058025886 9:100141962-100141984 GTTTCAGTGGGGGAGTAGGTGGG + Intronic
1058077953 9:100669567-100669589 GTGTGTGTGGGGAGGTAGGCGGG + Intergenic
1059828474 9:118062261-118062283 TTGTCTCTGGACAAGTAGGTAGG - Intergenic
1061521290 9:131119818-131119840 GTGTCTGGGGAGTAGAGGGTAGG - Intronic
1203771733 EBV:53130-53152 GTGTCTGCGGAGACGTAGGCCGG + Intergenic
1185999270 X:4989630-4989652 GTTTATGTGGAGGAGTAGGATGG - Intergenic
1186695300 X:12023933-12023955 GTGGCAGTGGTGAAGAAGGTAGG + Intergenic
1186909839 X:14151105-14151127 GAGGCTGTGGAGAAATAGGAAGG - Intergenic
1187127473 X:16467544-16467566 GTGGCTGTGGATAAGTAGATAGG - Intergenic
1187458663 X:19465885-19465907 GTGGCTGTGAAGAAGTAGATAGG - Intronic
1187827590 X:23347396-23347418 CTCTCTGAGGAGAAGTATGTGGG + Intronic
1188437922 X:30183987-30184009 GTTTTTGTTGAGAAGTAGGCTGG + Intergenic
1190936261 X:55001292-55001314 GTGGAGGTGGAGAATTAGGTGGG - Intronic
1191805465 X:65130779-65130801 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1193537427 X:82731501-82731523 GTTTCAGTGGGGGAGTAGGTGGG - Intergenic
1194909613 X:99624903-99624925 CTGTCTGAGGAGAAGTACCTAGG + Intergenic
1196438452 X:115695384-115695406 GTGTTTGGGCAGAGGTAGGTGGG - Intergenic
1198311473 X:135428661-135428683 GTGTGTTTGGAAAAGAAGGTGGG - Intergenic
1199073471 X:143504338-143504360 GTTTCAGTGGGGGAGTAGGTGGG + Intergenic
1200744093 Y:6888130-6888152 GAGACTGTGGAGAAATAGGAAGG - Intergenic
1201233936 Y:11892174-11892196 GTTTCAGTGGTGGAGTAGGTGGG + Intergenic