ID: 1112685586

View in Genome Browser
Species Human (GRCh38)
Location 13:101821713-101821735
Sequence CAGAATTGCTAAAATTAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 19, 3: 75, 4: 510}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112685586_1112685590 -8 Left 1112685586 13:101821713-101821735 CCATGTTAATTTTAGCAATTCTG 0: 1
1: 0
2: 19
3: 75
4: 510
Right 1112685590 13:101821728-101821750 CAATTCTGGTGGGAGTCTAATGG 0: 1
1: 0
2: 1
3: 29
4: 358
1112685586_1112685591 5 Left 1112685586 13:101821713-101821735 CCATGTTAATTTTAGCAATTCTG 0: 1
1: 0
2: 19
3: 75
4: 510
Right 1112685591 13:101821741-101821763 AGTCTAATGGTATCAGTTTGTGG 0: 1
1: 0
2: 0
3: 11
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112685586 Original CRISPR CAGAATTGCTAAAATTAACA TGG (reversed) Intronic
900717693 1:4155865-4155887 CAAAATTACAAAAATTAACTGGG - Intergenic
902102818 1:14006828-14006850 AAGAAATTCTAAAATTCACATGG - Intergenic
902371730 1:16011896-16011918 AAAAAATGCAAAAATTAACAGGG - Intergenic
903111139 1:21135192-21135214 CAGAATTGTGAAAATTAAACAGG + Intronic
903157531 1:21457597-21457619 GAGGATGGCTAAAATTAAAAAGG + Intronic
903432638 1:23318873-23318895 CAGAACCCCTAAAATTAAAAAGG - Intronic
904209242 1:28875300-28875322 CAGAATGGCTATTATTAAAAAGG + Intergenic
904308440 1:29607489-29607511 CACAATGGCTATAATTAAAAGGG + Intergenic
905746871 1:40425555-40425577 CAGAAATGCTAAACTAAGCATGG + Intergenic
905854831 1:41302767-41302789 CAGAATGGCCAAAATTTAAAAGG + Intergenic
906070980 1:43016184-43016206 CAAAATTACAAAAATTAACCGGG + Intergenic
906861887 1:49369630-49369652 CAAAGTTGCTAAAATTCACAGGG + Intronic
906979678 1:50616334-50616356 CAAAAATTCTAAAATTAATATGG - Intronic
907824012 1:57998106-57998128 CAGAATTTCTAGAAGTACCAGGG - Intronic
908591610 1:65642977-65642999 CAGAATGGCTAAAATTTTAAAGG - Intergenic
908734269 1:67259408-67259430 AAGAATGGCTAAAATTAAAAAGG - Exonic
908903076 1:68978551-68978573 CAAAAATACAAAAATTAACAGGG + Intergenic
908947417 1:69516405-69516427 CAATATTGGTAAAATAAACAGGG - Intergenic
909132977 1:71763010-71763032 CAAAAATGCTAAAAATAAAAAGG + Intronic
909158387 1:72112036-72112058 CAGAATTGTTAATATGAAGAAGG + Intronic
909210097 1:72812361-72812383 CATATTGGCTAAAATTAAAATGG - Intergenic
909833687 1:80226536-80226558 CAGGATTGTTAGCATTAACATGG - Intergenic
910064413 1:83136040-83136062 CAGAATAGCTATTATTAAAAAGG - Intergenic
911630308 1:100175850-100175872 CAGAATGGCTAAAATTCAAAAGG + Intronic
911721761 1:101198778-101198800 CTGAATTGCAAAAATTGACCAGG + Intergenic
912098783 1:106180184-106180206 CAGAAATTCTGAGATTAACAGGG - Intergenic
912255794 1:108056681-108056703 CAGAATTGCCATAATTAGAAAGG - Intergenic
913042946 1:115046387-115046409 AAAAAATGCTAAAATTCACATGG + Intergenic
913212335 1:116591973-116591995 GAGAATAGCTAAAATTCACTGGG - Intronic
913414807 1:118593179-118593201 CTGAATTGCTCAAATTAAAATGG + Intergenic
913544674 1:119855700-119855722 GAGAATGGCTAAAATTAAAAAGG - Intergenic
913602116 1:120431598-120431620 AAGAATGGCTAAAATTAAAAAGG + Intergenic
914084935 1:144445037-144445059 AAGAATGGCTAAAATTAAAAAGG - Intronic
914190944 1:145410194-145410216 AAGAATGGCTAAAATTAAAAAGG - Intergenic
914363291 1:146955208-146955230 AAGAATGGCTAAAATTAAAAAGG + Intronic
914377744 1:147087397-147087419 CAGAAATACAAAAATTAACTGGG + Intergenic
914407078 1:147386164-147386186 TAGAATGGCTAAAATTTAAAGGG - Intergenic
914429143 1:147604116-147604138 CAGAATTGCTAATAATACCAGGG + Intronic
914488385 1:148131931-148131953 AAGAATGGCTAAAATTAAAAAGG - Intronic
914585682 1:149059681-149059703 CAGAATTGCTGAAAGTCACCTGG + Exonic
914588750 1:149087047-149087069 AAGAATGGCTAAAATTAAAAAGG - Intronic
914911699 1:151792319-151792341 CAAAATTGGTAAAATTTCCAGGG - Intergenic
915169060 1:153964957-153964979 CGTAATTGGTAACATTAACAAGG + Intronic
915829323 1:159111416-159111438 CAGAATTGCTCACTTTAAAATGG + Intronic
916964366 1:169920003-169920025 CAAAATTGATAAAATTCCCAGGG - Intergenic
917139106 1:171816911-171816933 CTTAATTACAAAAATTAACATGG + Intergenic
917154350 1:171980180-171980202 CTGTATTGCTAAAATAAACAGGG - Intronic
917253172 1:173084755-173084777 CAGTAATGCTACAATGAACATGG - Intergenic
917852242 1:179075029-179075051 TAAAAATGCAAAAATTAACAGGG + Exonic
918438308 1:184540003-184540025 CAGAATGGCTTAAAACAACAAGG - Intronic
918720658 1:187848188-187848210 CAGAACTGCCAAAATAATCAAGG - Intergenic
918921021 1:190709841-190709863 CTGAATTGCTAAAATAAAATTGG - Intergenic
919609649 1:199729464-199729486 CAGAATGGCTAAAATTAAAATGG + Intergenic
920566452 1:206977411-206977433 CAAAATTGCTTAATTTAAGAAGG + Intergenic
921157264 1:212448342-212448364 CAGAATTTCTTTAAATAACAAGG + Intergenic
921468542 1:215521085-215521107 CAATATTGCTAAAATGGACAAGG + Intergenic
922149721 1:222988812-222988834 CAAAAATGCAAAAATTAACTGGG - Intronic
922410686 1:225372227-225372249 CAGAATTAATAAAATTCATATGG + Intronic
922638348 1:227200268-227200290 CAAAAATACAAAAATTAACAGGG + Intronic
922653606 1:227361867-227361889 CAGAAAGGCTAAAATTGACAAGG - Intergenic
923669537 1:236028550-236028572 CAAAATTGAGAAATTTAACATGG - Intronic
924744642 1:246820424-246820446 CTTAATTGCTAACACTAACAAGG - Intergenic
1063407051 10:5806192-5806214 TAGAATGGCTAAAATTAAAAAGG - Intronic
1064837582 10:19550987-19551009 CAGAATGGCTATTATTAAAAAGG - Intronic
1066123558 10:32316168-32316190 CAGAATGGCTAAAATAGAAAAGG + Intronic
1066651686 10:37661973-37661995 TAAAAATACTAAAATTAACAGGG + Intergenic
1067105993 10:43366764-43366786 CAAAATTACAAAAATTAACCTGG + Intergenic
1067424247 10:46191757-46191779 GAGAACTGGTAAAATTAAAATGG + Intergenic
1067825197 10:49566836-49566858 CAGAATGGCTATTATTAAAAAGG + Intergenic
1068345941 10:55777990-55778012 GAGAACTGGTAAAATTAAAATGG - Intergenic
1068682176 10:59831910-59831932 CAGAAATGGCAAACTTAACAAGG - Intronic
1068861595 10:61853538-61853560 CAGAATTGCAAAGATTTAAATGG - Intergenic
1068915167 10:62423415-62423437 CTGAATTGCTGAAATTCCCAAGG - Intronic
1069358221 10:67612354-67612376 CAAAATTGCAAACATTCACAAGG + Intronic
1070817428 10:79333831-79333853 TAAAATGGCTAAAATTAAAAAGG - Intergenic
1070860668 10:79657172-79657194 GAGAACTGGTAAAATTAAAATGG + Intergenic
1070876595 10:79818391-79818413 GAGAACTGGTAAAATTAAAATGG - Intergenic
1071153953 10:82668211-82668233 CAGAATGTCTAAAATTAGCTAGG + Intronic
1071643523 10:87340568-87340590 GAGAACTGGTAAAATTAAAATGG - Intergenic
1072042198 10:91618582-91618604 CAGAAATGAAAAAATTAATAAGG - Intergenic
1072225426 10:93364293-93364315 AAGAACTCCTCAAATTAACAAGG + Intronic
1072322194 10:94261587-94261609 CAAAGTGGCTAAAATTAAAATGG + Intronic
1072671434 10:97432663-97432685 CAAAATGGCTAAAATGAAAATGG - Exonic
1073662346 10:105490514-105490536 CAGAAATTTTAAAATAAACATGG - Intergenic
1074170407 10:110928732-110928754 CAAAAATACAAAAATTAACAGGG + Intronic
1074421768 10:113315419-113315441 CAGCATTGCTGAAATCAACGTGG + Intergenic
1075605518 10:123802827-123802849 AAGAATGGCTAAAATAAAAAAGG - Intronic
1076211665 10:128651742-128651764 TAGAATGGCTAAAATTAAAAAGG + Intergenic
1076211799 10:128653653-128653675 CAAAATTGCACAAATTAAAAAGG + Intergenic
1076392753 10:130115754-130115776 CAGAAATACAAAAATTAACCAGG + Intergenic
1077645733 11:3922189-3922211 TAGAATGGCTAAAATAAAAAAGG - Intronic
1077956260 11:7022601-7022623 CAGAATTCTTAAGATGAACAGGG + Intronic
1078847058 11:15127832-15127854 TAGAAATGCAAAAATTAACTGGG + Intronic
1078931670 11:15917091-15917113 TAGGATGGCTAAAATTAAAAAGG - Intergenic
1079526104 11:21390078-21390100 CAGTATGGCTAAAATGAAAAAGG - Intronic
1080100747 11:28456599-28456621 AAAAATTACAAAAATTAACAGGG - Intergenic
1081894253 11:46571271-46571293 TAGAATTTCTAAAAATTACAGGG - Intronic
1082213195 11:49531710-49531732 TAGAAATCCTAAAATTCACATGG - Intergenic
1082985466 11:59166333-59166355 AAGAGTTCTTAAAATTAACATGG + Intergenic
1083515305 11:63252082-63252104 AAAAAATCCTAAAATTAACATGG + Intronic
1083821637 11:65174874-65174896 CAAAATGGCTAAAATGAAAATGG + Intergenic
1084078932 11:66805613-66805635 CAAAAATGCAAAAATTAACTGGG - Intronic
1084496430 11:69506536-69506558 TAGGATAGCTAAAATTAAAAAGG - Intergenic
1085588749 11:77737096-77737118 CAAAATGGCTAAAAATAACCTGG + Intronic
1085659289 11:78348555-78348577 TAGAATGACTAAAATTAAAAAGG + Intronic
1085778392 11:79386715-79386737 CAGAATAGCTAAAATGAACACGG + Intronic
1086667882 11:89506886-89506908 CAGAATGGCTAAGATTAAAAAGG + Intergenic
1086900862 11:92366333-92366355 CAAAATGGCTAAAATGAAAATGG + Intronic
1087001850 11:93428898-93428920 CATAATAGCTAAATTTAAAAAGG - Intronic
1087289911 11:96309436-96309458 CAGGATTGCTAAGATCATCATGG + Intronic
1087507894 11:99051045-99051067 CAGAATAGCATCAATTAACATGG + Intronic
1090004329 11:122987240-122987262 CAGAATTTAAAAAATTAACACGG - Intergenic
1090220097 11:125012724-125012746 CAGAATTTTTATAATTCACAAGG + Intronic
1091700640 12:2658384-2658406 CAGACTGCCTAAAATTAAAATGG + Intronic
1093300400 12:17446273-17446295 AAGACTTGTTAAAATTACCATGG - Intergenic
1093446064 12:19259867-19259889 CAGAATTATAGAAATTAACATGG - Intronic
1093539942 12:20269568-20269590 CAGAACTGCTAACAAAAACAGGG - Intergenic
1094264247 12:28537926-28537948 CATAATTCCTAAAATTAAATGGG + Intronic
1094324202 12:29219047-29219069 CAAAAATGCAAAAATTAACCAGG - Intronic
1094404501 12:30100991-30101013 TAGAATGGCTAAAATTTAAAAGG - Intergenic
1094759239 12:33511003-33511025 CAGACTTTCTAAGACTAACAAGG + Intergenic
1095969283 12:47890786-47890808 CAAAATGGCTAAAATGAAAATGG + Intronic
1096619251 12:52852350-52852372 CAAAAATGCAAAAATTAACCAGG - Intergenic
1097151079 12:56980390-56980412 CAGAAATGCAAAAATTAGCTGGG - Intergenic
1097296666 12:57972585-57972607 AAAAATTACTAAAATTAGCAGGG + Intergenic
1097624855 12:61987721-61987743 CAGAATTGGTAAATTAAATAAGG + Intronic
1097945571 12:65364323-65364345 GAGATTTTCTAAAATTAAAAGGG + Intronic
1099524404 12:83701682-83701704 CAGAATAGCTAAAGTTATCCTGG + Intergenic
1099577411 12:84399018-84399040 AAGAATTGATATCATTAACATGG + Intergenic
1099818067 12:87674044-87674066 CAGAACTGCTAATTTTAACCTGG - Intergenic
1100118364 12:91337904-91337926 AAAAATTTCTAAAATTCACAGGG - Intergenic
1100336954 12:93640661-93640683 CAAAATGGCTAAAATGAAAATGG + Intergenic
1100628728 12:96364417-96364439 CAGAGTGGCTAAAATTTAAAAGG - Intronic
1100801923 12:98241100-98241122 CAGAATTCCGAAACCTAACATGG + Intergenic
1100975720 12:100120539-100120561 TAAAATAGCTAAAATTAAAAAGG + Intronic
1101220881 12:102638753-102638775 TAGAATTGCTAAAATTAAAAAGG + Intergenic
1101361508 12:104031682-104031704 CAAAATGGCTAAAATGAAAATGG - Intronic
1101470219 12:104989110-104989132 TAGAACAGCTAAAATTAAAAAGG - Intronic
1101867952 12:108536582-108536604 CAGAATTAGTAAAATTAGAAAGG + Intronic
1102831027 12:115999826-115999848 TACCTTTGCTAAAATTAACAGGG - Intronic
1104631938 12:130410064-130410086 GAGAATGGCTAAGATTAAAACGG - Intronic
1104715564 12:131013831-131013853 CAGAAATGCTCAAAATAACAGGG - Intronic
1105215580 13:18282596-18282618 GAGAATAGCTAAAATTCACTGGG - Intergenic
1105714550 13:23049359-23049381 CATATTTTCTAAAATTAATATGG + Intergenic
1106569839 13:30916798-30916820 CAAAAAGGCTAAATTTAACAAGG + Intronic
1106714798 13:32376359-32376381 CAAAAATGCAAAAATTAACCGGG + Intronic
1107182419 13:37476585-37476607 CAGAATTTCAATAATTAAGAAGG + Intergenic
1107342687 13:39425550-39425572 TAGAATTGCTAAAATTAGAAAGG - Intronic
1108013682 13:46050548-46050570 CTGAATTTCTAAGATTAAAAAGG + Intronic
1108802182 13:54112269-54112291 CAGAGTTACAAAAATGAACATGG + Intergenic
1109198679 13:59407522-59407544 CAGAATGGCTATTATTAAAAAGG - Intergenic
1109243304 13:59919004-59919026 CAGAAATACTAAAATATACAAGG + Intronic
1109277952 13:60322892-60322914 CAAAATGGCTAAAATAAAAATGG - Intergenic
1109470831 13:62801499-62801521 CAGAAGAACTAAAATTAAAAAGG - Intergenic
1110185806 13:72673666-72673688 CAGAATGCATAAAGTTAACATGG + Intergenic
1110482501 13:75996370-75996392 CAGAATTAGTAAAATAAAGAGGG - Intergenic
1111617360 13:90677260-90677282 CTGAATTACTATAATAAACAAGG + Intergenic
1112160699 13:96864607-96864629 CAGGATGGCTACAATTAAAAAGG - Intergenic
1112642413 13:101291057-101291079 CAGATTTGCTAAAAGCAGCAGGG - Intronic
1112685586 13:101821713-101821735 CAGAATTGCTAAAATTAACATGG - Intronic
1112796206 13:103059130-103059152 CAGAATGGCTATTATTAAAAAGG - Intronic
1112893071 13:104262782-104262804 CAGAATTGCTAGTACTACCATGG - Intergenic
1113645836 13:111994913-111994935 CATAAATGCTACAATTAACACGG - Intergenic
1113710294 13:112459190-112459212 CAGAATGGCTATTATTAAAAAGG - Intergenic
1115723020 14:36183756-36183778 CAGAATGGCTAAAATTAAAAAGG - Intergenic
1116101644 14:40445617-40445639 CAAAATTGTTTAAAATAACATGG + Intergenic
1116190012 14:41652836-41652858 CAGAATGGCTATTATTAAAAAGG - Intronic
1116334248 14:43636949-43636971 AAGAATGGCTAAAATTAAAAAGG + Intergenic
1116377472 14:44221586-44221608 TAGAATGGCTATAATTAAAAAGG + Intergenic
1116446787 14:45020769-45020791 TAGTATTGCTAAATTTTACACGG + Intronic
1117472845 14:56063833-56063855 CAGAATGTCTAAAATTACAAGGG - Intergenic
1117799639 14:59429858-59429880 CAGAATAGCTAAAATAAAAAAGG + Intronic
1118463194 14:66005404-66005426 CAGAATGGCTAAAATTTAAAAGG - Intergenic
1119029252 14:71178790-71178812 CTGAATGGCTAAAATTGAAAAGG - Intergenic
1119178821 14:72590106-72590128 TAGAATGTCTAAAATTAAAAAGG + Intergenic
1120088875 14:80308154-80308176 CAGAATTCCTCAAACTCACAGGG + Intronic
1120185369 14:81388365-81388387 CAGAAATGCTTAAATCATCAAGG - Intronic
1120735117 14:88044052-88044074 AAGACATGATAAAATTAACATGG - Intergenic
1121174567 14:91881352-91881374 CAGACGTGCTACAATTTACAAGG - Exonic
1121468835 14:94136151-94136173 TAGAATGGCTAAAATTTAAAAGG + Intergenic
1122566311 14:102659352-102659374 CAGAATAGCCAAAATAAAAACGG - Intronic
1123131331 14:105987946-105987968 AAGAATCGCTAAAATCACCAGGG + Intergenic
1124384297 15:29193615-29193637 AAGAATTGCTCACATTACCATGG - Intronic
1124840742 15:33239788-33239810 CAGAATAGCTAAAATCATAAAGG + Intergenic
1125156306 15:36590509-36590531 CAGAATTGCCTCAATTAGCAGGG - Intronic
1125568635 15:40696780-40696802 CAGAATAGTTAAAATCAAAAAGG - Intronic
1125570965 15:40717815-40717837 TAGACATGCTAAAATTAACTGGG + Intronic
1125636018 15:41189205-41189227 CAAAAATACAAAAATTAACAGGG + Intronic
1125809589 15:42526594-42526616 TAAAATTGCAAAAATTAAAAAGG - Intronic
1126345278 15:47687107-47687129 CAGAATTCCCAAAAAGAACATGG + Intronic
1128365445 15:66997426-66997448 TAGACTGGCTAAAATTAAAAAGG - Intergenic
1129058600 15:72840892-72840914 AAGAATGGCTAAAATTAAAAAGG - Intergenic
1129506055 15:76082517-76082539 CAGAATTGCAGCAATTAACTTGG + Intronic
1130020184 15:80223720-80223742 CAGAATGGCTGGAATTTACAAGG - Intergenic
1130244860 15:82237477-82237499 CAGAATTGCTAAAATGAAAACGG + Intronic
1130262997 15:82374070-82374092 AAGAATTACAAAAATTAAGAGGG - Intergenic
1130278296 15:82495593-82495615 AAGAATTACAAAAATTAAGAGGG + Intergenic
1130470625 15:84222778-84222800 AAGAATTACAAAAATTAAGAGGG + Intergenic
1130478113 15:84337345-84337367 AAGAATTACAAAAATTAAGAGGG + Intergenic
1130493652 15:84450785-84450807 AAGAATTACAAAAATTAAGAGGG - Intergenic
1130592912 15:85227404-85227426 AAGAATTACAAAAATTAAGAGGG + Intergenic
1131417864 15:92276444-92276466 CACAATTTCTAAAATGAGCAGGG + Intergenic
1131701860 15:94945578-94945600 CAGAGTGCCTAAAATTAAAAAGG - Intergenic
1131841375 15:96441405-96441427 CAAAATGGCTAAAATGAAAATGG + Intergenic
1131956804 15:97745205-97745227 CAAAATTCCAAAATTTAACATGG - Intergenic
1132355164 15:101166155-101166177 AAGAAGTGCTAGAATTTACAGGG + Intergenic
1132408426 15:101559268-101559290 TGGAATGGCTAAAATAAACATGG - Intergenic
1133289324 16:4708355-4708377 CAGAATTTCTAAAAATAACAAGG + Intronic
1134756968 16:16675678-16675700 CAGAATATCCAAAAATAACAGGG - Intergenic
1134757043 16:16676693-16676715 CAAAAATGCAAAAATTAACCAGG - Intergenic
1134989025 16:18682470-18682492 CAAAAATGCAAAAATTAACCAGG + Intergenic
1134989100 16:18683485-18683507 CAGAATATCCAAAAATAACAGGG + Intergenic
1135082874 16:19451441-19451463 CAGAATGGCTTTAATTATCAGGG + Intronic
1135084522 16:19464261-19464283 CAAAAATGCAAAAATTAGCAGGG + Intronic
1136641938 16:31573500-31573522 AAGAATTCCTAAAATTCATATGG + Intergenic
1139160494 16:64501566-64501588 TAGAATGGCTATAATTAAAAAGG - Intergenic
1140270855 16:73465272-73465294 CAGAATGGCTAAAATCTAGATGG + Intergenic
1140421306 16:74821570-74821592 CAGAGTTGCTCAAATTTACTTGG - Intergenic
1143257400 17:5571741-5571763 AAGAAATTCTAAAATTAATATGG + Intronic
1143823256 17:9582327-9582349 CAAAATGGCTAAAATTAAGATGG - Intronic
1143870234 17:9952813-9952835 CAGAATGGCTATAATTAAAAAGG + Intronic
1144837632 17:18165307-18165329 CAGAAGTTCTAAAATGAAAATGG + Intronic
1145409050 17:22639789-22639811 GAGAACTGGTAAAATTAAAATGG - Intergenic
1146782304 17:35685578-35685600 CAAAATAGCTAAAATCCACATGG - Intronic
1147036950 17:37688787-37688809 CACAATTGTTATTATTAACATGG + Intronic
1149510310 17:57235833-57235855 CTGAATTGCACAATTTAACATGG - Intergenic
1150677338 17:67255972-67255994 CAGAAGGGCTTAAATTAAAAAGG + Intergenic
1150760952 17:67961114-67961136 CAGAATTTCTTTAAATAACAAGG + Intronic
1151465527 17:74282459-74282481 AAGAATTGCAAAAATTAGCCAGG - Intronic
1153046619 18:861143-861165 CAGAATTTAAAAAATTAACCAGG - Intergenic
1153990828 18:10398516-10398538 CAGAGTACCTAACATTAACAAGG + Intergenic
1155970108 18:32075098-32075120 CAGAATCTCTGAAATTATCATGG + Intergenic
1156770898 18:40723394-40723416 CAGAATGGCTATTATTAAAAAGG + Intergenic
1156958844 18:42998380-42998402 CAGAATAGCCAAAACTAAAATGG - Intronic
1157352971 18:46907378-46907400 CAGAGTGTCTAAAATTAAAAGGG + Intronic
1158501899 18:58009963-58009985 CAAAAATACAAAAATTAACAAGG + Intergenic
1158823900 18:61192579-61192601 CAGAATGGCTATTATTAAAAAGG + Intergenic
1159788335 18:72742809-72742831 TAGAATTGCTAAGATGACCAAGG + Intronic
1160320251 18:77884593-77884615 CAGAATTCCCAAAAGTAATAAGG + Intergenic
1161439346 19:4281595-4281617 CAAAAATGCAAAAATTAACCAGG + Intronic
1161654185 19:5503589-5503611 CAGAAATTCTAAGATTCACATGG - Intergenic
1163889699 19:19999970-19999992 CAGAAATGGTAAGATAAACAAGG + Intronic
1164967765 19:32500365-32500387 TAGAATTGCTAACATTTGCAGGG + Intergenic
1167704175 19:51068786-51068808 CAGAATAGCAAAAATTAGAAAGG + Intergenic
1167885618 19:52497378-52497400 CAAAAATACTAAAATTAGCAGGG - Intronic
1168561950 19:57391885-57391907 CAGAATTGCTTGAACTAACCTGG - Intronic
925087966 2:1126426-1126448 AAATATTGCTACAATTAACATGG + Intronic
926244931 2:11116073-11116095 CAAAAATACAAAAATTAACAAGG + Intergenic
926565778 2:14471415-14471437 CAGAAATGCAAAAATGAAAAAGG - Intergenic
926600305 2:14835983-14836005 CAGAATAGCTGAAATTAGAAAGG - Intergenic
927237903 2:20893797-20893819 CAGAATGGCTATTATTAAAAAGG + Intergenic
927439514 2:23102864-23102886 CAGAATTGATAAAATGAAAGAGG - Intergenic
927661412 2:24996474-24996496 CAGAATTGGTGAATTTTACAGGG + Intergenic
927800319 2:26092981-26093003 CAGACTGGCTCAAATTAAGAGGG + Intronic
929369634 2:41207010-41207032 GAAAATTGATAAAATTACCAAGG + Intergenic
929485656 2:42351810-42351832 CAGAATAACTAAAATTAGCCAGG + Intronic
929730174 2:44481494-44481516 GAGAATTGCAAAAATAAAAATGG - Intronic
930332661 2:50005872-50005894 CAAAAATGCTAACATTAAAAGGG - Intronic
931153546 2:59601974-59601996 CAGAGTGGCTAAAATTGAAAAGG - Intergenic
931281128 2:60792873-60792895 TAAAAATGCAAAAATTAACAGGG + Intronic
931513514 2:63025791-63025813 CAGAATCTCTAAAATTCCCAAGG - Intronic
931582051 2:63787130-63787152 CAGAATAGCTAAATTTTAAATGG + Intronic
932484198 2:72071810-72071832 TAGAATGACTAAAATTAAAAAGG - Intergenic
932919815 2:75898790-75898812 CAGAATTCTTAAAATTAACAGGG - Intergenic
932934591 2:76087530-76087552 CAGAATTGGTAAGATCATCATGG + Intergenic
933294939 2:80478877-80478899 CAAAAATCCTAAAATTAATATGG - Intronic
933798893 2:85943980-85944002 CAGAATAGCTAAAATGAAAAAGG + Intergenic
934167253 2:89305576-89305598 CACAATTGCTGAAACTAACAAGG - Intergenic
934200022 2:89876868-89876890 CACAATTGCTGAAACTAACAAGG + Intergenic
934298749 2:91764129-91764151 GAGAATAGCTAAAATTCACTGGG + Intergenic
935873536 2:107479381-107479403 AAAAATTGCAAAAATTAACCGGG - Intergenic
935934527 2:108167330-108167352 CTGATTTGCAAGAATTAACAGGG + Intergenic
937553460 2:123124643-123124665 CAGAATTTCTAAAATTACACTGG - Intergenic
937921097 2:127131494-127131516 CTGAATTGGAAATATTAACATGG - Intergenic
938042091 2:128084224-128084246 CAAAAATGCAAAAATTAACCAGG - Intergenic
938143514 2:128814763-128814785 CAGAATGGCTAAGATAAAAATGG + Intergenic
938207112 2:129433283-129433305 CAGAAATGGCAAAAATAACATGG + Intergenic
938393237 2:130921600-130921622 CAGAATGGCTAAAATTAAAAAGG - Intronic
938621525 2:133059510-133059532 AAAAATTACAAAAATTAACAAGG + Intronic
938640117 2:133268852-133268874 AAATTTTGCTAAAATTAACATGG + Intronic
939581769 2:143958362-143958384 TACAATTTCTAAAATTAACCAGG - Intronic
940033657 2:149290762-149290784 CACAAGTGCTAAAAATAAGACGG + Intergenic
940170169 2:150820470-150820492 CAGAAGTGCTAAAATGAAGGTGG + Intergenic
940527483 2:154835264-154835286 AAGCATTTCAAAAATTAACAAGG - Intronic
940890353 2:159029722-159029744 CAAAATTTTTAAAATTAACTGGG - Intronic
940999907 2:160190804-160190826 GAAAATAACTAAAATTAACAAGG - Intronic
941791253 2:169554501-169554523 TAAAATTACAAAAATTAACAGGG + Intronic
942758497 2:179369973-179369995 CAGCACTGCTAGAATGAACAAGG - Intergenic
943148885 2:184084342-184084364 CAGAATGGCTATTATTAAAAAGG + Intergenic
944978091 2:205080799-205080821 CAGAATAGCTAAAATGAAAAAGG - Intronic
945821825 2:214674020-214674042 AAGATTTTTTAAAATTAACATGG + Intergenic
946921125 2:224583715-224583737 CTGAATTCCTAAAATTTAAAAGG - Intronic
947192471 2:227521656-227521678 CTGAATTGGTAAAAGTAACACGG - Intronic
947484126 2:230531452-230531474 GAGAAATGCTAAAACCAACATGG + Intronic
1168982447 20:2018645-2018667 TAGAATGGCTAAAATTAAGAAGG + Intergenic
1169398245 20:5254920-5254942 AAAAATTGCAGAAATTAACAGGG + Intergenic
1169690738 20:8328510-8328532 CAGGATAACTAAAATTAAAATGG - Intronic
1170108130 20:12774275-12774297 AAGAATAGCTAAAATTAAAAAGG + Intergenic
1170259753 20:14390941-14390963 CAGAATGGCTATTATTAAAAGGG + Intronic
1170369127 20:15629271-15629293 TAAAATGGCTAAAATTAACAAGG - Intronic
1170619778 20:17986016-17986038 AAAAAATCCTAAAATTAACACGG - Intronic
1171721387 20:28566872-28566894 CAGAACTACAAAAATTCACATGG + Intergenic
1171785585 20:29461258-29461280 CAGAACTACAAAAATTCACATGG + Intergenic
1171803611 20:29652748-29652770 CAAAATTGCTACAATTAAACTGG - Intergenic
1171862728 20:30415948-30415970 CAGAACTACAAAAATTCACATGG - Intergenic
1173191829 20:40882754-40882776 CAAAAATGCAAAAATTAGCAGGG - Intergenic
1174298443 20:49565502-49565524 CAAAATTTTTAAAATTAACTGGG + Intronic
1174698100 20:52580505-52580527 AAGAAATGCTAAAAATAAAAGGG + Intergenic
1176704974 21:10108563-10108585 AAGAATGGCTAAAGTTAAAAAGG + Intergenic
1177410471 21:20723775-20723797 CAGAATTACAAAAATAAAAACGG - Intergenic
1177965696 21:27724209-27724231 CATATTAGCTAAAATTAAAAGGG - Intergenic
1178999093 21:37438019-37438041 TAGAATGGCTAAAATTAAAAAGG - Intronic
1180294930 22:10925532-10925554 CAGAACTACAAAAATTCACATGG + Intergenic
1180413736 22:12640533-12640555 CAGAACTACAAAAATTCACACGG - Intergenic
1183143418 22:35966508-35966530 CAGAATGACTAAAATGAAAAAGG - Intronic
1183420145 22:37707113-37707135 CAAAAATACAAAAATTAACAGGG + Intronic
1183595730 22:38809088-38809110 AAGCATTGCTAAAAATAAAAAGG - Intergenic
1184099139 22:42332626-42332648 TAAAATTGCAAAAATTAGCAGGG - Intronic
1184416350 22:44353964-44353986 TAAAAATGCAAAAATTAACACGG - Intergenic
1185354238 22:50357049-50357071 CTGAATGGCTAAAAGTAAAAAGG - Intronic
949146926 3:712302-712324 GAGAATTTCTAAAGTTTACATGG - Intergenic
949965145 3:9349331-9349353 CAAAATGGCTAAAATGAAAATGG - Intronic
949996991 3:9625958-9625980 TAGAATGGTTAAAATTAAAAAGG - Intergenic
950641106 3:14348908-14348930 CTGAATTGATTAAATTAAGATGG + Intergenic
950842824 3:15983803-15983825 CAGAATGGCTAGTATTAAAAAGG - Intergenic
951426010 3:22545670-22545692 CAGAATTTCTAATATTAACTTGG + Intergenic
951638066 3:24802028-24802050 TAGGATGGCTAAAATTAAAAGGG - Intergenic
952019794 3:29004245-29004267 TAGAATTACAAAAATTAAGAGGG - Intergenic
952053519 3:29415504-29415526 CAGGATTGCTTTTATTAACATGG + Intronic
952336085 3:32404319-32404341 CAAAATTACAAAAATTAGCAGGG - Intronic
953273168 3:41466538-41466560 CATACATGCTAAAATTAAAAAGG + Intronic
954000094 3:47549758-47549780 TAGAATTGCTCAAATTAAAAAGG - Intergenic
955256190 3:57334039-57334061 CACAATTACTAAAATTAAAATGG + Intronic
957062298 3:75491698-75491720 TAAAAATGCAAAAATTAACAGGG + Intergenic
957558408 3:81790101-81790123 CAGAATGGCTGACATTAACATGG + Intergenic
957698702 3:83680571-83680593 CAGAATGGCTATTATTAAAAAGG + Intergenic
958870827 3:99556892-99556914 AAGAATTAATAAAATTAAAATGG + Intergenic
959126670 3:102298062-102298084 CAGAATTGCTGAAATACAAAAGG + Intronic
959211858 3:103394486-103394508 CAAAAATTCTACAATTAACAAGG - Intergenic
959266264 3:104142834-104142856 CAGAAGAGTTAAAATTAAAAAGG - Intergenic
959513704 3:107242019-107242041 CAGAATAGACAAAACTAACAGGG - Intergenic
960454115 3:117849371-117849393 AAGAAATTCTAAAATTAACTAGG + Intergenic
962319767 3:134380980-134381002 CAGAAGGGTTAAAATTAAAAAGG - Intergenic
962446456 3:135470254-135470276 CAGAACTGCTGATATTAAAAGGG - Intergenic
962448718 3:135493315-135493337 TAGAATTGCAAAAATGAATAAGG - Intergenic
962926942 3:140003060-140003082 AAGAAATGCTAAAATTTATATGG - Intronic
963189814 3:142456748-142456770 TAGAATGGCTAAAATAAAAAAGG + Intronic
963373197 3:144428228-144428250 CAGAAATACTAAACTTTACATGG + Intergenic
963439355 3:145317284-145317306 AAAAATTCCTAAAATTTACATGG - Intergenic
963611788 3:147477702-147477724 CAGAATGGCTAAAATTGAAAAGG - Intronic
963617921 3:147567074-147567096 AAGAAATTCTAAAATTAATATGG + Intergenic
963963390 3:151335895-151335917 CAGAAATGCTAATAGTAATATGG - Intronic
964237628 3:154551825-154551847 AAGAATTCTTAAAATTAAAAGGG + Intergenic
966049362 3:175594677-175594699 CAGTATGGCTATAATTAAAAAGG - Intronic
966987656 3:185196839-185196861 CAGAAATGCAAAAATTAGCCAGG + Intronic
967132289 3:186483036-186483058 CAAAATTGCTAAAAAAAAAAAGG - Intergenic
972106052 4:35489011-35489033 CAGAATTGATTAAATTTTCAAGG + Intergenic
972914224 4:43856329-43856351 CAGAATTTCTAAAAGTATTAAGG + Intergenic
973222783 4:47747921-47747943 CAGATTTGCTAAATTTCAAAAGG + Intronic
974074872 4:57159333-57159355 CACAATTGTTAAAATTAAGAAGG - Intergenic
975489860 4:74976398-74976420 TAGAATTGCTGAAATTCCCAGGG - Intronic
975523316 4:75323387-75323409 AAGAATTGCTAACAATTACATGG + Intergenic
975768025 4:77689894-77689916 CATAATTGCTAACAATAAAAAGG + Intergenic
975920047 4:79374824-79374846 CAGAATGGCTAAAATTAAAAAGG - Intergenic
975932478 4:79542020-79542042 CAGAATGGCTAAAATTTAAAAGG - Intergenic
976056907 4:81079836-81079858 CAGAATAGCTATTATTAAAAAGG + Intergenic
976785941 4:88821145-88821167 CACAAATGCTTAAATTCACAAGG + Intronic
977307832 4:95347401-95347423 AAAAAATGCTAAAATTTACATGG + Intronic
977364183 4:96045942-96045964 CACAATATCTAAAATTAATATGG - Intergenic
977377555 4:96225788-96225810 TAGAATGTCTAAAATTAAAATGG + Intergenic
977674081 4:99728980-99729002 CATATTGGCTAAAATTAAAAGGG - Intergenic
977755301 4:100663547-100663569 CAGAATGGCTAAAATGAAGTAGG - Intronic
978167924 4:105631234-105631256 GAGAATGACTAAAAATAACATGG + Intronic
978585370 4:110270981-110271003 AAGAATTGCTTAAATTCACATGG + Intergenic
978916798 4:114135651-114135673 CAGAATTGTGGAAATTAACAAGG + Intergenic
979159666 4:117443827-117443849 AAGAAATTCTAAAATTCACATGG - Intergenic
979929452 4:126612368-126612390 CAAAACTGCAAAAATTAGCAGGG - Intergenic
980234031 4:130080470-130080492 AGGAATTGCTAAAAATAAAAAGG - Intergenic
980377184 4:131964952-131964974 AAGAATGGCTAAAGTTAAAAAGG + Intergenic
980882560 4:138727469-138727491 CAGAATTATTAAAACTAGCAAGG - Intergenic
981203350 4:142009982-142010004 AAAAATTCCTAAAATTTACATGG - Intergenic
981215814 4:142165893-142165915 CAGAACAGCTAAAATCAAAAAGG - Intronic
981445042 4:144826129-144826151 CAGAATGGCTAAAATTGAAATGG + Intergenic
981960937 4:150538103-150538125 CAGAATGGCTATTATTAAAAAGG + Intronic
982680547 4:158423741-158423763 CGGATTGGCTAAAATTAAAAAGG - Intronic
983259354 4:165438648-165438670 CAAAGTCACTAAAATTAACATGG + Intronic
983813153 4:172089479-172089501 TGGAATTACTAAAATTAAAATGG - Intronic
984129971 4:175862761-175862783 CAGAATTGCTCGAATGAAAATGG - Intronic
984213728 4:176881809-176881831 AAAAATTGGTAAAATTAAAAAGG - Intergenic
984380287 4:178984390-178984412 CCGAATTGCAAAAATTAGTAAGG + Intergenic
984671421 4:182492598-182492620 CAGTATTTCTAAAAATAGCAGGG - Intronic
985046427 4:185945609-185945631 AAGAATTTCTAAAATGAAAAGGG - Intronic
985244642 4:187968008-187968030 CAGAATAGGTAATATTACCAGGG + Intergenic
986984984 5:13490599-13490621 AAGAATTGATATAATTAAAATGG - Intergenic
987547136 5:19325833-19325855 CACAATTGCTAAGACTCACAGGG - Intergenic
987651261 5:20743211-20743233 CAAAAATACAAAAATTAACAGGG + Intergenic
987996346 5:25285795-25285817 CAGAATAGCTAAAAAGAATACGG + Intergenic
988134011 5:27145365-27145387 CAGAGTTGCTAAAATTTACAGGG - Intergenic
988198245 5:28035612-28035634 TAGAATGGCTAAAATTAAATAGG - Intergenic
988392223 5:30649464-30649486 AAGAATGGCTAAAATTTAAAAGG + Intergenic
988423027 5:31029689-31029711 CAGAAGTACTAACATGAACATGG + Intergenic
988983714 5:36596802-36596824 CACAATTGCTAACATTCACAAGG - Intergenic
989112639 5:37921693-37921715 AAGAATGGCTAAAATTAAACAGG - Intergenic
989118883 5:37983576-37983598 CTGAATTCCTAAAAGGAACAGGG - Intergenic
989173498 5:38496814-38496836 CAAAAATACTAAAATTAACCAGG + Intronic
989975898 5:50586565-50586587 CAGAATTTCAAAAGTTAAAAAGG + Intergenic
990089431 5:52023681-52023703 GAAAATTGTTAAAATTCACAAGG + Intronic
990093240 5:52082085-52082107 CAAAATAGCTAAAAATAAGAAGG + Intergenic
990359002 5:54998585-54998607 CAGAAATACAAAAATTAACGGGG + Intronic
991586390 5:68206394-68206416 TAGAATGGCTAAAATTATAAAGG - Intergenic
993915036 5:93733985-93734007 CAGACTTGGTATAATAAACAAGG + Intronic
994349058 5:98723447-98723469 GAGAATAGCTAAAATTTACTAGG + Intergenic
994929917 5:106168700-106168722 CAGAACAGTTAAAATTAAAAAGG - Intergenic
995381544 5:111540381-111540403 CAGAATGGCTATTATTAAAAAGG + Intergenic
996043864 5:118848584-118848606 CAGAGTAGCTAAAATAAAAAAGG + Intronic
996809825 5:127504439-127504461 CAGTATTAATAAAATTAAAAAGG + Intergenic
997688280 5:135805343-135805365 CATAATTCCTAATATCAACATGG + Intergenic
998931808 5:147189467-147189489 CATAATTGGGAAAATTATCAAGG + Intergenic
1000068219 5:157715270-157715292 CACAATAGCTAAAATGAAGAAGG - Intergenic
1000120069 5:158188863-158188885 CAGAATACTTAAAATCAACAGGG + Intergenic
1000681891 5:164195442-164195464 CAAAATTGCTAACATGATCATGG + Intergenic
1001376012 5:171259187-171259209 CAGAATGGCTATTATTAAAAAGG + Intronic
1001760707 5:174205765-174205787 CAGAAGTCCTAACATTATCAAGG + Intronic
1002143550 5:177160673-177160695 GAAAATTGCTAACATTAACTGGG + Intronic
1002506755 5:179684643-179684665 CACTATGGCTAAAATTAAAAAGG - Intronic
1003037007 6:2650350-2650372 TAGAATGGCTAAAATTTAGAAGG + Intergenic
1003807424 6:9741032-9741054 CAGAATGGCTATTATTAAAAAGG - Intronic
1004103490 6:12640643-12640665 CAGGATAGCTAAAATTAAAAAGG - Intergenic
1005366007 6:25077673-25077695 CAGAATGGCTAACATGAAAAAGG - Intergenic
1005576229 6:27191938-27191960 CACATTTGCTAAAGTTAAAAAGG + Intergenic
1005702425 6:28415323-28415345 CAGGATTGCAAAGATAAACATGG - Intergenic
1007057379 6:38900902-38900924 CAGAATTGCTAAAATCGGCCAGG - Intronic
1007188001 6:39988846-39988868 CAGATTTTAGAAAATTAACATGG - Intergenic
1008446402 6:51597507-51597529 AAAAAATCCTAAAATTAACATGG + Intergenic
1010178404 6:73055980-73056002 CAAAATGGCTAAAATGAAAATGG - Intronic
1010481216 6:76356618-76356640 CAGCATTGTAAAAATTAACTTGG - Intergenic
1010895156 6:81352692-81352714 CAGAATGGCTAATATTAAAAAGG - Intergenic
1011091121 6:83601216-83601238 CAGGATTGCTAAAATTACTTGGG - Intronic
1011767484 6:90638587-90638609 CAAAATAAGTAAAATTAACAAGG - Intergenic
1014009871 6:116462885-116462907 CAGAATTGTTAGAATTAAAGGGG + Intronic
1014100098 6:117502212-117502234 CAGAATTAGTGAAATTTACATGG - Intronic
1014493322 6:122089438-122089460 CAGCATTGCCAGAATAAACAGGG + Intergenic
1014535227 6:122606409-122606431 CAAAAATGCAAAAATTAGCAGGG + Intronic
1014578519 6:123105186-123105208 AAGAATTTCTAAAATTCATATGG - Intergenic
1015395763 6:132732698-132732720 CAAAATTTCTAAAATTCATATGG + Intronic
1016170103 6:141003433-141003455 CAGATTTGCCAAAATTGTCAAGG - Intergenic
1016471758 6:144382028-144382050 CAGAATGGCTATTATTAAAAAGG - Intronic
1017386785 6:153894869-153894891 CAAAATTGCTACAATTAAACTGG + Intergenic
1017562306 6:155641798-155641820 CAGCAAAGCTAAAATTAAGAAGG - Intergenic
1017698873 6:157048134-157048156 CTGACTTGCAAAAATTGACATGG - Intronic
1017823132 6:158063210-158063232 CATAATTGCTATAAATAACAAGG + Intronic
1018163594 6:161072250-161072272 CTAAATTTCTAAAATAAACATGG - Intronic
1018293856 6:162323719-162323741 CAGAATGTCTAAAATTAAAAAGG + Intronic
1019483889 7:1279108-1279130 CTGAATTGCTGAATTTAAAATGG + Intergenic
1019585375 7:1799230-1799252 CAGAATGGCTAAAATGAAAAAGG + Intergenic
1020406723 7:7843869-7843891 CATAATTGCAAAAACTAACAGGG + Intronic
1020582772 7:10026419-10026441 CAGAATGGCTATTATTAAAAAGG - Intergenic
1020720470 7:11738516-11738538 GAGAATTCCAAAACTTAACATGG - Intronic
1020736946 7:11962557-11962579 CAGGTTGGCTAAAATTAAAAGGG - Intergenic
1021878143 7:25067648-25067670 CAGAATTTCTTTAAATAACAAGG - Intergenic
1022224310 7:28347073-28347095 AAGATTTGCTAGAATGAACAGGG - Intronic
1022607648 7:31832075-31832097 CTGAATTGATAAAAATAAAAAGG + Intronic
1022623664 7:32011644-32011666 TAGAATGGCTAAAATTAAAAAGG + Intronic
1022827174 7:34026621-34026643 CAGAGTTACTAAAATGAAAATGG + Intronic
1023023979 7:36034901-36034923 CAGAAATACTAAAATTAGCCAGG + Intergenic
1023689366 7:42770341-42770363 TAGAATAGCTAAAATTAAAAGGG + Intergenic
1024952966 7:54884198-54884220 TAGAATGGCTAAAATTAAATAGG - Intergenic
1026021487 7:66710556-66710578 TAGAATGGCTAAAATTAAAAGGG - Intronic
1026412560 7:70139838-70139860 CAAAAATGCCAAAATTAACTGGG + Intronic
1026885951 7:73945497-73945519 TAGAATGGCTAAAATTAAAAGGG - Intergenic
1027279697 7:76598715-76598737 CAGAATAGCTATTATTAAAAAGG + Intergenic
1027598374 7:80205962-80205984 CAGAATTTCTAAAATCATCTTGG + Intronic
1027721284 7:81744727-81744749 CAGAGTTTCTAAAATCAGCATGG - Intronic
1027738486 7:81967270-81967292 CAGAATTTCTAATTATAACATGG - Intronic
1028031385 7:85918497-85918519 CAAAATGGCTAAAATAAAAAGGG - Intergenic
1028067485 7:86405544-86405566 CAGAATAGCTATTATTAAAAAGG + Intergenic
1028185529 7:87780972-87780994 AAGAAATTCTAAAATTAATATGG - Intronic
1030473956 7:110004079-110004101 CAGATTTGCTGAAATAAACCAGG - Intergenic
1030876752 7:114822756-114822778 CTCAAATGCTAAAGTTAACAGGG - Intergenic
1031767370 7:125798416-125798438 TAGAATGGCTAAAATTATAAAGG - Intergenic
1032570969 7:132996568-132996590 CAGAGTTGCTAAAATTGAGAAGG + Intronic
1033592709 7:142826409-142826431 CAGATTTGCTAAAACTATAAAGG + Intergenic
1034777703 7:153846160-153846182 TAGAATGGCTAAAATTAAAATGG - Intergenic
1035152943 7:156890658-156890680 TAGAATGACTAAAATTAAAAAGG + Intronic
1036109779 8:5885314-5885336 CAAAATGGCTAAATGTAACATGG + Intergenic
1036533769 8:9624211-9624233 CAGAGTTGCTATAATTTACTAGG - Intronic
1037428815 8:18787772-18787794 CAGAAATGATAAATTTATCAAGG - Intronic
1037458829 8:19088713-19088735 CAGAATAGCTATTATTAAAAAGG - Intergenic
1038297286 8:26306010-26306032 CAGAATTACAAAAATTAGCTGGG + Intronic
1038513650 8:28164387-28164409 GAGACTTGCTCAAATTAACAGGG + Intronic
1039607175 8:38890886-38890908 CAGCATGGCTAAAATGAAAAAGG - Intergenic
1039889722 8:41676260-41676282 AAGAATGGTTAAAATTAAAAAGG - Intronic
1040701209 8:50068311-50068333 AAGAAAAGCTACAATTAACAAGG - Intronic
1041134912 8:54747738-54747760 CAGAAATGCAAAAATTAGCTGGG + Intergenic
1042033850 8:64508299-64508321 TAGAATAGCTAAAATTAAAAGGG + Intergenic
1042556320 8:70036308-70036330 CAAAATTACAAAAATTAACCAGG + Intergenic
1042594177 8:70428081-70428103 AAAAATTGAGAAAATTAACATGG + Intergenic
1042898984 8:73702858-73702880 TAGAATGGCTAAAATTAGAAAGG + Intronic
1043135686 8:76521052-76521074 CAGAATGGCTATCATTAAAAAGG - Intergenic
1043172950 8:76988031-76988053 CATAAGTGCTAAAATCAAGAAGG + Intronic
1043322935 8:79012834-79012856 CAAAAATTCTAAAATTTACATGG - Intergenic
1043361505 8:79477925-79477947 TAGAATAGCTAAAACTAAAAAGG + Intergenic
1043421553 8:80103707-80103729 CAGAAATGTTAAAATGAACTTGG - Intronic
1043500844 8:80853494-80853516 CAGAACTGCTAAAATAATCTTGG - Intronic
1044099040 8:88107285-88107307 AAGACTTGATAAAATTAAAATGG - Intronic
1044249762 8:89992302-89992324 CAGAATTGCTATAGGTAACCTGG - Intronic
1044287391 8:90424889-90424911 AAAAAATGCTAAAATTTACATGG - Intergenic
1044759378 8:95501671-95501693 CAGAATAGCTAAAATAAAAATGG + Intergenic
1044908870 8:97035536-97035558 AAGAATGGCTAAAAATAAAAAGG - Intronic
1045922404 8:107546852-107546874 CAGAATAGCTATTATTAAAAAGG + Intergenic
1045951986 8:107862688-107862710 AACAATTCCTAAAATTCACATGG - Intergenic
1046099925 8:109602592-109602614 CAAAAATGCAAAAATTAACCGGG - Intronic
1046196389 8:110868393-110868415 GAGAATACCTAAAATTAAAATGG - Intergenic
1046975433 8:120270692-120270714 CAGAATGGCTATTATTAAAAAGG + Intronic
1047055429 8:121159406-121159428 CAGCATTGCTAATATTCAGAAGG - Intergenic
1047776340 8:128073838-128073860 CAGAGATGCTAAAAATAACTAGG + Intergenic
1048294092 8:133201680-133201702 AAGAAATGCAAAAATTAGCAGGG + Intronic
1048565720 8:135594710-135594732 TAGAATGACTAAAATTAAAAAGG + Intronic
1048674021 8:136756688-136756710 CATTATTTCTAAAATTGACAAGG - Intergenic
1049735293 8:144201926-144201948 CAGAATTGCTTAAACTCAGAAGG + Intronic
1050442234 9:5677198-5677220 CAGAATGACTAAAATTAAAAAGG - Intronic
1051172719 9:14335363-14335385 TAGAATGGCTAAAAATAAAAGGG - Intronic
1052269280 9:26609546-26609568 CAGAAATGCTAAAGGAAACAGGG + Intergenic
1052882433 9:33611537-33611559 CAGAATTGCTAAAATGAAAAAGG - Intergenic
1053038067 9:34842893-34842915 TAGAATGGCTAAAATTAAAAAGG - Intergenic
1053282277 9:36828259-36828281 CAGGAATGCTACATTTAACATGG + Intergenic
1053493929 9:38534695-38534717 CAGAATTGCTAAAATGAAAAAGG - Intergenic
1053558392 9:39162304-39162326 CAGAATTGCTATTATTTAAAAGG + Intronic
1053560190 9:39184425-39184447 CAGAAAGGCTAAAATTAAAAAGG - Intronic
1053642235 9:40095628-40095650 AAGAATGGCTAAAGTTAAAAAGG + Intergenic
1053763904 9:41369837-41369859 AAGAATGGCTAAAGTTAAAAAGG - Intergenic
1053822507 9:41982529-41982551 CAGAATTGCTATTATTTAAAAGG + Intronic
1053824298 9:42004667-42004689 CAGAAAGGCTAAAATTAAAAAGG - Intronic
1054136928 9:61434530-61434552 CAGAAAGGCTAAAATTAAAAAGG + Intergenic
1054138722 9:61456638-61456660 CAGAATTGCTATTATTTAAAAGG - Intergenic
1054323128 9:63693018-63693040 AAGAATGGCTAAAGTTAAAAAGG + Intergenic
1054542515 9:66281017-66281039 AAGAATGGCTAAAGTTAAAAAGG - Intergenic
1054606276 9:67182696-67182718 CAGAAAGGCTAAAATTAAAAAGG + Intergenic
1054608069 9:67204837-67204859 CAGAATTGCTATTATTTAAAAGG - Intergenic
1054898631 9:70342773-70342795 CAGAGTTGGTAAAATGGACAAGG - Intronic
1055131177 9:72776904-72776926 CAGAATTTTTAAAAATAAAAAGG - Intronic
1055748422 9:79476322-79476344 AAGAATTGCTGACATTAGCAAGG - Intergenic
1055943812 9:81674849-81674871 CAGAATTCTTAAAATGTACATGG + Intronic
1055992279 9:82119687-82119709 GAGAATTGTAAAAATTTACATGG + Intergenic
1056257003 9:84810010-84810032 AAGATTTGCTAAAATTAGCTGGG + Intronic
1056645716 9:88409899-88409921 CTGAATTGCTGAACTTAAGAAGG - Intronic
1057674666 9:97129521-97129543 CAGAATTGCTAAAATGAAACAGG - Intergenic
1057713073 9:97464708-97464730 CAGACTTGCTTATATCAACAGGG - Intronic
1058631462 9:106992312-106992334 TAGCATGGCTAAAATTAAGAAGG + Intronic
1058708985 9:107662622-107662644 CAGAATAGCTAAAATTAAAAAGG - Intergenic
1058830969 9:108816076-108816098 CAGAATGGTTAACATTTACATGG + Intergenic
1059203629 9:112442789-112442811 CAGATTTGCTAAAGGTATCAAGG - Intronic
1059716328 9:116916677-116916699 AAAAATTACTAAAATTAACTAGG + Intronic
1060709860 9:125849566-125849588 CAGAAATGCTAAAATGAGGAGGG - Intronic
1060784736 9:126442109-126442131 CAGAATTGTTAAAATACATAGGG - Intronic
1062132143 9:134902876-134902898 TAGAGTTGCTAAAAGTAAAATGG + Intergenic
1202790005 9_KI270719v1_random:78662-78684 AAGAATGGCTAAAGTTAAAAAGG + Intergenic
1202801812 9_KI270720v1_random:6654-6676 CAGAACTACAAAAATTCACACGG + Intergenic
1203446357 Un_GL000219v1:60401-60423 CAGAACTACAAAAATTCACATGG + Intergenic
1185781803 X:2854380-2854402 CAGAAATACAAAAATTAACCGGG - Intronic
1186002582 X:5029550-5029572 CAGAATTGTGAGAATTAAGAAGG + Intergenic
1187196026 X:17084574-17084596 TAGGATGGCTAAAATTAAAAAGG - Intronic
1187263307 X:17707355-17707377 CAGACTTGATAAAATTAGCCAGG + Intronic
1187282690 X:17871248-17871270 TAGAATGGCTAAAATAAAAATGG - Intergenic
1187405386 X:18999533-18999555 CAGAGTTGCTAGGATTTACAGGG - Intronic
1187802991 X:23085815-23085837 CAGAATGGCTAAAATTCAAAAGG - Intergenic
1187926677 X:24257208-24257230 CAGAATGGCTAAAAATAAAAAGG - Intergenic
1188115934 X:26242572-26242594 TAGAATGGCTAAAATTAAAAAGG - Intergenic
1188180808 X:27053359-27053381 TAGAATAGCTAAAATTGAAATGG - Intergenic
1188208598 X:27391748-27391770 CAGAATGGCTATTATTAACAAGG + Intergenic
1188849611 X:35115669-35115691 TAGAATTACAAAAATTAAAAGGG + Intergenic
1189444588 X:41068768-41068790 CAGAATGGCTATTATTAAAAAGG - Intergenic
1189525875 X:41821385-41821407 CAGAATGGCTAAAATTAAAAAGG + Intronic
1190793752 X:53722628-53722650 TAGAATGACTAAAATTAAAAAGG - Intergenic
1191703270 X:64065674-64065696 CAGAATGGCTATTATTAAAAAGG - Intergenic
1193135673 X:77968713-77968735 CAAAATGGCTAAAATGAAAATGG + Intronic
1193674984 X:84439078-84439100 CAGAATAGCAATAATTAAAAAGG - Intronic
1193777998 X:85667728-85667750 CAGAATGGCTAAAATTAAAATGG - Intergenic
1194475321 X:94351636-94351658 TAGAATTGCTAAAACTATCCTGG + Intergenic
1194876216 X:99191516-99191538 CAGAATTCCTCAAATCAAAATGG - Intergenic
1196038320 X:111172244-111172266 CAGAATGGCTAAAATTAAAAAGG - Intronic
1196129210 X:112135225-112135247 GAGAATGCCTAAAATTAAAAAGG - Intergenic
1196234785 X:113266225-113266247 AAAAATTACTAAAATTTACATGG + Intergenic
1196282851 X:113843885-113843907 CAGAATATCTAAAATTAAGAAGG - Intergenic
1196535830 X:116842850-116842872 CAGAAATGCAAAACTTAACAAGG + Intergenic
1196610167 X:117704858-117704880 CAATATTTCTATAATTAACATGG + Intergenic
1196939816 X:120763893-120763915 CAGAATGGCTAAAATTAAGAAGG - Intergenic
1197374771 X:125669012-125669034 CAGAATGGCTATTATTAAAAAGG + Intergenic
1197564968 X:128071945-128071967 CAAAAATCCTAAAATTAATATGG - Intergenic
1198119419 X:133577605-133577627 CAGCATTCTTAAAATTAAAAGGG - Intronic
1198127857 X:133663981-133664003 CAGAATTTCTTTAAATAACAAGG - Intronic
1198174069 X:134137461-134137483 CAGGAGTGATAAAATTATCATGG + Intergenic
1198315905 X:135465916-135465938 CAGAATAGCCAAAATTATCCTGG + Intergenic
1198844191 X:140892227-140892249 CTAAATGGCTAAAATTAAAATGG - Intergenic
1198959273 X:142167129-142167151 AAAAATTGCTGAAATTAAAATGG + Intergenic
1199005490 X:142691756-142691778 CAGAATGGCTATCATTAAAAAGG + Intergenic
1199152323 X:144501598-144501620 CAAAATTTCTAAAATTAAATTGG + Intergenic
1199289211 X:146087687-146087709 CAGGGTTGATAAAATTACCAGGG - Intergenic
1199394445 X:147318218-147318240 CAAAAATACTAAAATTAGCAGGG + Intergenic
1199494157 X:148434560-148434582 CAGAATGGCTAAAATTAAGAAGG + Intergenic
1199747892 X:150786130-150786152 CAGAATAACTAAAATTTAAAAGG - Intronic
1199927402 X:152481357-152481379 CAGAATTCCCAAAAGAAACAAGG + Intergenic
1200298747 X:154950376-154950398 CAGAATGGCTAAAATTAAAAAGG - Intronic
1201471727 Y:14342188-14342210 CACCATTGCTGAAATTCACAAGG - Intergenic
1201978214 Y:19876222-19876244 GTAAATTGCTAAAATAAACATGG - Intergenic