ID: 1112688935

View in Genome Browser
Species Human (GRCh38)
Location 13:101867003-101867025
Sequence CTGGAGAATCAGAAGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 903
Summary {0: 1, 1: 0, 2: 7, 3: 107, 4: 788}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112688930_1112688935 5 Left 1112688930 13:101866975-101866997 CCAAAGGGGAGGCCTGGAAGCCA 0: 1
1: 0
2: 1
3: 27
4: 261
Right 1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG 0: 1
1: 0
2: 7
3: 107
4: 788
1112688932_1112688935 -7 Left 1112688932 13:101866987-101867009 CCTGGAAGCCAAGCAACTGGAGA 0: 1
1: 0
2: 1
3: 38
4: 912
Right 1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG 0: 1
1: 0
2: 7
3: 107
4: 788
1112688929_1112688935 8 Left 1112688929 13:101866972-101866994 CCACCAAAGGGGAGGCCTGGAAG 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG 0: 1
1: 0
2: 7
3: 107
4: 788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112688935 Original CRISPR CTGGAGAATCAGAAGGAAGA AGG Intronic
900919172 1:5659831-5659853 CTGGAGGATCCGATGGCAGATGG - Intergenic
901775332 1:11556726-11556748 CCGCAGAATCAAAAGGAGGATGG + Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903056153 1:20637651-20637673 CTGAATAATGAGAAAGAAGATGG + Intronic
903651768 1:24926939-24926961 CTTGAGCAGCAGAAGGAAGGCGG - Intronic
903751949 1:25628749-25628771 TTGGAGACTCAGAAGGGGGAGGG - Intronic
903870771 1:26432806-26432828 CTGGGGAATCAGATGGACTATGG - Intronic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904383640 1:30127737-30127759 CTAAAGAATCAGAAGGAGCATGG - Intergenic
904773115 1:32892107-32892129 CTGGAGAATCTGAAGGGCCAGGG + Intronic
905035247 1:34913990-34914012 AGGGAGAATAAGAAGGAAAAAGG + Intronic
905068114 1:35201099-35201121 CTGGAAAATAGGAAGGAGGAAGG - Intergenic
905794355 1:40807274-40807296 CTGGAGAGTCACAAGGCGGAAGG + Intronic
906056669 1:42923500-42923522 GTGGAGAATGAGGAGGAAGCAGG + Intergenic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
906736161 1:48130938-48130960 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
906834055 1:49063843-49063865 CTGGAGGAACAGAAGCAACAGGG - Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908086184 1:60636630-60636652 CTGGAGAGAGGGAAGGAAGAAGG + Intergenic
908185533 1:61649322-61649344 CTGGAAAATCATTAGGAGGAAGG - Intergenic
908256669 1:62308897-62308919 CAGGAGAATCAGAAGTCAGGGGG - Intronic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
908805573 1:67927802-67927824 CTAGAGAATACGAAGGGAGAAGG - Intergenic
908959377 1:69676936-69676958 CTGGAGACTCAGAAGGGAAAGGG - Intronic
909053964 1:70800837-70800859 CTGAAGATTCAGAAGGAGCAGGG - Intergenic
909339141 1:74511996-74512018 AAGGAAAATCGGAAGGAAGAGGG + Intronic
910449807 1:87333748-87333770 TTGGAAAATCAGCAGGAACATGG + Intronic
910754885 1:90678636-90678658 ATGGAAAATCACAAGGAACAAGG + Intergenic
911721922 1:101200452-101200474 ATAGGGAATAAGAAGGAAGATGG + Intergenic
912228783 1:107767934-107767956 CTGGTAAATCATAAGGAAGTAGG + Intronic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
913008641 1:114660456-114660478 CTGGACATTCAGAAGAAAGCAGG + Intronic
913049400 1:115103794-115103816 CTGTAGCAACACAAGGAAGAAGG - Intergenic
913070567 1:115294704-115294726 CTGGAGGATGAGAAGGAATGAGG + Intronic
913232648 1:116754518-116754540 ATTGAAAATCAGAAGGAAGCTGG - Exonic
913473779 1:119217184-119217206 CTGGACAAGCAGAATGATGATGG - Intergenic
913487797 1:119349378-119349400 TTGGAAAATCAGAAAGAAAAAGG + Intergenic
913610215 1:120503506-120503528 CTGGAGAAGCAAACAGAAGAAGG - Intergenic
913984585 1:143553333-143553355 CTGGAGAAGCAAATAGAAGAAGG + Intergenic
914390271 1:147215001-147215023 CAGGATGATCAGAAGGCAGAAGG + Intronic
914506904 1:148297249-148297271 CTGCAGATACAGTAGGAAGATGG - Intergenic
914580975 1:149018733-149018755 CTGGAGAAGCAAACAGAAGAAGG + Intronic
915076281 1:153310618-153310640 CTGGAGACCCAGAATGAAGAAGG + Exonic
915356616 1:155258913-155258935 CTGGACAAAAAGAAGGTAGAGGG + Exonic
915447424 1:155981885-155981907 CTGGAGAATCTGAAAGCTGATGG - Intronic
915565482 1:156710504-156710526 CTGGAGTTTCTGGAGGAAGAAGG + Intergenic
915694891 1:157729888-157729910 TTGGAGACTCAGAAGAAGGAGGG + Intergenic
915938559 1:160103623-160103645 CTAGGGAAACAGGAGGAAGAAGG - Intergenic
915983804 1:160442925-160442947 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
916141463 1:161702913-161702935 CTGAAGACTCAGAACCAAGAGGG - Intergenic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916282389 1:163066148-163066170 ATGGAGCCTCAGAAGGATGAGGG - Intergenic
916403158 1:164470455-164470477 CTAGAGAATAAGCAGTAAGAAGG - Intergenic
916636847 1:166680054-166680076 ATGGAGACTGAGAAGGAGGAGGG - Intergenic
916849575 1:168689820-168689842 CTGGAGAAACAGAAGGCATTAGG - Intergenic
917004484 1:170397795-170397817 CTGGATTATCATAAGGAAAATGG + Intergenic
918091315 1:181297479-181297501 CTGAAGCATCAGAAGGGAGGGGG + Intergenic
918386423 1:184012929-184012951 CTGGAGATTCAAAAAGAAGAGGG + Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918566880 1:185944302-185944324 TTGAAGACTCAGAAGGGAGAGGG + Intronic
918708686 1:187700855-187700877 CTGTAGAATGAGAACAAAGAAGG + Intergenic
918809284 1:189094445-189094467 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
918928876 1:190826700-190826722 ATGGAGATTCAGAAGGGTGAGGG + Intergenic
919211611 1:194494144-194494166 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
919354019 1:196498431-196498453 TTGCAGAATTAGAAGAAAGAGGG - Intronic
919842569 1:201619826-201619848 CTGGAGAAGCAGAGGCAAGCTGG + Intergenic
919936291 1:202252850-202252872 CTTGAAAGTCAGAGGGAAGAAGG + Intronic
920089686 1:203443413-203443435 TTGCAGAATCAGGAGGAAAAGGG - Intergenic
920611143 1:207438966-207438988 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
920612861 1:207458631-207458653 CTGAAGGACAAGAAGGAAGAAGG - Intronic
921132023 1:212227985-212228007 AAGGAGAATGCGAAGGAAGAAGG - Intergenic
921417658 1:214909254-214909276 CAGGAGGAAGAGAAGGAAGAAGG + Intergenic
921565727 1:216716115-216716137 GTGGAGAATCCAAAGGAACACGG - Intronic
921728779 1:218553527-218553549 CAGGAGACTCAAAGGGAAGAGGG - Intergenic
921842768 1:219846282-219846304 CAGGAGGATTAGGAGGAAGATGG + Intronic
921858871 1:220019422-220019444 CATGAGAATCAGAAAAAAGATGG + Intronic
922015121 1:221637496-221637518 CTGGAGAAATAGTAGGAAGTGGG - Intergenic
922353177 1:224751936-224751958 CTGATGAACCAGAAGAAAGATGG + Intergenic
922367332 1:224878289-224878311 CTTGGGAATAAGGAGGAAGAGGG - Intergenic
922647199 1:227300658-227300680 GTGGAGACTCAGAAGGGAGAAGG + Intronic
923388185 1:233486680-233486702 CTTGAAAATCAGAAGGAAGATGG - Intergenic
923640791 1:235758294-235758316 CTGGGGTAGCAGAAGGAAAATGG + Intronic
923806028 1:237258956-237258978 CTGGCCAAGCAGAAGGCAGAAGG - Intronic
923809356 1:237295293-237295315 CAGGAAAGTCAGAAGGAGGAAGG + Intronic
924108113 1:240669712-240669734 ATGGAGACTCAGAAGGGTGAAGG - Intergenic
1063836692 10:10022615-10022637 CTGGAGCATCTGATGGAAAAGGG - Intergenic
1063945425 10:11171513-11171535 CTGGGGAATGAACAGGAAGAAGG + Intronic
1064005687 10:11697117-11697139 CTGAACAACCAGAAGGATGAAGG - Intergenic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064235569 10:13571079-13571101 TTAGAGATTCAGAAGGAAGGAGG + Intergenic
1064358991 10:14646342-14646364 CTGGAGACTCAGGAGGAGGGAGG - Intronic
1064955500 10:20903856-20903878 ATGGAGACTCAGAAGGGAGAAGG + Intronic
1065085977 10:22176954-22176976 CTGCAAAATCAGAAAGAATATGG + Intergenic
1065251641 10:23821534-23821556 CTTGAGAAGCAGAAGGAAGCAGG + Intronic
1065879190 10:30025124-30025146 CTGGAGACTGGGTAGGAAGAGGG + Intronic
1065913023 10:30326814-30326836 CTGGAGAAACAGAAGGCAACTGG - Intronic
1066444499 10:35469654-35469676 ATGGAGAGTCAGACGGGAGATGG + Intronic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1066702483 10:38144868-38144890 CTCAAGAATCAGAGGTAAGAAGG + Intergenic
1066989984 10:42503845-42503867 CTCAAGAATCAGAGGTAAGAAGG - Intergenic
1067065413 10:43101563-43101585 CTGGAGGCTCAGGATGAAGAGGG - Intronic
1067935266 10:50605904-50605926 ATGGAGACTCAGAAGGGTGAAGG - Intronic
1068439522 10:57032888-57032910 CTGTAAAATCAAAAGCAAGATGG - Intergenic
1068503991 10:57875919-57875941 CTGTAGAGTCAGCAGGAAAAGGG + Intergenic
1068520635 10:58073468-58073490 CCGGAGACTCAGAAGGAGGGAGG - Intergenic
1068635184 10:59340526-59340548 ATGGAGAGTCCGAAGGAACAAGG - Intronic
1068640260 10:59396956-59396978 ATGGAGACTCAGAAGGGTGAGGG - Intergenic
1069219411 10:65864805-65864827 ATAGGGAATCAGAATGAAGAAGG + Intergenic
1070100641 10:73382714-73382736 CTGGGGAATCAAAATAAAGAAGG + Intronic
1071299595 10:84246386-84246408 CTGGAGACTCAGAAGGGGAAGGG - Intronic
1072191797 10:93081829-93081851 CTGGAGAAACATAAGGTAAATGG - Intergenic
1072223104 10:93344405-93344427 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1072464266 10:95648716-95648738 CTGGAGAATGAGAAGCCACAGGG + Intronic
1072747982 10:97955181-97955203 CTGGTGAATCTGAAGGAGGGTGG - Intronic
1072850055 10:98880617-98880639 CTTGATAATCAAAAGGAAGCAGG - Intronic
1072872907 10:99139271-99139293 CTGGAGACTCAGAAGCAGAAGGG + Intronic
1073143170 10:101262231-101262253 CTGAAGCATCAGGAGGGAGAGGG - Intergenic
1073932942 10:108597794-108597816 CTGGAGATTCAGAAGGTACAGGG - Intergenic
1073959594 10:108911668-108911690 GCGGAGAATTAGAGGGAAGATGG - Intergenic
1074210448 10:111328269-111328291 CTGGAGACTCCGAAGGGAGTGGG + Intergenic
1074284615 10:112086397-112086419 CTGGAGAAGCTGAGGCAAGAAGG + Intergenic
1074700517 10:116088090-116088112 ATGGAGAACCAGAAGGACAAAGG + Intronic
1075093709 10:119457608-119457630 CTGGGGACTCAGTAGGGAGAAGG - Intronic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1075987653 10:126801404-126801426 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1076171576 10:128324327-128324349 CTGGAGAGTCAGAAGTCAGAGGG - Intergenic
1078001410 11:7499680-7499702 TAGGAGAAGCAGAAGGAACATGG + Intronic
1078118431 11:8480245-8480267 CTGGAGCATCAGGTGGAAGAAGG + Intronic
1078430479 11:11284359-11284381 CTAGTGAATCAGAAGTGAGAGGG - Intronic
1079181036 11:18193745-18193767 CTGCAGAATCACAAGGATGAGGG - Intronic
1079186392 11:18241736-18241758 CTGGAGACTCAGAAAGATGGAGG + Intronic
1079467799 11:20748563-20748585 TTGGAGACTGAGAAGGCAGAAGG - Intronic
1080380877 11:31771248-31771270 CTTCAGAATCAGAAGAAAGCAGG + Intronic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1080609292 11:33890128-33890150 CTGGAGACTCAGAAGGGTGGGGG + Intronic
1080640251 11:34154491-34154513 CAGGAGTATCAGAAGGTAGTGGG - Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080794533 11:35551258-35551280 CTGAATGATCAGAAGCAAGATGG + Intergenic
1082255027 11:50024529-50024551 CTGGAGACTCAGAAGCGGGAAGG - Intergenic
1082857692 11:57823628-57823650 ATGGAGAATCAGATGCAAGAAGG + Intergenic
1083002023 11:59301212-59301234 CTCAAGAAACAGAAGGAAGTGGG + Intergenic
1083096558 11:60256850-60256872 CAGGAGTATCTGAAGGAAGGAGG - Intergenic
1083132662 11:60640300-60640322 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083153085 11:60805778-60805800 ATGGAGACGGAGAAGGAAGAGGG - Intergenic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084389166 11:68863947-68863969 CTTTAGGATCTGAAGGAAGAGGG - Intergenic
1085534333 11:77208974-77208996 CTGAAGAATCAGAAGATACAAGG - Intronic
1086163750 11:83752788-83752810 CTGGAATATGAGAACGAAGAAGG + Intronic
1086771531 11:90773755-90773777 CTGGAGTACCAGAAGGAAACAGG - Intergenic
1086901699 11:92374796-92374818 ATGGAATTTCAGAAGGAAGATGG - Intronic
1087530032 11:99368912-99368934 CTGGAGAATGTCAGGGAAGAGGG + Intronic
1087614417 11:100471656-100471678 CTAGAGAAGTAGCAGGAAGATGG - Intergenic
1087949636 11:104204871-104204893 AAGGAGGATCAGAAGGGAGAAGG - Intergenic
1089028709 11:115299701-115299723 CTTAAGAAGCAGAAGCAAGACGG + Intronic
1089157596 11:116414229-116414251 CTTGAGAATCTGGAGGAAGGTGG - Intergenic
1089256192 11:117195543-117195565 GAAGAGAATCAGAAGGAAGGAGG + Intronic
1090136359 11:124203564-124203586 CTGGGGAGTCAGAAGAAAGGAGG + Intergenic
1090201800 11:124862930-124862952 CTAGAGAATGGGAAGGAAAAGGG + Intergenic
1090369088 11:126234743-126234765 CTTCAGAAACAGAAGCAAGATGG + Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090696898 11:129254383-129254405 GTGGAGAATGGGAAGGAGGAAGG - Intronic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1090943449 11:131409235-131409257 TTTGAGAAGCAGAAGGAAGCAGG + Intronic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091027242 11:132152585-132152607 CCGGAGAATGACAAGGAAGTAGG + Intronic
1091444530 12:535925-535947 CTGGGGGATAAGGAGGAAGAGGG + Intronic
1091579720 12:1776757-1776779 CTGCAGCATGAGAAGGAAGATGG + Intronic
1091956538 12:4648725-4648747 CTGGTGAGTCCGGAGGAAGAAGG - Exonic
1092027761 12:5257380-5257402 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1092060332 12:5545642-5545664 CAGGAGAAGTAGAAGGAAGGGGG + Intronic
1092569987 12:9710847-9710869 TGGGAGAGTCAGAAGGGAGATGG - Intergenic
1092915453 12:13185208-13185230 CTGGAGACTCAGAAGGCGGAGGG + Intergenic
1093456649 12:19371465-19371487 TTGGAGACTCAGAAGGGAGAGGG - Intronic
1093908478 12:24719468-24719490 CTGGAGACTGTGAGGGAAGAGGG - Intergenic
1093977971 12:25443907-25443929 TTGGAGACTCAGAAGGGGGAAGG - Intronic
1094129901 12:27063562-27063584 CAGAAGAAAAAGAAGGAAGAAGG - Intronic
1094322101 12:29195858-29195880 ATGGGGACTCAGAAGGACGAGGG - Intronic
1094647791 12:32343641-32343663 ATGGAGGAACAGAAGGAAGGAGG - Intronic
1094804901 12:34080200-34080222 CTGGAGAAAGAAAAGAAAGAAGG + Intergenic
1094816668 12:34193375-34193397 ATGGAGAATGAGGAGAAAGAAGG + Intergenic
1095100374 12:38175819-38175841 CTGGGGAACTAGGAGGAAGAAGG - Intergenic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095369533 12:41450504-41450526 CTGGGGAATCTGAAGAAGGAGGG + Intronic
1096001629 12:48135086-48135108 CAGGAGACTCAGAAGCCAGAAGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1097249217 12:57623196-57623218 GTGGAGAAACAGGTGGAAGATGG + Intronic
1097257343 12:57689293-57689315 ATGGAGACTCAGAAGGATGATGG + Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098081607 12:66791834-66791856 CTGGAGACTCAGAAGCAGGGAGG - Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098358611 12:69633909-69633931 CTGGAGAAGCAGCAGGATGAGGG - Intergenic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1098992733 12:77082433-77082455 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1099079426 12:78157810-78157832 GAGGAGAAAAAGAAGGAAGAGGG + Intronic
1099143370 12:79008202-79008224 CTGGAATATCTGAAGGAAGAGGG + Intronic
1099908263 12:88797889-88797911 TTGGAGAATCATAAGAAACAAGG - Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100090359 12:90961051-90961073 CTGGAAAATCAGCAAAAAGATGG - Intergenic
1100245610 12:92753711-92753733 CTGGAGAGGCAGAAGGGAAAAGG - Intronic
1100762555 12:97825327-97825349 TTGGAGAATCAGAAGGGAGTGGG - Intergenic
1100774276 12:97957204-97957226 CTGGAGAATGAGAAATCAGATGG + Intergenic
1100787462 12:98093958-98093980 CTGGAGAATCAGTGGGAGGGTGG - Intergenic
1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG + Intergenic
1101616480 12:106342895-106342917 TTGCAGTATCAGAAGGAAGAGGG + Intronic
1101850497 12:108398125-108398147 CTGGAGCATCATGAGGGAGAGGG + Intergenic
1101928713 12:108994693-108994715 CTGGAGACTCTGAAGTCAGATGG - Intronic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102709091 12:114909620-114909642 CTGGCGAAAAAGATGGAAGAAGG - Intergenic
1102937798 12:116911967-116911989 TTGGAGAATCTGGAGGAAGCTGG + Intronic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103024387 12:117561936-117561958 CTGGAGATTCACAATGAACAAGG + Intronic
1103044825 12:117727370-117727392 GTGAAGAAAAAGAAGGAAGAAGG + Intronic
1103333292 12:120169953-120169975 CTGGAGCAACAGAATGAAGGAGG + Intronic
1103988853 12:124785034-124785056 CTCCAGAAGCAGCAGGAAGAGGG - Intronic
1104247907 12:127060864-127060886 CAGGAGAGTCAGAAAGGAGATGG - Intergenic
1104294100 12:127496047-127496069 CTGGAGAACCATCAGGATGATGG - Intergenic
1104577328 12:129979873-129979895 CTGGAGGATGAAAGGGAAGAGGG + Intergenic
1104809045 12:131609505-131609527 CTAGAGGCTCAGAAGGAGGAGGG - Intergenic
1105617770 13:22035567-22035589 CTGGGAAATCAGAGTGAAGAAGG - Intergenic
1105747205 13:23388716-23388738 CTGGAGACTCAGAAGCAGGGAGG + Intronic
1106041360 13:26096840-26096862 AAGGAGAAAGAGAAGGAAGAGGG - Intergenic
1106582027 13:31027088-31027110 CTGGAGAAGAAGGAGGAGGAGGG - Intergenic
1108008025 13:45972429-45972451 TTGGAGACTCAGAAGGGGGAGGG + Intronic
1108095319 13:46894522-46894544 CTAGAGAATGTGAAGGAGGAAGG - Intronic
1108096691 13:46909118-46909140 CTGGAGACTCAGAAGTGAGGAGG - Intergenic
1108213128 13:48158319-48158341 AGGGAGGATCAGAAGGTAGAGGG - Intergenic
1108456815 13:50624054-50624076 CTGGAAACTCAGAAAGGAGAGGG - Intronic
1108588707 13:51893438-51893460 CTGGTGAAGCTAAAGGAAGAGGG - Intergenic
1108822425 13:54369604-54369626 TTGGAGGCTCAGAAGGGAGAGGG - Intergenic
1108862162 13:54874517-54874539 CTTGAGAATCCAAAGCAAGATGG + Intergenic
1108875948 13:55051301-55051323 CTGGAGATTCAGAAGAGAGAAGG + Intergenic
1109065385 13:57682152-57682174 TAGGAGTATAAGAAGGAAGATGG - Intronic
1109179774 13:59199789-59199811 CTGGAGAATGAGGAGCAATAAGG + Intergenic
1109399010 13:61800055-61800077 ATGGAGAATGAGAAGGAGAATGG + Intergenic
1109413738 13:62008424-62008446 CTGGAACATCAGATGTAAGAGGG + Intergenic
1109483629 13:62990278-62990300 TTGGAAACTCAGAAGGGAGAGGG - Intergenic
1110560767 13:76908770-76908792 CTGGGGAAGCAGAAAAAAGATGG - Intergenic
1110901031 13:80824859-80824881 CTGGAGACTCAGAGTGGAGAGGG - Intergenic
1111880900 13:93955838-93955860 CTGGAGAAAAAGAAGATAGAAGG - Intronic
1112239357 13:97665669-97665691 CTGGAGAACAAGAGTGAAGAGGG + Intergenic
1112559610 13:100501371-100501393 ATGGAGACTCAGAAGGGTGACGG - Intronic
1112688935 13:101867003-101867025 CTGGAGAATCAGAAGGAAGAAGG + Intronic
1113420975 13:110171269-110171291 CTAGAGGACCAGAAGGCAGATGG + Intronic
1113590062 13:111492383-111492405 CCGGAGCATCTGAAGGATGATGG + Intergenic
1114010926 14:18367635-18367657 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1114363568 14:22002878-22002900 CTGCAGACTCAGAAAGAAAACGG - Intergenic
1114402305 14:22421056-22421078 CTGCAGAAGCAGAAGGACTATGG - Intergenic
1115094535 14:29618964-29618986 CTGGAGAATGAGGAGGAGGAAGG + Intronic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1115863141 14:37711994-37712016 CTGGACAAAAAGAAGGAAGCAGG + Intronic
1115896190 14:38090360-38090382 TTGGAGAAACAGCAGGAAGAAGG + Intergenic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116762611 14:49033172-49033194 ATTGAGAATTAAAAGGAAGAGGG + Intergenic
1116762786 14:49035343-49035365 CTGGAGATTCAGAAGGGTGGGGG + Intergenic
1117640501 14:57793399-57793421 TTGGAGGCTCAGAAGGTAGAAGG - Intronic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1120139588 14:80913755-80913777 GTGGAGACTCAGAAGGGAGGAGG + Intronic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1120929233 14:89831647-89831669 CTGGAGAATGAGAATGGTGAAGG + Intronic
1122748720 14:103917359-103917381 CTGGACTATGGGAAGGAAGATGG + Intronic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1124100695 15:26690083-26690105 CTGGAGAATGAGAAGGTACACGG + Intronic
1124117713 15:26862915-26862937 CTGGAGACTTAGAAGGGAGAAGG + Intronic
1124410815 15:29435082-29435104 CTGGAGAGTGATAGGGAAGAGGG - Intronic
1125244167 15:37615240-37615262 CTGGTGATTCAGAAGTAATAGGG + Intergenic
1125747747 15:42008644-42008666 CTGGAGCAACAGAAGGGATAGGG + Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126847001 15:52769662-52769684 CTGGAGAAGCAGAAGGCACAGGG + Intronic
1127122105 15:55780596-55780618 AGGGAGAAGAAGAAGGAAGAAGG + Intergenic
1128359253 15:66949331-66949353 CTTGAGAAAGAGAAGGAAGGGGG - Intergenic
1129149570 15:73679585-73679607 CTGGTGAGTCGGAAGGAAGGTGG - Intergenic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130182849 15:81648805-81648827 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1130361063 15:83186717-83186739 CTGGAGATTCAGAAGGGAAGAGG + Intronic
1130825469 15:87540572-87540594 CTGGAGACTCAGAAGGTAGGAGG + Intergenic
1130884461 15:88081641-88081663 CTGGGGGCTCAGAAGGAAGGGGG - Intronic
1130894947 15:88162776-88162798 CTGGAGAAAGAGGAGGAAGCTGG - Intronic
1131150129 15:90042572-90042594 TTGGATGATCAGAAGGAAAAAGG + Intronic
1131268807 15:90934412-90934434 CTGGAGAATCAGACAGACGAGGG - Intronic
1131299718 15:91186696-91186718 CTGGAGACTCAGAAGGCTGTGGG + Intronic
1131476358 15:92743551-92743573 TTGGAGAGTCTGAAGGAAGGAGG + Intronic
1132932186 16:2464406-2464428 CTGGAGCCTCAGAAGGAGGGAGG + Intronic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1133696258 16:8265838-8265860 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1134209004 16:12260366-12260388 ATGAAGGATGAGAAGGAAGACGG - Intronic
1135118548 16:19745002-19745024 GTGAAGAATCACATGGAAGATGG + Intronic
1135200129 16:20430030-20430052 TTGGAGACTCAGAAGGAAGAAGG + Intronic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1135253655 16:20922864-20922886 CTGGAGACCCAGAAGAAAGCTGG + Intronic
1135727858 16:24870838-24870860 CTAGAGATGCAGAAGAAAGATGG + Intronic
1135973013 16:27086005-27086027 CTGGAGACTCAGAAGGTGGAGGG + Intergenic
1136685979 16:31995189-31995211 CTGCAGAACCAGAAGGCATAAGG - Intergenic
1136786591 16:32938722-32938744 CTGCAGAACCAGAAGGCATAAGG - Intergenic
1136883178 16:33915072-33915094 CTGCAGAACCAGAAGGCATAAGG + Intergenic
1137002070 16:35237837-35237859 ATGCAGAATCAGAATGAAGTAGG - Intergenic
1137392205 16:48091245-48091267 CTGCAGAACCCGAAGGAGGAAGG - Intronic
1137805557 16:51301882-51301904 CTGAAGAAGCAGCAGAAAGAAGG - Intergenic
1137971708 16:52991915-52991937 CTGGAGACTCAGAATGGGGAGGG + Intergenic
1138057753 16:53853477-53853499 CTGGAGATTCAGAAGAGAGGAGG - Intronic
1138300809 16:55928404-55928426 CTGGAGACTCAGAAGGTGGAAGG + Intronic
1138649280 16:58449653-58449675 ATGAAGAATGAGATGGAAGAAGG + Intergenic
1138719673 16:59064883-59064905 CTGGAGACTCAGAAGGGTGGGGG - Intergenic
1139128460 16:64110894-64110916 ATGGTGAATCAGAAGAAAGCTGG - Intergenic
1139305913 16:65986243-65986265 TTGGAGACTCAGAAGGGAAAAGG + Intergenic
1140665687 16:77225132-77225154 CAGGAGAGACAGAAGGAAAATGG - Intergenic
1140973876 16:80040863-80040885 CTGGAGAAAAAGAAGAAAGCGGG - Intergenic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1141030387 16:80582631-80582653 TTAGAGACTCAGAAGGAGGAAGG + Intergenic
1141031919 16:80596599-80596621 ATGGAGGAACAGAAGGATGATGG + Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1141355172 16:83338803-83338825 CTGGATAATAAGGAAGAAGAGGG + Intronic
1141371727 16:83493231-83493253 CTGAAGAAGCAGAAAGAAGTTGG + Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1203088826 16_KI270728v1_random:1200388-1200410 CTGCAGAACCAGAAGGCATAAGG - Intergenic
1143270855 17:5673420-5673442 CTGGAGAGTGGGAAGGAAGAGGG + Intergenic
1143737350 17:8922118-8922140 CTGGAGAATAGGAAAGAAGGAGG + Intronic
1143947426 17:10605466-10605488 TTGGAGAAAGAGAAGGAGGAGGG + Intergenic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1145102831 17:20090920-20090942 CTGGAGACCCATAAGGAATAGGG - Intronic
1145123105 17:20278302-20278324 TTGGAGAATTAGAAGCAAGAGGG + Intronic
1145829896 17:27907450-27907472 ATGGAGAGTCAGAGGAAAGAGGG + Intergenic
1145989857 17:29072796-29072818 CTACAGAATGAGAAGGTAGAAGG + Intergenic
1146614567 17:34344618-34344640 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1146790776 17:35749324-35749346 CTGGGGAATGAGAAGCAAGGAGG + Intronic
1146968353 17:37052256-37052278 CTGGAGAATCTGATGGAACAAGG + Intronic
1147146939 17:38490854-38490876 CTGCAGAACCAGAAGGCATAAGG - Intronic
1148387015 17:47241484-47241506 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1148661016 17:49332852-49332874 CTGGAGAAACTGAAAGAAAAGGG - Intronic
1148685959 17:49501415-49501437 ATGAAGACTCAGAGGGAAGATGG + Intronic
1149003770 17:51783583-51783605 AAGGAGAATAAGAAAGAAGAAGG + Intronic
1149132174 17:53316122-53316144 CAGGGGAGTCAGAAGGGAGATGG + Intergenic
1149275350 17:55027400-55027422 TTGGAGACTCAGAAGGGGGATGG + Intronic
1149662094 17:58339354-58339376 CTTGAGTAGCAGAAGGCAGAGGG - Intergenic
1150006680 17:61474119-61474141 GGGGAGGATCAGAAGGATGATGG + Intronic
1150665319 17:67130165-67130187 CTGGAGATTCAGAAGGTAGCGGG + Intronic
1152026683 17:77814201-77814223 CTGGAGGATGAGAAGCAACATGG + Intergenic
1152158099 17:78648104-78648126 CTGTGGAGTCAGAAGGAAGCCGG + Intergenic
1152260454 17:79263953-79263975 CTTGAGACACACAAGGAAGAAGG + Intronic
1152774760 17:82194096-82194118 CTGGAGGCTCTGAAGGAAGCCGG - Exonic
1152859879 17:82690162-82690184 CTGAAGAATCAGAGGGAGCATGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153499597 18:5734651-5734673 CTGGAGACTCAGAAGGGTGGAGG + Intergenic
1153689348 18:7575946-7575968 GTGGAGAATCTGATTGAAGATGG + Intronic
1154083855 18:11282863-11282885 TTGGAGACTCAGAAGGGTGAGGG - Intergenic
1154120661 18:11649548-11649570 CTGGACAATCAGATGGAATGAGG - Intergenic
1154435313 18:14337653-14337675 CTGGAGAATCCGAGGGCAGGTGG + Intergenic
1154505650 18:15038245-15038267 CTTGAGAAACAGAAGGACCAAGG - Intergenic
1154962507 18:21324008-21324030 TTGGAGATTCTGAAGGGAGAAGG + Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155382129 18:25235373-25235395 CTGGGGAAGCAGAAGGTAAAGGG + Intronic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1155789268 18:29944957-29944979 CCGGAGAATAAGAAGATAGAAGG - Intergenic
1156269391 18:35517085-35517107 CTGGAGTTGCAGGAGGAAGATGG - Intergenic
1156392776 18:36666221-36666243 CTGGAGAATAGAAAGCAAGAGGG + Intronic
1157185367 18:45536081-45536103 CTGGACAATAAGAAGGAAAAAGG - Intronic
1158187861 18:54791942-54791964 ATGGAGAGCCAGAAGGGAGATGG - Intronic
1158294312 18:55977936-55977958 TTGGAGATTCAGAAGGGAGGAGG + Intergenic
1158508299 18:58066789-58066811 TGGAAGAATCAGGAGGAAGAGGG + Intronic
1158554289 18:58462397-58462419 TTGGAGACTCAGAAGGAAGGTGG - Intergenic
1158768151 18:60481096-60481118 TTGGAGACTCAGAAGGAAGGAGG - Intergenic
1158816423 18:61103169-61103191 CTGGAGACTCAGAAGCAGGGAGG + Intergenic
1158983031 18:62783916-62783938 CCTGAGAATGAGAAGAAAGATGG + Intronic
1159095734 18:63899411-63899433 CTGGAAATTCAGAAGAATGAAGG - Intronic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1160416105 18:78712135-78712157 CGTGAGACTCAGCAGGAAGATGG + Intergenic
1160601845 18:80019670-80019692 CTGGAGACTAAGAAGGAACAAGG - Intronic
1161438646 19:4278777-4278799 TTGGAGCAGCAGAAGGAAGAGGG - Exonic
1161842767 19:6692967-6692989 CTGGAGAAGCAGAAGCCCGACGG - Exonic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1162452777 19:10764768-10764790 CCTGAGAATCAGGAGGGAGATGG - Intronic
1162930026 19:13952938-13952960 AGGGAGAATCAGGAGGAAGGGGG + Intronic
1163162716 19:15475151-15475173 GTGGAGATTCAGAAGGGTGAGGG + Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163272525 19:16262757-16262779 CTGGGGAGTCAGAAGTAGGATGG - Intergenic
1163283938 19:16334455-16334477 TTGTAGAGACAGAAGGAAGAAGG - Intergenic
1163765265 19:19160295-19160317 CTGGGAAACCAAAAGGAAGAAGG + Intronic
1164441249 19:28282287-28282309 CAGGGGAGTCAGAAAGAAGATGG - Intergenic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1164879667 19:31721337-31721359 CTTGTGAATCAGAAGGAAGCAGG + Intergenic
1165106007 19:33470034-33470056 CTGCTGAAGCAGCAGGAAGATGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166714897 19:44960723-44960745 CTGGAGCCTCAGAGGGAAGTGGG + Intronic
1167114076 19:47478877-47478899 TTGGAGATTCAGAAGCAGGAAGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1167764704 19:51473842-51473864 CTGAACAATCAGGATGAAGATGG - Intergenic
1168254725 19:55159145-55159167 CTGGAGACTCAGAGGGCAGCTGG + Exonic
1168393267 19:56027975-56027997 CTGGAGACTGAGGTGGAAGAAGG - Exonic
1168430732 19:56277739-56277761 ATAGAGACTCAGAAGGAAGGAGG + Intronic
1168635007 19:57989365-57989387 CTGGAAAACGAGAAGGAAAAAGG + Intronic
925029765 2:641343-641365 CTGGAGACTCAACAGGCAGACGG + Intergenic
925062427 2:903575-903597 AGGGTAAATCAGAAGGAAGAAGG - Intergenic
925702126 2:6649227-6649249 ATGAAGAATGAGGAGGAAGAAGG - Intergenic
925722137 2:6839625-6839647 CTGGAGACTAAGAAGGAACAAGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
926724118 2:15984255-15984277 CTGGAGAAGCAAGAGGGAGAAGG - Intergenic
926858659 2:17284676-17284698 CTGAAGCTTCTGAAGGAAGATGG + Intergenic
926906942 2:17814827-17814849 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
926990082 2:18669671-18669693 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
927049808 2:19316193-19316215 TTGGAGAGTCAGAGGGAGGAGGG - Intergenic
927258496 2:21061890-21061912 CTGGAGAAACAATAGGAAGTGGG - Intergenic
927910958 2:26899453-26899475 ATAGAAAATCACAAGGAAGAGGG - Intronic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929594464 2:43167742-43167764 CTGGAGCAGAAGAAGGAAGAAGG - Intergenic
930349695 2:50234805-50234827 TCGGAGATTCAGAAAGAAGAAGG + Intronic
930379056 2:50604297-50604319 CTGTTGAATCAGAAGCAAGGGGG + Intronic
930463176 2:51710059-51710081 GTGGAGACTCAGAAGGGTGAGGG + Intergenic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
930892919 2:56412005-56412027 CTGGAGACTCAGAAGGGTGAGGG + Intergenic
931260659 2:60615544-60615566 ATTGAGAGTGAGAAGGAAGATGG + Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931565999 2:63616237-63616259 CTGAAGAATAAGAAGGGAGAGGG + Intronic
932182221 2:69657494-69657516 TTGGAGAATAAGTAGGATGATGG - Intronic
933315222 2:80706815-80706837 CGGGGGAGCCAGAAGGAAGATGG - Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
935103830 2:100021057-100021079 CTTCAGGATCAGGAGGAAGAGGG - Intronic
935277184 2:101485097-101485119 TTGGAGAATGAAGAGGAAGATGG - Intergenic
935895040 2:107726715-107726737 ATAGAAAATCCGAAGGAAGAAGG + Intergenic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
936444698 2:112586411-112586433 CTGAACAACCAGAAGGATGAAGG - Intronic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
937064513 2:119007044-119007066 CTGGAGTAGTGGAAGGAAGAAGG - Intergenic
938321827 2:130371224-130371246 CTGGGGAGTCCGGAGGAAGAGGG - Exonic
938526005 2:132131705-132131727 CTGTAGACTCAGAAGGGTGAGGG - Intergenic
938849413 2:135245298-135245320 CTGGGCAATCAGCAGGAAGTTGG + Intronic
938963209 2:136361485-136361507 ATGGAGAGAGAGAAGGAAGAAGG - Intergenic
939322628 2:140644079-140644101 CTGGGGAATCAGCACGCAGAGGG - Intronic
939553129 2:143640284-143640306 ATGGGGAATCAGAAGGAAGAGGG + Intronic
939763477 2:146214716-146214738 CTAAAGATTTAGAAGGAAGATGG + Intergenic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940525438 2:154808045-154808067 CTGGAGTGTCAAATGGAAGAGGG + Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940574868 2:155489964-155489986 ATGAAGAATGAAAAGGAAGATGG + Intergenic
941178601 2:162231973-162231995 CTGCAGAGCCAGCAGGAAGATGG - Intronic
941478886 2:165981826-165981848 CTGGAGATTCAGAAGTAGGGAGG - Intergenic
941834752 2:170004260-170004282 CTGGAGCATGAGGGGGAAGAAGG + Intronic
941849427 2:170164421-170164443 CTGGAGAGGCAAAGGGAAGAGGG - Intergenic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941974398 2:171386998-171387020 TTGGGGAGTCAGAAGGGAGATGG - Intronic
942430450 2:175905825-175905847 ATGGAGATTCAGAAGCATGAGGG - Intergenic
942950660 2:181717445-181717467 GGGGAGAATTAGAAAGAAGAGGG - Intergenic
944534878 2:200698880-200698902 TGGGAGAATGAGAAGGATGAAGG + Intergenic
944560945 2:200937164-200937186 GTGGTGATTAAGAAGGAAGAGGG + Intronic
944579981 2:201124080-201124102 CTAGAGAAGCAGTAGAAAGAAGG + Intronic
944790525 2:203120461-203120483 CTAGAAAATCATAAAGAAGATGG + Intronic
945268711 2:207917017-207917039 CTGGAGAAAAAGAAGGGAGAGGG + Intronic
945974476 2:216259556-216259578 CTGGAGGATCAAAAGGCAGGAGG - Exonic
945977656 2:216283297-216283319 GTGGAGAATCAGAGGGAAAAGGG - Intronic
946056768 2:216909778-216909800 ATGGGGAAACAGAAGGGAGATGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947073258 2:226315025-226315047 CCTGAGACCCAGAAGGAAGAAGG - Intergenic
947448877 2:230186660-230186682 ATGGAGACTCAGAAAGGAGAGGG - Intronic
947815623 2:233034488-233034510 CTGAGGAAGCAGAAGGCAGAGGG - Exonic
948669853 2:239561306-239561328 CTGGAGACTCAGAAAGGAGGTGG - Intergenic
1168932837 20:1637839-1637861 CTGGAGAATCAGAAAAATGAGGG + Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169373018 20:5043179-5043201 CTGGGGAGCCAGAAGGAAGCTGG - Intergenic
1169879140 20:10328024-10328046 CTGGAGAATGAGAGGGATGTGGG - Intergenic
1170745758 20:19097644-19097666 GTGGAAAATCAGAAGAGAGAAGG - Intergenic
1170815186 20:19708074-19708096 AGGGAGAATCAGAAGAAAGGGGG + Intronic
1171211855 20:23323055-23323077 CTGGAGACTCAGAAGGGGTAGGG + Intergenic
1171370999 20:24661780-24661802 CAGGAGCGTCAGAAGGAAGCAGG + Intronic
1171822667 20:29868392-29868414 ATGGAGAATCAGGAGAAAGAAGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172163922 20:32887156-32887178 ATGGATAATCAGAAGGGATAGGG - Intronic
1172602097 20:36190870-36190892 CTGCAGAATGAGCAGGAAAATGG + Intronic
1173074176 20:39800954-39800976 CTGGAGAACCAAAAGGAAGCAGG - Intergenic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1173619514 20:44426067-44426089 CTGTGGAATCAGGGGGAAGATGG + Intronic
1173856850 20:46255724-46255746 CTGGAGCAGGAAAAGGAAGAAGG - Intronic
1173866683 20:46317004-46317026 CAGGAGTCTCAAAAGGAAGATGG + Intergenic
1174100236 20:48121640-48121662 CTGGAGAACCAGAGGGGAGCTGG - Intergenic
1174153602 20:48502870-48502892 CTGGAGAACCAGAAAGGAGCTGG - Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1175040577 20:56046458-56046480 TTAGAGACTCAGAAGAAAGAGGG + Intergenic
1175148922 20:56917623-56917645 CTGGAGTGGGAGAAGGAAGACGG - Intergenic
1175644985 20:60663589-60663611 CTGGAGAATCAAATGGAATGGGG - Intergenic
1176257297 20:64158946-64158968 CAGGAGAAGCAGGAGGAAGCAGG - Intronic
1176792211 21:13330871-13330893 CTTGAGAAACAGAAGGACCAAGG + Intergenic
1176916590 21:14633235-14633257 CTAGAGAAACAGAAGTAATAGGG - Intronic
1177991606 21:28041735-28041757 CTTGAGAAACAGAAGGACCAAGG + Intergenic
1178265311 21:31137634-31137656 CTGGAAAATCACATGGCAGAAGG - Intronic
1178619027 21:34158343-34158365 CTGGAGAATCAGATTTCAGAGGG + Intergenic
1180324268 22:11354597-11354619 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
1180435420 22:15298439-15298461 CTGTAGACTCAGAAGGGTGAGGG + Intergenic
1181759688 22:25049571-25049593 CTGGAAACTCAAGAGGAAGAAGG - Intronic
1182851626 22:33479383-33479405 ATGAACAAACAGAAGGAAGAGGG + Intronic
1183005011 22:34894107-34894129 CTGCAGAATCATAAGTAAGATGG - Intergenic
1183044739 22:35210816-35210838 CTACAGAAGCAGAAGGAAAATGG + Intergenic
1184003850 22:41694655-41694677 GTGGAAATTCAGATGGAAGAGGG + Exonic
1184821064 22:46909636-46909658 CAGCAGCAACAGAAGGAAGAAGG - Intronic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
1185044120 22:48520469-48520491 CTGCAGAATCAGATGGCAGTTGG - Intronic
1185236825 22:49718747-49718769 CTGGAGAATGAGAGAGGAGAGGG - Intergenic
949127894 3:468499-468521 CAGGAGAATAAGAAAGAAAAAGG + Intergenic
949277298 3:2299470-2299492 TTGAAGATTCAGAAGAAAGAGGG - Intronic
949674459 3:6437319-6437341 GTAGGGAATGAGAAGGAAGATGG - Intergenic
949901832 3:8821522-8821544 ATGGAGGATGAGAAGGAAGAAGG - Intronic
950199374 3:11032291-11032313 CTGGAGACTCAGAAGGGTGGGGG - Intronic
950214945 3:11152782-11152804 CTGGAGAATCACCAGGGAGTGGG + Intronic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
950698995 3:14727128-14727150 CTGGACATTCAGACTGAAGATGG - Intronic
951342543 3:21506247-21506269 CTGGAGAATTCTATGGAAGAGGG - Intronic
951685611 3:25340730-25340752 CTGGAGAACAAGAAGGAAGTAGG + Intronic
952199010 3:31106130-31106152 CTGGAGACTCAGAAGGGTGAAGG - Intergenic
952493147 3:33891235-33891257 TTGGAGACTCAGAAGAGAGAGGG - Intergenic
952978601 3:38717329-38717351 AGGAAGAATCAGTAGGAAGATGG + Intronic
953277297 3:41514762-41514784 ATGGAGACTCAGAAGGGTGAGGG + Intronic
953363820 3:42324846-42324868 CTGGAGAAGCATAAGCAAGTGGG - Intergenic
953380464 3:42467520-42467542 ATGGAGACTCAGAAGGGTGAAGG + Intergenic
953549444 3:43890001-43890023 TTGGAGGAGCTGAAGGAAGAAGG - Intergenic
953869811 3:46616484-46616506 TTGGAGACTCAGAAGGAAAGAGG - Intronic
954034559 3:47844247-47844269 CTGGAGAAAGACGAGGAAGAGGG + Intronic
954460176 3:50622026-50622048 CCTGGGAACCAGAAGGAAGATGG - Intronic
954966350 3:54614586-54614608 CTGGGGAATGAGAAGGAAGGAGG - Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955603856 3:60677315-60677337 CTGGAGACTCAGAATGATGATGG - Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
955938932 3:64129626-64129648 CTGGAGTGACAGAAGGAACAAGG + Intronic
956031075 3:65038772-65038794 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
956784427 3:72630576-72630598 GGGGAGAAGCAGAAGGAAGAAGG + Intergenic
957527826 3:81399964-81399986 GTGGAGGATCTGAAGGAAGTAGG + Intergenic
957666770 3:83241972-83241994 CTGGAAATTGAGGAGGAAGAAGG + Intergenic
959167142 3:102794566-102794588 CTGGAAACACAGAAGGGAGAAGG - Intergenic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960062824 3:113340902-113340924 TGGGAGAACCAGAAGGGAGATGG + Intronic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960076204 3:113488586-113488608 TTGGAGACTCAGAAGGGGGAGGG + Intronic
960113383 3:113867886-113867908 TGGGAGTATCAGAAGGAAAAAGG - Intronic
960414953 3:117373246-117373268 TTGGATACTCAGAAGGTAGAGGG - Intergenic
961082282 3:124036579-124036601 ATGGGAAATCAGAAGGGAGAAGG - Intergenic
961636461 3:128335937-128335959 CTGGAGAAGCAGAAGGCTGAAGG + Intronic
961793108 3:129390650-129390672 CTGGAAAATCAGAAAAAAGTGGG - Intergenic
961994431 3:131226664-131226686 TTGGAGACTCAGAAGGGAGGAGG + Intronic
962031477 3:131605382-131605404 CTAGAGAGAGAGAAGGAAGAGGG - Intronic
962841676 3:139238405-139238427 CTGGAGGAAGAGGAGGAAGAAGG - Intronic
964074805 3:152680761-152680783 CTGGAGAATAAGAAGATAGAAGG + Intergenic
964276380 3:155012689-155012711 CTGGACAATAAGCAGGAAGAAGG - Intergenic
964635497 3:158853822-158853844 TTGGAAACTCAGAAGGAAGGTGG - Intergenic
965761618 3:172083684-172083706 CTGGATAATTAGAGTGAAGATGG + Intronic
966319891 3:178690516-178690538 GAGGAGAATGAGAAGGAAGAAGG + Intronic
966486588 3:180477947-180477969 ATGTGGAATCAGAAGGAAAAAGG - Intergenic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
967531767 3:190555746-190555768 CTGGACAGTCTGGAGGAAGAGGG - Intronic
967699119 3:192571004-192571026 CTGAAGAATCAGAAGGTTAATGG - Intronic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968358484 3:198128001-198128023 AAGGAGATTCAGCAGGAAGATGG - Intergenic
969172441 4:5375111-5375133 CTGGAGTTTCAGAAGCCAGATGG - Intronic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
969995071 4:11303575-11303597 CGGGAGAAGAACAAGGAAGAAGG - Intergenic
970234486 4:13944768-13944790 TGGGGGAGTCAGAAGGAAGATGG + Intergenic
970276016 4:14402155-14402177 CTGCTGAAGCAGAAGGAAAAGGG + Intergenic
970299468 4:14666508-14666530 GTGGAGCATCTGGAGGAAGATGG + Intergenic
970553098 4:17203930-17203952 TGGAAAAATCAGAAGGAAGAGGG + Intergenic
970564733 4:17320686-17320708 TTGGAGAACCAAAAAGAAGAAGG - Intergenic
970594391 4:17586633-17586655 CTGCAGGATCAGAGGGATGAGGG + Intronic
970738219 4:19198991-19199013 CTGAAGTATGAGAAGGAAAAGGG + Intergenic
971094682 4:23387374-23387396 AAGGAGAAGCAGAAGTAAGATGG - Intergenic
971364863 4:25969570-25969592 CTGTCCAATCAGAAGGGAGATGG + Intergenic
971449607 4:26787717-26787739 CTGAAGGTTCAGAAGGAAGTAGG + Intergenic
971574091 4:28251884-28251906 GTGGAGAAAGAGAAGGAAGCTGG + Intergenic
971676425 4:29635354-29635376 CTGGAGACCCAGAAGGATGAGGG + Intergenic
972170479 4:36340044-36340066 CTGGAGAATACAAAGGTAGAAGG + Intronic
972510241 4:39762459-39762481 CTGAAGAATCAGAAGCCAAATGG - Intronic
975126579 4:70789027-70789049 CTGGAGGATCAGATGGGAGGAGG - Intronic
975293616 4:72706620-72706642 AAGGAGAATGAGAGGGAAGAAGG + Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
975989214 4:80239774-80239796 GTGGAAAATGAGAGGGAAGAAGG - Intergenic
976205618 4:82620772-82620794 TTGGACAATGAGAAGGGAGATGG + Intergenic
977557912 4:98503431-98503453 CTGGAAACTCAGAAGGAACCAGG + Intronic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
977974549 4:103249023-103249045 CTGGAGACTCAGAAGCAGGGAGG - Intergenic
978151671 4:105443332-105443354 GTGAAGAAGCAGAAGGCAGAAGG + Intronic
978194439 4:105954449-105954471 TTGGAGAATGAACAGGAAGAAGG - Intronic
978718931 4:111882179-111882201 CATCAGAGTCAGAAGGAAGAGGG + Intergenic
979117246 4:116841128-116841150 TTTGAGAATCAGATGGAAAATGG - Intergenic
979966983 4:127087208-127087230 CTGTAAAATCAGAAGCAAGTTGG - Intergenic
980718982 4:136668126-136668148 CTAGAGAAACTGAAGTAAGATGG - Intergenic
980759249 4:137207402-137207424 GTGGAGAGTGAGAAGAAAGAAGG + Intergenic
981361589 4:143852065-143852087 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
981889768 4:149721447-149721469 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
981933828 4:150218113-150218135 CTTGAGCCTCAGAAGGAACAGGG - Intronic
981954602 4:150454737-150454759 TTGGAGACTTAGAAGGGAGAAGG - Intronic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
982161649 4:152576489-152576511 CTGGAGAATCACTCGGAAGGTGG - Intergenic
982344692 4:154344644-154344666 TTGCAGAAACAGAAGGAAAAAGG + Intronic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
983281442 4:165685761-165685783 CTGGCAAATGAGAAGAAAGAAGG - Intergenic
983400527 4:167259000-167259022 CTGGAGACTTAGAAGGGGGAGGG + Intergenic
983924457 4:173384617-173384639 TTAGAGAATTGGAAGGAAGATGG - Intergenic
984125407 4:175803131-175803153 GAGGAGAAAGAGAAGGAAGAGGG - Intronic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
984269542 4:177534208-177534230 CTGGAGAAGCAGGAGGGAGTAGG + Intergenic
984321770 4:178206677-178206699 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
984402767 4:179288007-179288029 CTGCATAATCAGGAGGAAAAGGG - Intergenic
985416178 4:189737913-189737935 CAGGAAAATCAGAAGGATGCTGG + Intergenic
985440057 4:189976301-189976323 AAGGAGATTCAGCAGGAAGATGG + Intergenic
986350796 5:6877947-6877969 CTACAGAAGAAGAAGGAAGAGGG - Intergenic
986384297 5:7216593-7216615 CTGGAGACTAAGAAGGAAAGAGG - Intergenic
986465756 5:8021282-8021304 CTGGAGATTCAGAATGAGCAAGG - Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
987272680 5:16328186-16328208 ATGGATAATAAGAAGAAAGATGG + Intergenic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
988979029 5:36545905-36545927 TTGGAGACTCAGAAGTAAGGAGG + Intergenic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989238896 5:39180760-39180782 CTGGAGAAGTAGAAAGTAGATGG - Intronic
989322359 5:40151199-40151221 CTGGAGGAGCAAAAGGAAGAAGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
989954690 5:50343855-50343877 CTGAAAAATCACAAGGAAGAGGG - Intergenic
989981707 5:50653760-50653782 CAAGAGAATCAGGAGGAAGAGGG - Intergenic
990486155 5:56261093-56261115 TGTGAGAATGAGAAGGAAGAAGG - Intergenic
991325173 5:65423154-65423176 CTGGAGATTCAGAAGGGGGAAGG + Intronic
991513856 5:67412070-67412092 CTTGAAACTCAGAATGAAGATGG + Intergenic
991557542 5:67912517-67912539 ATGGTCAATCAGGAGGAAGAAGG + Intergenic
992073896 5:73173663-73173685 CTGGAGAACCATAAGGAGGAGGG - Exonic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
992588708 5:78270854-78270876 CTACAGAATCAAAAGGAGGAGGG - Intronic
992834207 5:80624204-80624226 CTGGCCAAACAGAAGAAAGAAGG - Intergenic
993132123 5:83912101-83912123 CTGAATAATTAGAAGGAAAAAGG - Intergenic
993628031 5:90249586-90249608 CTGGAGACTCAGAGGGGTGAGGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
996304841 5:122035281-122035303 CTGGACACTCAGGAGAAAGATGG - Intronic
996486598 5:124042268-124042290 CTGGGGAGCCAGAAGGGAGATGG - Intergenic
997251528 5:132392410-132392432 CTGGAGAAGCAAAGGAAAGAGGG - Intronic
997294678 5:132762096-132762118 CTGGAGAATCAGGAGCACCAGGG - Intronic
997923096 5:138001502-138001524 ATGGAGCTTTAGAAGGAAGATGG - Intronic
998172696 5:139881851-139881873 CTGGGGCTTCAGAAAGAAGAGGG - Intronic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999471311 5:151857578-151857600 CTGGACACCCAGAAGGCAGAGGG - Intronic
999552427 5:152703979-152704001 CTGGAGAATAAGGAGAAATATGG + Intergenic
999575408 5:152971227-152971249 TTGGAAACTCAGAAGGAGGAGGG + Intergenic
999738864 5:154534128-154534150 CTGGAGGCTGAGGAGGAAGATGG - Intergenic
999989067 5:157033026-157033048 CTGCAGAATCAAAAGGGACATGG - Intronic
1001145013 5:169176252-169176274 CCTGAGAAAAAGAAGGAAGAAGG - Intronic
1001214917 5:169846855-169846877 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002865648 6:1119858-1119880 TTGGTGAATCAGAACAAAGAAGG + Intergenic
1002905736 6:1447590-1447612 CTGGAGACTCAGAAGGGGGGAGG - Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003244153 6:4370060-4370082 CATGAGAACCAGAAGGAAAAAGG + Intergenic
1003526972 6:6906226-6906248 CTGGAGAACCACAAGGGAGCAGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003762762 6:9198908-9198930 CTGGTGACTCAGCAAGAAGAGGG - Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1004701411 6:18082949-18082971 CTGGAGAAAAAGAAGGAAAAAGG - Intergenic
1005926783 6:30451506-30451528 CAGGAGGCTCTGAAGGAAGAGGG + Intergenic
1006285473 6:33090556-33090578 CAGGAGATTCAGAACGAAAAGGG + Intergenic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006734885 6:36266541-36266563 CTGGACAATGAGAAGTAACAGGG - Intronic
1007099042 6:39231940-39231962 ATGGAGAGCAAGAAGGAAGAAGG - Intergenic
1007406418 6:41638451-41638473 CTGGAGGGAGAGAAGGAAGAAGG + Exonic
1007650793 6:43419625-43419647 CTGGAAAATTAGGTGGAAGAAGG + Intergenic
1008418322 6:51268709-51268731 CTGGAGGAACAGGGGGAAGAGGG - Intergenic
1009709998 6:67305925-67305947 CTGGAGACTCAGAAAGGAGGAGG - Intergenic
1009905881 6:69868782-69868804 CTGGAGGACCAGAAAGTAGATGG - Intronic
1010977008 6:82326572-82326594 TTGGAGACTCAGAAGAAAGGAGG - Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1012351813 6:98260744-98260766 CTGGAGATTCAGAAGTGAGGAGG - Intergenic
1012533017 6:100261328-100261350 GTGGACAATCAGAAGGATGTGGG - Intergenic
1013380629 6:109566704-109566726 CTGGAGACTCAGAAGGGAGCAGG + Intronic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014092627 6:117421414-117421436 TTGGAGACTCAGAAGGGGGAGGG - Intronic
1014552617 6:122806660-122806682 CTGGAGAAGAAGAATGAACATGG - Intronic
1014681413 6:124435160-124435182 CTGGATAACTAGAAGGAATATGG + Intronic
1014989163 6:128052843-128052865 CTTGAGAATCAAAATAAAGATGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015314590 6:131804291-131804313 CTGGCGAATTAGAAGAAAGCTGG + Intergenic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015636266 6:135277801-135277823 TTGGAGACTCAGAAGGGGGAAGG + Intergenic
1015666524 6:135636118-135636140 AGGGAGAAGAAGAAGGAAGAAGG - Intergenic
1015890795 6:137967913-137967935 CTGGAGCATCAGAGTGATGATGG - Intergenic
1016028640 6:139314787-139314809 CTTGAGGATTAGAAGCAAGATGG - Intergenic
1016110328 6:140215564-140215586 ATGGAGACTCAGAAGTAAGAGGG - Intergenic
1016150628 6:140737554-140737576 TTGGAGACTCAGAAAGGAGAGGG - Intergenic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016590054 6:145734977-145734999 CTAGGGAATCAGTAGGAAGCCGG + Intronic
1016689563 6:146921169-146921191 CTGGAAACTCAGAAGGGAGCGGG + Intergenic
1016693040 6:146961360-146961382 CTGGAGACTCAGAAGGGTAAGGG + Intergenic
1016927446 6:149365717-149365739 TTGGAGATTCAGAAGGAAAGGGG - Intronic
1017057913 6:150454458-150454480 CTGGAAAACCAGCAGGGAGAGGG + Intergenic
1017272315 6:152522213-152522235 TTGGAGACTCAGAAGGATGAGGG - Intronic
1017988201 6:159463087-159463109 CAAGAGAATCAAAAGGAAGTGGG + Intergenic
1018282780 6:162206027-162206049 CGAGAGAAGGAGAAGGAAGAAGG + Intronic
1018333879 6:162763300-162763322 CTTGAGAAGCAGCAGGAAGGAGG + Intronic
1018573202 6:165232236-165232258 CTGGAGACTGAGATGAAAGAGGG - Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1019391927 7:793180-793202 GTGGAGACTCAGAAGGGTGAAGG + Intergenic
1019797636 7:3063525-3063547 GAGGAGAAGCAGAAGAAAGAAGG - Intergenic
1020966944 7:14882596-14882618 ATAGAGACTCAGAAGGGAGAAGG - Intronic
1020970252 7:14928831-14928853 ATGGAGACTCAGATGGATGAGGG - Intronic
1021488785 7:21196218-21196240 CTGGTGAAGCAGCAGGAAGATGG - Intergenic
1021662499 7:22934362-22934384 CTGGAGAAACAAAAAGAACAGGG - Intergenic
1022123340 7:27331626-27331648 CTGGAGTTTCTGAAGAAAGAAGG - Intergenic
1022247321 7:28572854-28572876 CTGGAGAATAAATGGGAAGATGG - Intronic
1023567364 7:41536902-41536924 GTGGAGGATGAGAAAGAAGATGG + Intergenic
1023570816 7:41569617-41569639 CTCTAGAAGCAGAAGCAAGAAGG + Intergenic
1024019130 7:45349209-45349231 CTGGAGGATCACCAGGAGGATGG + Intergenic
1024431624 7:49294945-49294967 AAGGAGAATCTGAAAGAAGAAGG + Intergenic
1024576267 7:50767270-50767292 CTGGAGGATCAGGAGCCAGAGGG - Intronic
1024979719 7:55147080-55147102 CTGGAGACTCAGAAGCATGTAGG - Intronic
1025641291 7:63373071-63373093 CTGGAGAATTTGGAGGAAAATGG - Intergenic
1026070995 7:67119483-67119505 CCGAAGACTCAGAAGGGAGAAGG - Intronic
1026228756 7:68465398-68465420 CTTCAGAGTGAGAAGGAAGAGGG - Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1026842682 7:73679243-73679265 CCGGAACCTCAGAAGGAAGAGGG + Intergenic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027640243 7:80724102-80724124 CTCCAGAATGAGAAGGAACATGG + Intergenic
1027800924 7:82747850-82747872 CTGGAGGATCAGAGACAAGAAGG + Intergenic
1028123910 7:87089354-87089376 ATGGAGACTCAGAAGGGTGAGGG + Intergenic
1028396104 7:90369994-90370016 TTGGAGACTCAGAGGGAGGAAGG + Intronic
1028454940 7:91028051-91028073 CTGGAGACTCAGAAGCAGGAAGG - Intronic
1029111919 7:98217083-98217105 CTGGAAAGGCAGAAGGGAGAGGG + Exonic
1029173915 7:98650381-98650403 TTGGAGCATCAGAAGGGAGAAGG + Intergenic
1029815211 7:103086890-103086912 ATGGAGAATAAGACAGAAGAGGG + Intronic
1030337635 7:108343223-108343245 CAGTAGAATTAGAAGGAAAAAGG + Intronic
1030401495 7:109057235-109057257 CTGGAGACTCAGAAGGAGAGAGG - Intergenic
1030541223 7:110832769-110832791 CTGGAGTATGAGAATGCAGAGGG + Intronic
1030919031 7:115356861-115356883 CAGGAGAAGCAGAAGCAAGTTGG + Intergenic
1031714870 7:125096541-125096563 CTGGAGATTCAGAAGGAGGAGGG - Intergenic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1032543166 7:132721148-132721170 CTGGTGATTCAGAAGGAAGCAGG - Intronic
1033935739 7:146583439-146583461 CATGAGAATCTGAAGGGAGAAGG + Intronic
1033984362 7:147205243-147205265 CTGGAGACTTAGAAGGAGGGAGG - Intronic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034748618 7:153547083-153547105 CTGGTGAGACAGAAGGAAGGAGG - Intergenic
1035138666 7:156734479-156734501 ATGGAGAGTCAGAAGGGAGAGGG + Intronic
1035232727 7:157476125-157476147 CTGGAGAATGAGAAACAGGATGG + Intergenic
1035309597 7:157956991-157957013 CTAGAGAGTAAGAAGGAAAAGGG + Intronic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1036531758 8:9596368-9596390 GTTGAGAATGAGAAGTAAGAAGG - Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1036727098 8:11230117-11230139 CTGGTGCTTCAGAAGGAAGTGGG + Intergenic
1036783212 8:11664785-11664807 TTAGAGACTCAGAAGAAAGAGGG - Intergenic
1037250992 8:16894065-16894087 CTGGAGACTCAGAAGGGAGGAGG - Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1037514954 8:19620870-19620892 CAGGAGCATCAGAGGGAACATGG + Intronic
1037581960 8:20250689-20250711 CAGGAGAATCAGAGGGGAGGCGG - Intronic
1037813279 8:22098934-22098956 CTGGGTAACCTGAAGGAAGAGGG - Exonic
1038324819 8:26564927-26564949 TTGGAGACTCAGAAGAAGGAGGG - Intronic
1038397604 8:27258613-27258635 CTGGAGAACCAGAGGGGTGAGGG + Intergenic
1038932233 8:32206791-32206813 CTGGAGACTCAGAAGGGTGGAGG - Intronic
1038945041 8:32349836-32349858 ACAGAGAATCAGAAAGAAGATGG - Intronic
1040087320 8:43358137-43358159 TTGGAGACTCAGAAGAAGGAAGG - Intergenic
1041043956 8:53874344-53874366 CCAGAGAATCAGAAGCAATAAGG + Intronic
1041304363 8:56445459-56445481 CTGGGCTGTCAGAAGGAAGATGG - Intronic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041741361 8:61160483-61160505 CTGCAGGAGCAGAAGGAAAATGG + Intronic
1041753653 8:61288754-61288776 ATGGAGAATCACCAGGAAGCAGG + Intronic
1041756717 8:61321906-61321928 CTGGAGTACAAGTAGGAAGAGGG - Intronic
1041893551 8:62898545-62898567 TTGGAGACTCAGAAGGGAGGAGG + Intronic
1042083317 8:65081065-65081087 CTGTAGAATCCCAAGTAAGATGG + Intergenic
1042215275 8:66424952-66424974 CTAGAGGAGCAGGAGGAAGATGG + Intergenic
1042784496 8:72533329-72533351 TTGGAGACTCAGAAGGGGGAAGG - Intergenic
1042944904 8:74144989-74145011 CTGGAGAATGAGAAGGGCCAGGG + Intergenic
1043500757 8:80852685-80852707 CTTGGGAATTAGTAGGAAGAGGG - Intronic
1043509139 8:80932416-80932438 CTGCAGAATCAGAAAGGAAAGGG + Intergenic
1044376044 8:91472300-91472322 CTGCAAAATCAGAAAGGAGATGG - Intergenic
1044489317 8:92793311-92793333 CTGAAGAGTCAGAGGGAAGTAGG + Intergenic
1044664717 8:94623343-94623365 GTGGAGAATGAGAAGTTAGAGGG + Intergenic
1044725104 8:95188300-95188322 GTGGAGAAGCAGAAGGCAGCAGG + Intergenic
1044735301 8:95272502-95272524 CTGGAGACTCAGAAGAGAGGAGG - Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045043457 8:98250348-98250370 CTAGAGAATTTGAAGGAAAAGGG - Intronic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045332313 8:101166032-101166054 CTATAGAAAAAGAAGGAAGAGGG + Intergenic
1045480088 8:102584831-102584853 CTGCAGAGTCTGAAAGAAGAGGG - Intergenic
1046509897 8:115188966-115188988 AGAGAGAATCAGAAGGATGAAGG - Intergenic
1047106078 8:121731900-121731922 TTGGAGACTCAGAAGGAAGAGGG - Intergenic
1047403703 8:124567624-124567646 CTGGAAAAGCACAAGAAAGAAGG - Intronic
1047948934 8:129911799-129911821 CAGGAGATCCAGAAGTAAGAAGG - Intronic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048061217 8:130921019-130921041 CTGGAGAAACAGAACCAACAGGG - Intronic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048504534 8:135008853-135008875 CTGGAGAATGAGAGGAGAGAGGG + Intergenic
1048672302 8:136736758-136736780 CAGGTGAGTCAGAAGGCAGAGGG + Intergenic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1051694321 9:19751794-19751816 CTGGAGGATCAGACGTAGGAAGG + Intronic
1051807241 9:21008614-21008636 CTGGTGGTTAAGAAGGAAGAAGG - Intronic
1052081925 9:24216838-24216860 CTGGAAAAAAAGAAGGAAGTTGG - Intergenic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1052768674 9:32667751-32667773 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053107380 9:35422982-35423004 TTGGAGACTCAGAAGGGGGAGGG + Intergenic
1053318651 9:37075634-37075656 CTGGAAAATAAAAAGGAAGGAGG + Intergenic
1053409319 9:37905245-37905267 CTGGAAATTCAGAAGCATGAGGG + Intronic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1053524852 9:38818032-38818054 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1053532198 9:38893854-38893876 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1053539047 9:38954685-38954707 CTGGAGAATAAGTTGGAAGAAGG + Intergenic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053750017 9:41243742-41243764 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1054197086 9:62042448-62042470 CTGGAGACTCAGAAGCGGGAGGG - Intergenic
1054204421 9:62118263-62118285 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054255516 9:62808080-62808102 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054335789 9:63807528-63807550 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054627094 9:67409234-67409256 CTGGAGAATAAGTTGGAAGAAGG - Intergenic
1054633940 9:67470101-67470123 TTGGAGACTCAGAAGCAGGAAGG - Intergenic
1054641322 9:67546246-67546268 CTGGAGACTCAGAAGCGGGAGGG + Intergenic
1054741961 9:68815318-68815340 TTTAAGAATCAGAAGAAAGAAGG + Intronic
1054878221 9:70118724-70118746 CTGGAGAAACAGCACGTAGAAGG + Intronic
1055862409 9:80768406-80768428 TCAGAGAGTCAGAAGGAAGACGG + Intergenic
1056207265 9:84332419-84332441 CTGGAGAATTAGGAGGGATAGGG + Intronic
1057761411 9:97877655-97877677 CTGGAGAAGAAGAAAGAAGATGG + Intergenic
1058276494 9:103048039-103048061 TTAGAGAATCAGAAGGGGGAGGG + Intergenic
1058318947 9:103606005-103606027 CTGGAGAAACTGAAGGAATGGGG - Intergenic
1058363760 9:104182989-104183011 CTGGAGATGCAGAAACAAGAAGG + Intergenic
1058463933 9:105209617-105209639 ATGGAGACTCAGAAGGAGAAGGG - Intergenic
1058583556 9:106483757-106483779 CTGGAGAATCAGATGCAGGGAGG - Intergenic
1058587462 9:106525602-106525624 CTGGAGACTCAGAAGGGGGTGGG + Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1059418691 9:114177799-114177821 CTGCAGAATCAGAACAGAGAAGG - Intronic
1059491691 9:114673061-114673083 CTGGACTCTCAGAAGGACGAAGG + Intergenic
1059657349 9:116368679-116368701 CTGGAGAAACCGAAAGAAGGAGG + Intronic
1060036640 9:120261534-120261556 CTGGAGAGGGAGAAGGCAGAGGG + Intergenic
1060204602 9:121675112-121675134 TTGGCGACTCAGCAGGAAGATGG - Intronic
1060290716 9:122300056-122300078 GTGGAGAAAGGGAAGGAAGAGGG + Intronic
1061505053 9:131027081-131027103 CTAATGAACCAGAAGGAAGACGG + Intronic
1062695497 9:137873743-137873765 CTGGAGGGTCCGGAGGAAGATGG + Intergenic
1203375716 Un_KI270442v1:374937-374959 ATGGAGAACCAGGAGAAAGAAGG + Intergenic
1185634717 X:1543311-1543333 CTGGACATTCAGACGGAAGAGGG + Intergenic
1185998961 X:4987314-4987336 TTGGAGACTCAGAAGCAGGAAGG + Intergenic
1186582956 X:10840624-10840646 TTGGAGAAAGAGAAGGAAGGCGG - Intergenic
1186826308 X:13343548-13343570 TTGGAGACTCAGAAGGGAGGAGG - Intergenic
1186835861 X:13437159-13437181 TTGGAGACTCAGAAGGGTGAGGG + Intergenic
1187217185 X:17288558-17288580 CTGGCCAATCTGAAGGAAGGTGG + Intergenic
1187274891 X:17808569-17808591 CTGGGAAGTAAGAAGGAAGATGG - Intronic
1187348342 X:18488505-18488527 CTGGTCAACCAGAAAGAAGAAGG + Intronic
1187424960 X:19168985-19169007 TTTGAGAGTCAGAGGGAAGAGGG - Intergenic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1188303982 X:28539840-28539862 ATGCAGACACAGAAGGAAGATGG + Intergenic
1188486463 X:30687510-30687532 CTGGAGCATTAGAAGAAATAAGG - Intronic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1190879478 X:54482616-54482638 CTGGTGAATGGGAAGGGAGATGG - Intronic
1191834546 X:65449839-65449861 TTGGAGACTCAGAAGCATGAGGG + Intronic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1193317113 X:80077137-80077159 GTGGGGAATCACAGGGAAGAGGG + Intergenic
1193470943 X:81902571-81902593 TTGGAGACTCAGAAGGGGGAGGG - Intergenic
1193617174 X:83703485-83703507 TTGGAGACTCAGAAGTAGGAGGG - Intergenic
1194615312 X:96093651-96093673 TTGGAGACTCAGAAGGGAGGAGG + Intergenic
1194695109 X:97038013-97038035 CTGGAGACTCAGAAGGGGGTAGG - Intronic
1194859940 X:98985600-98985622 CAGGAGAAAGAGAAAGAAGAGGG + Intergenic
1194874478 X:99169671-99169693 CTGGAGACTCAAAAGCAAGGAGG + Intergenic
1195010283 X:100726931-100726953 ATGGAGACTCAGAAGGGTGAGGG - Intronic
1195070358 X:101273249-101273271 CTGGAGAATGGGTTGGAAGAAGG - Intronic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1196011196 X:110889694-110889716 CTAGAGGATCAGGAGGTAGAGGG + Intergenic
1196109729 X:111932987-111933009 CTGGAACAGCAGAAAGAAGATGG - Intronic
1196557934 X:117112704-117112726 TTGGAGACTCAGAAGCAGGAGGG + Intergenic
1197053375 X:122088259-122088281 GTGGAGTCTCAGAAGGAAAAGGG - Intergenic
1197571314 X:128154156-128154178 TTGGAGACTCAGAAGTAGGAGGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1198038327 X:132823431-132823453 TTAGAGACTCAGAAGGAGGAGGG - Intronic
1198052847 X:132965135-132965157 CTGGAGAATTTGAAGGAAGCAGG + Intergenic
1198064209 X:133080258-133080280 CAGGAGAATCAGAAGAAAGAAGG + Intronic
1198110861 X:133501653-133501675 CTGGGAAATCAGAGGCAAGATGG - Intergenic
1198278909 X:135123332-135123354 GTGGAGCATCAGGAGGAAGGTGG + Intergenic
1198292050 X:135249188-135249210 ATGGAGCATCAGGAGGAAGGTGG - Intronic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198479792 X:137030929-137030951 GTGGAGAATGAGGATGAAGAGGG - Exonic
1198543168 X:137662042-137662064 CTGAAGCTTCTGAAGGAAGATGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1200491400 Y:3827990-3828012 TTGGAGATTCAGAAGGGGGAAGG + Intergenic
1200709671 Y:6472242-6472264 CTGGAGCATGAGAAGGAGGCCGG - Intergenic
1200803100 Y:7404322-7404344 CAGGAGAATGAGAAAGAACACGG - Intergenic
1200910060 Y:8523971-8523993 ATGGGGAGCCAGAAGGAAGATGG - Intergenic
1200960203 Y:8989482-8989504 ATGGAGAGCCAGAAGGGAGATGG - Intergenic
1201024441 Y:9692466-9692488 CTGGAGCATGAGAAGGAGGCCGG + Intergenic
1201066313 Y:10098629-10098651 ATGGAGAACCAGGAGAAAGAAGG - Intergenic
1201742080 Y:17335120-17335142 CTGGAAAATCAGATAGAAAAGGG + Intergenic
1201761582 Y:17545266-17545288 ATGGAGAATGAGGAGAAAGAAGG + Intergenic
1201839970 Y:18360724-18360746 ATGGAGAATGAGGAGAAAGAAGG - Intergenic