ID: 1112691349

View in Genome Browser
Species Human (GRCh38)
Location 13:101898306-101898328
Sequence GAGATACTCAACCTGTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 2, 1: 0, 2: 6, 3: 35, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112691348_1112691349 -5 Left 1112691348 13:101898288-101898310 CCTAAGCATTTCACACAAGAGAT 0: 1
1: 4
2: 56
3: 323
4: 730
Right 1112691349 13:101898306-101898328 GAGATACTCAACCTGTATAAAGG 0: 2
1: 0
2: 6
3: 35
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112691349 Original CRISPR GAGATACTCAACCTGTATAA AGG Intronic
903664480 1:24997954-24997976 GAGATACTGACCCTGCATTAGGG + Intergenic
905943059 1:41879352-41879374 GAGATGCTCAATCCCTATAAGGG + Intronic
906997992 1:50818633-50818655 GGGAGACTCAAGCTGTATGAAGG - Intronic
908331823 1:63078507-63078529 TAGAGACTCAAACTGTAGAAGGG + Intergenic
910183915 1:84514577-84514599 CGGATACTCAACCTGTATAGTGG + Intergenic
910630766 1:89351622-89351644 GATATAATCATCCTGTTTAAAGG + Intergenic
915255964 1:154628984-154629006 GAGATGCTTAACCTCAATAAGGG - Intergenic
916709263 1:167388102-167388124 GAGATCCTCAAATTTTATAAAGG - Intronic
918054556 1:181008493-181008515 GAGATGCTCAACCTGTAATTTGG + Intronic
919868032 1:201798060-201798082 GAGATACGCAAACTGCAGAAGGG - Intronic
923607969 1:235461941-235461963 GAGATGTTCAACCTTTATTATGG + Intronic
924544292 1:245010649-245010671 GGGATACTCAGCCTGTAAAGTGG - Intronic
924931639 1:248737622-248737644 TAGTTTCTCCACCTGTATAATGG - Intronic
1062969226 10:1633289-1633311 GGGACACTCAACCTGTGTATGGG - Intronic
1067005046 10:42652782-42652804 GAGCTACTCTTCCTGCATAAAGG - Intergenic
1068308907 10:55253996-55254018 GAGATACTAAACGTTTTTAAAGG - Intronic
1071738777 10:88332702-88332724 TAGATAGTTAACCTGTAAAAAGG - Intronic
1074038648 10:109766227-109766249 GAGGTTTTCAACCTGTAGAATGG + Intergenic
1077513433 11:2984900-2984922 GAGATACTCAACCTGTATAAAGG - Intronic
1078353034 11:10610835-10610857 GTTATCCTCATCCTGTATAATGG + Intronic
1080665281 11:34330539-34330561 GAGAAACTGTACCTGTATTAGGG + Intronic
1083314724 11:61807415-61807437 GGAATACTTAACCTGTATAGGGG - Intronic
1085204114 11:74720132-74720154 GAGATAATTAACTTCTATAAGGG - Intronic
1089658733 11:119971744-119971766 GAGATCCTCTGCCTGTAAAATGG + Intergenic
1099867830 12:88306137-88306159 AAGATACTAAACTTGTATTAAGG - Intergenic
1102441782 12:112969276-112969298 GAAATACTCAACCTGTATCATGG + Intronic
1104195227 12:126530739-126530761 GGTATACTCAACCTGTACCAAGG - Intergenic
1104723398 12:131059544-131059566 GGGATCCTCAACCTGTATAAAGG - Intronic
1105742533 13:23342651-23342673 GGGACACCCAACCTGTATGAAGG + Intronic
1106824124 13:33500891-33500913 GAGATAACCAACTTGTATTAAGG + Intergenic
1107593175 13:41930493-41930515 GAGCTGCTCAACCTGTATCATGG - Intronic
1107730285 13:43341617-43341639 GAGATACTCAAACGGTTTACTGG + Intronic
1107781291 13:43905292-43905314 GAGATACTCAACTTCTAGTAAGG - Intergenic
1108835226 13:54537532-54537554 CACATAATAAACCTGTATAATGG + Intergenic
1110124667 13:71927745-71927767 GAGATTCCCATCCAGTATAAAGG + Intergenic
1112343672 13:98573132-98573154 GGGATACTCAACCCGTAGTAAGG + Intronic
1112691349 13:101898306-101898328 GAGATACTCAACCTGTATAAAGG + Intronic
1113776159 13:112946682-112946704 CAGATACAGAACCTGAATAAAGG + Intronic
1114003959 14:18291706-18291728 GAGATTCACAACTTTTATAAAGG - Intergenic
1114803574 14:25807182-25807204 GAGCTACTCAAACTTTACAATGG + Intergenic
1116523981 14:45882753-45882775 GGGATACTCAAACTATATAAAGG + Intergenic
1116690060 14:48094390-48094412 GAGGAACTCAACTTGTATTAGGG - Intergenic
1117150208 14:52879383-52879405 GGGACACTCAACTGGTATAATGG - Intronic
1117221494 14:53610854-53610876 CAGATTCTCTACCTGTAAAATGG + Intergenic
1118534737 14:66748608-66748630 GGGATATTCAACCTGTATAATGG - Intronic
1119610951 14:76061727-76061749 GGGATACTCAGTCTATATAAAGG - Intronic
1119895827 14:78219193-78219215 GAAATAGTCACCCTGTATATTGG - Intergenic
1123388424 15:19843926-19843948 GAGATTCACAACTTTTATAAAGG - Intergenic
1123738446 15:23210002-23210024 CAGATTCTCAACCTGTAGAATGG + Intergenic
1124289656 15:28438666-28438688 CAGATTCTCAACCTGTAGAATGG + Intergenic
1124293565 15:28478645-28478667 CAGATTCTCAACCTGTAGAATGG - Intergenic
1125828886 15:42697856-42697878 GGGGTACTCAACCTGTAAAAGGG + Intronic
1128180381 15:65597960-65597982 GGGATACTCAACCTGTACTAGGG - Intronic
1133084327 16:3350029-3350051 AAAATACTCAAACTGTAAAAGGG + Intergenic
1134120413 16:11580202-11580224 GAGATACTTGATCTGTGTAAAGG + Intronic
1134278115 16:12794737-12794759 GGGATGCTCAACCTGTACAAAGG + Intronic
1135598233 16:23759809-23759831 CACATATTCAGCCTGTATAAAGG + Intergenic
1136709021 16:32217983-32218005 CAGATTCTCAACCTGTAGAATGG - Intergenic
1136758888 16:32711441-32711463 CAGATTCTCAACCTGTAGAATGG + Intergenic
1136809219 16:33158943-33158965 CAGATTCTCAACCTGTAGAATGG - Intergenic
1136815695 16:33269023-33269045 CAGATTCTCAACCTGTAGAATGG - Intronic
1138041306 16:53671370-53671392 GAAATATGCAAACTGTATAAAGG - Intronic
1140486555 16:75298266-75298288 GGGATATTCAACCTGTATCTGGG + Intronic
1142116176 16:88357251-88357273 CAGTTTCTCAACCTGTACAATGG + Intergenic
1203061044 16_KI270728v1_random:971766-971788 CAGATTCTCAACCTGTAGAATGG + Intergenic
1147162279 17:38575118-38575140 GAGATACCCAGCCTAAATAAGGG - Intronic
1154533817 18:15376106-15376128 GAGATTCACAACTTTTATAAAGG + Intergenic
1157049572 18:44146124-44146146 GAGAGATTAAACCTGTAAAATGG + Intergenic
1158091504 18:53719360-53719382 AAGATCCTCAACATGTAGAAAGG - Intergenic
1158614954 18:58978662-58978684 GGGATACTCAACCTGTATTTAGG - Intronic
1162239111 19:9334386-9334408 GAGATATTCAACCTGTATTATGG + Intronic
1165949451 19:39465833-39465855 GAGACACTCAACGTGTATTAGGG - Intronic
927396963 2:22663356-22663378 GAGATACTCTTCCTTCATAAAGG + Intergenic
928740534 2:34347011-34347033 GGGATAGTCAACCTGTATTTAGG - Intergenic
931335131 2:61333468-61333490 GGCATACTCAACCTGTAATAAGG + Intronic
936069929 2:109360616-109360638 AAGATACTCAGCCTGTATATAGG + Intronic
937777440 2:125795743-125795765 GGGATACTCAACCTATATTTAGG - Intergenic
938032110 2:128003735-128003757 GGTATACTCAACCTGTAATATGG - Intronic
938532565 2:132203402-132203424 GAGATTCACAACTTTTATAAAGG + Intronic
938879987 2:135575503-135575525 GGGATAGTCAACCTGTAATATGG + Intronic
940118202 2:150233774-150233796 GGGATACTCAACTTGTATTAGGG + Intergenic
940482546 2:154253271-154253293 GTGATAATCACCCTGTATAGAGG - Intronic
945590101 2:211718337-211718359 GGGATACTCAATGTGTGTAAGGG - Intronic
945702571 2:213190103-213190125 AATATACACAACCTGTATGAAGG + Intergenic
947410426 2:229832452-229832474 GAAATACTGAAGTTGTATAAAGG + Intronic
947880211 2:233502317-233502339 GGGATACTCAACCTGTAATTGGG - Intronic
1170238857 20:14140095-14140117 GGGATACTCAACCTGTAGTAAGG + Intronic
1170368398 20:15621490-15621512 GAGATTCTCAAACTGTTTAGAGG - Intronic
1176875482 21:14122660-14122682 GAGCTACTCCCCCTGTATATAGG - Intronic
1177474836 21:21606741-21606763 GGGATACTCAGCCTGTAAAAGGG - Intergenic
1178054380 21:28783008-28783030 GGGATACTCAACCTGTATCAGGG - Intergenic
1180428475 22:15222509-15222531 GAGATTCACAACTTTTATAAAGG - Intergenic
1182050464 22:27309237-27309259 GAGAGACTAAATCTGTCTAAAGG + Intergenic
1185003402 22:48260742-48260764 GAGAGAGTCAACCTGAATTAAGG + Intergenic
949176427 3:1068538-1068560 GAGATAGTCACCCTGGATTATGG - Intergenic
952742017 3:36743093-36743115 GGGATACTCAACCGGTATGAGGG - Intergenic
953294378 3:41698607-41698629 GGGATAATCAACCTGTATATAGG + Intronic
953686655 3:45083222-45083244 GAGATGCTGACCCTGCATAAAGG - Exonic
964050396 3:152385552-152385574 GAGTTACCCAACATGTAAAAAGG - Intronic
965591594 3:170365338-170365360 GGGATGCTCAACCTGTACTAAGG - Intronic
968349523 3:198041597-198041619 GTGATGCTCAACCTGCGTAATGG + Intronic
972361495 4:38329560-38329582 CAGACACTCAAGCTGGATAACGG - Intergenic
972739953 4:41879633-41879655 GAGATAATAAAGCTGTTTAAAGG + Intergenic
973690648 4:53426542-53426564 GGAATACTCAACTTGTATATAGG + Intronic
976220194 4:82750769-82750791 GAGATTCACTACCTGTAAAATGG - Intronic
978795506 4:112704732-112704754 GAGATACTGAAACTTTGTAAAGG + Intergenic
979314721 4:119248446-119248468 GAGATACCCAACCTGTATTTCGG - Intronic
980459758 4:133093569-133093591 GAGTTACTGAACCTTCATAATGG - Intergenic
981784069 4:148457821-148457843 GAGATTAACAACCTATATAATGG + Intergenic
984096917 4:175445808-175445830 GAGCTAATCAAACTGTAAAAAGG - Intergenic
989098277 5:37800963-37800985 GAGAGATTCACCCTGAATAAGGG - Intergenic
990751245 5:59019121-59019143 GAAATTCTAAACCTGAATAATGG - Intronic
993277842 5:85884344-85884366 GAGGTAATCAAAATGTATAAAGG - Intergenic
996461208 5:123745172-123745194 GAGATATTCAACCAGTATATGGG - Intergenic
996522578 5:124443616-124443638 TAGATACTCAACCTCTTTGAAGG + Intergenic
997575410 5:134972092-134972114 GGGATGCTCAGCCTGTATAAGGG - Intronic
999588253 5:153115282-153115304 CAGATACACAACCTGTACAAAGG + Intergenic
1003699135 6:8442876-8442898 GAGATACTCAACCTCTAGAAAGG - Intergenic
1004312109 6:14554861-14554883 GAGAAGCCCACCCTGTATAAGGG + Intergenic
1004561630 6:16758489-16758511 TAGCTACTCAACTTTTATAAAGG - Intronic
1007913937 6:45542976-45542998 GAGTTCCTCAACCAGCATAAAGG + Intronic
1016149614 6:140723380-140723402 GAGATGCTCAACCTGTACAGTGG + Intergenic
1016602197 6:145875147-145875169 GGGATACTCATCCTGTACCATGG + Intronic
1016603407 6:145889756-145889778 GGGATGCTCAACCTGTACAAGGG + Intronic
1020691509 7:11360474-11360496 GGGATGCTCAACCTGTAATAAGG + Intergenic
1021144535 7:17068664-17068686 GGGATACTCAACTTGTACAAAGG + Intergenic
1021234849 7:18130283-18130305 ATAATGCTCAACCTGTATAAAGG + Intronic
1027966354 7:85015004-85015026 GAGATATTCAGCTTGTAGAAAGG + Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1033008855 7:137597347-137597369 GACATACTTTACCTGTATATGGG - Intronic
1037148348 8:15602213-15602235 GGGATACTCAGCCTATATATAGG + Intronic
1038176634 8:25186089-25186111 GAGCTACTCAACGTGTCTAGGGG + Intronic
1038478485 8:27885496-27885518 GAGATACCCAGCCTGTGCAAAGG + Intronic
1038739541 8:30204913-30204935 GGGATACTCAACCTGTATTCTGG - Intergenic
1038812450 8:30863306-30863328 GGGATGCTAAACCTGTATTATGG + Intronic
1039374335 8:37018271-37018293 AGGGTACTCAACCTGTATATGGG + Intergenic
1039510000 8:38083972-38083994 GAGCTACTCTCCCTGCATAAAGG + Intergenic
1042760208 8:72264104-72264126 GAGACTGTCAACTTGTATAAAGG - Intergenic
1044177180 8:89141567-89141589 GATATAATCAACCTGAAGAAAGG - Intergenic
1047293453 8:123550389-123550411 GATCTACTAATCCTGTATAAAGG + Intergenic
1047455628 8:125007571-125007593 GAGATACTCAACATGTAAACCGG - Intronic
1050314824 9:4390741-4390763 CAGATACTCATCCTATACAATGG + Intergenic
1051327357 9:15987692-15987714 GGGATACTCAACCTGTATTTTGG - Intronic
1051587558 9:18742716-18742738 CAGAAACTCACTCTGTATAAAGG + Intronic
1053324218 9:37128137-37128159 GAGAGACTAAACCTGTTTGATGG + Intronic
1053685700 9:40519417-40519439 GAGATTCACAACTTTTATAAAGG + Intergenic
1053711176 9:40809996-40810018 GAGATTCACAACTTTTATAAAGG + Intergenic
1054278032 9:63105546-63105568 GAGATTCACAACTTTTATAAAGG - Intergenic
1054298784 9:63354871-63354893 GAGATTCACAACTTTTATAAAGG + Intergenic
1054396806 9:64659388-64659410 GAGATTCACAACTTTTATAAAGG + Intergenic
1054421086 9:64930813-64930835 GAGATTCACAACTTTTATAAAGG + Intergenic
1054431447 9:65164592-65164614 GAGATTCACAACTTTTATAAAGG + Intergenic
1054498932 9:65856935-65856957 GAGATTCACAACTTTTATAAAGG - Intergenic
1054894870 9:70297535-70297557 GGGATATTCAACCTGTAATAGGG + Intronic
1055082648 9:72282204-72282226 GTGATATTTAACCTGTAGAAAGG + Intergenic
1056648717 9:88438692-88438714 GGGATGCTCAACCTATATTATGG - Intronic
1057748196 9:97769313-97769335 GAGATACGCAAACTGTAAAAAGG - Intergenic
1058005810 9:99912554-99912576 CAAAGACACAACCTGTATAAAGG - Intronic
1058633544 9:107014364-107014386 GAGATACTCAACCTTTTCTAAGG + Intergenic
1060976401 9:127767675-127767697 GAGCTACTCATGCTGTAGAAGGG - Intronic
1187397320 X:18930141-18930163 GATATACTTAACATGTATACAGG - Intronic
1188581604 X:31720495-31720517 GAGATACTCTACATGTTTATAGG - Intronic
1189720752 X:43914233-43914255 GAGATACTCAGGCTAAATAAAGG - Intergenic
1192603740 X:72491840-72491862 CAGATAATCAATCTGTAAAATGG + Intronic
1192823588 X:74670162-74670184 GAGGTAGTCAACCTTTATGAAGG + Intergenic
1193759822 X:85450846-85450868 GAGATACTTAACCTCTATCTGGG + Intergenic
1193871765 X:86806775-86806797 GGGATCCTCAACCTGTAGAAGGG + Intronic
1196801337 X:119545982-119546004 GAGATACCTGACCTGTATCAGGG - Intronic
1197962239 X:132019860-132019882 GGGATACTCAACCTGAATAGAGG + Intergenic
1198185145 X:134247523-134247545 GAGATGTTCAAACTATATAAAGG - Intergenic